The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	0	6309	5135675		Bacillus_phage(100.0%)	4	NA	NA
WP_000627995.1|806_2171_+	nucleotide 5'-monophosphate nucleosidase	NA	NA	NA	NA	NA
WP_000450476.1|2727_4017_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_032207632.1|4074_5442_+	L-serine ammonia-lyase II	NA	NA	NA	NA	NA
WP_032207634.1|5553_6309_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 2
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	17835	26689	5135675	tRNA	environmental_halophage(25.0%)	7	NA	NA
WP_032207641.1|17835_19041_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	3.9e-73
WP_000184246.1|19040_19484_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|19534_20341_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|20417_21515_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|21984_23238_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|23469_24801_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775975.1|24862_26689_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	1.6e-25
>prophage 3
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	30222	33111	5135675		Klosneuvirus(100.0%)	1	NA	NA
WP_032207645.1|30222_33111_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	26.0	2.1e-69
>prophage 4
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	38588	45360	5135675		Geobacillus_virus(33.33%)	5	NA	NA
WP_000816232.1|38588_39383_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000957914.1|40414_42661_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|42673_43204_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|43888_44578_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|44646_45360_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 5
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	54991	57486	5135675		Aichi_virus(50.0%)	2	NA	NA
WP_000256437.1|54991_56410_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|56724_57486_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 6
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	64932	68734	5135675	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_106918762.1|64932_66205_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	4.4e-176
WP_001232281.1|66769_67090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001570270.1|67123_67330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272558.1|67978_68734_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 7
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	93216	108607	5135675	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_032207668.1|93216_94617_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_032207670.1|94634_95951_+	guanine deaminase	NA	NA	NA	NA	NA
WP_032207672.1|95986_97354_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_032207674.1|97389_97878_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001350545.1|97877_99797_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|100232_101681_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|101682_101808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|101804_101876_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192804.1|101930_102479_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|102521_104039_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|104048_105147_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_032207675.1|105237_106971_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.6e-59
WP_000715227.1|106976_107687_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|107710_108607_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 8
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	115029	117903	5135675		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000195050.1|115029_117903_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
>prophage 9
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	126430	127663	5135675		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|126430_127663_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 10
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	145668	146346	5135675		Bacillus_virus(100.0%)	1	NA	NA
WP_000956893.1|145668_146346_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	4.9e-09
>prophage 11
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	158984	160139	5135675		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|158984_160139_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 12
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	187225	190443	5135675	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_106888188.1|187225_188498_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.9e-175
WP_001145628.1|189804_190443_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	42.7	9.0e-45
>prophage 13
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	213848	215387	5135675		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723928.1|213848_215387_+	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
>prophage 14
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	226159	236941	5135675	protease,transposase	Stx2-converting_phage(25.0%)	5	NA	NA
WP_077744848.1|226159_226777_+	T3SS effector protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	77.2	4.5e-78
WP_032207120.1|229086_233178_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_106918763.1|233724_234880_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.6e-68
WP_000854916.1|235039_235417_+	toxin	NA	NA	NA	NA	NA
WP_106888148.1|235728_236941_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
>prophage 15
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	287073	287958	5135675		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_032205976.1|287073_287958_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.8	1.1e-64
>prophage 16
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	294033	304855	5135675		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000013149.1|294033_294861_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000848528.1|296036_296294_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_032205978.1|296336_298556_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_032205979.1|298666_300079_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|300153_300891_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|301123_303382_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183494.1|303927_304410_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|304462_304855_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 17
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	309812	324822	5135675	transposase	Bacillus_virus(16.67%)	15	NA	NA
WP_000195296.1|309812_311705_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_032205982.1|311733_312315_-	esterase YqiA	NA	NA	NA	NA	NA
WP_032205983.1|312314_313142_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|313166_313589_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917130.1|313589_314219_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	33.0	4.6e-17
WP_032205984.1|314423_315905_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|316052_316724_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|316729_317890_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_074433646.1|317927_318743_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001314167.1|318858_319632_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|319689_319860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|320120_320774_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_001297598.1|321147_321438_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_001272147.1|321721_322273_+	fimbrial-like protein	NA	NA	NA	NA	NA
WP_106918764.1|323593_324822_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	3.6e-175
>prophage 18
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	331624	333058	5135675		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032205991.1|331624_333058_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	5.7e-39
>prophage 19
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	338195	339434	5135675	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|338195_339434_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 20
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	345816	362000	5135675	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264369.1|345816_346830_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	3.7e-109
WP_001144069.1|347067_347283_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032205995.1|347393_349139_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.4e-76
WP_000437371.1|349333_351175_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228940.1|351252_351759_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_032205996.1|352012_352777_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000017986.1|353053_353677_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032205997.1|353830_355351_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	5.3e-35
WP_122993085.1|355657_357148_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	6.3e-33
WP_000450589.1|357189_357522_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212443.1|357740_358724_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082882.1|358907_362000_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
>prophage 21
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	374645	375611	5135675		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|374645_375611_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 22
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	403156	405451	5135675		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|403156_405451_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 23
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	413426	414572	5135675		Streptococcus_phage(100.0%)	1	NA	NA
WP_032208129.1|413426_414572_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	1.3e-49
>prophage 24
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	437581	445374	5135675		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809256.1|437581_438442_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	1.2e-49
WP_032208151.1|438505_440542_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_032208153.1|440499_440895_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|440914_441505_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646043.1|441514_442090_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147624.1|442203_443244_-	permease	NA	NA	NA	NA	NA
WP_032208154.1|443316_443952_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037607.1|444079_444598_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_000449031.1|444577_445021_-	YhbP family protein	NA	NA	NA	NA	NA
WP_032208156.1|445071_445374_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	1.1e-13
>prophage 25
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	451201	453091	5135675		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|451201_453091_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 26
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	458572	465211	5135675		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|458572_461245_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|461269_462757_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|462784_463237_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207684.1|463867_465211_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 27
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	468412	471285	5135675	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|468412_469261_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|469350_471285_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 28
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	477912	479389	5135675		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|477912_478884_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|479110_479389_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 29
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	483457	498252	5135675		Staphylococcus_phage(25.0%)	17	NA	NA
WP_032208171.1|483457_484267_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922872.1|484476_485454_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|485467_486454_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|486474_487041_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|487037_487613_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|487581_488139_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|488145_488871_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|488918_490352_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|490374_490662_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_032208173.1|490779_491271_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|491316_492171_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|492167_492440_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|492653_493286_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_032208175.1|493282_494011_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|494007_494661_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|494890_497227_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|497322_498252_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 30
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	505497	572221	5135675	tRNA,protease,transposase	uncultured_Mediterranean_phage(16.67%)	59	NA	NA
WP_000639208.1|505497_505803_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000979880.1|505878_506343_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209007.1|506339_507215_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|507211_507901_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108473.1|507948_509439_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|509548_510442_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_032208179.1|510563_511355_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_032208181.1|511734_513102_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000366129.1|513144_513642_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_032208183.1|513647_514286_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|514680_515073_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|515088_515517_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192305.1|515735_516863_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|517056_517455_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001295271.1|517608_518976_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|519065_520133_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_012565174.1|520195_521134_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032208186.1|521568_522039_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695690.1|522403_522667_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029013.1|522722_522995_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_032208188.1|523086_525054_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854021.1|525059_525992_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051841.1|525999_526203_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440317.1|526385_527315_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055909.1|527442_528888_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_032208189.1|529043_532844_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123197.1|532911_534381_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000203096.1|534370_534964_-	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000179409.1|534972_535461_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802516.1|535460_536564_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|536629_537673_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241456.1|537977_539918_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_032208190.1|540069_541044_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000354622.1|542776_543247_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884639.1|543257_544607_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000787051.1|544698_545745_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000048610.1|545741_546704_-	sugar kinase	NA	NA	NA	NA	NA
WP_050439359.1|546700_547714_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000132908.1|547714_549214_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
WP_032208192.1|549274_550165_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060552893.1|550200_551055_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|551396_552227_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_001446002.1|552258_553194_+	sugar kinase	NA	NA	NA	NA	NA
WP_001446003.1|553286_553529_+	YhdT family protein	NA	NA	NA	NA	NA
WP_032208194.1|553518_554970_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_032208195.1|554981_555863_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219652.1|556191_557157_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|557182_557479_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_032208196.1|557564_558449_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	5.4e-24
WP_001355779.1|558532_558712_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001129518.1|558714_559377_-	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_000160337.1|559775_560933_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_000825639.1|564300_564522_+	membrane protein	NA	NA	NA	NA	NA
WP_000738579.1|564952_565978_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_032208197.1|566045_567227_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106888148.1|567283_568496_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_106918765.1|568622_569779_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_047619141.1|570126_570696_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_085947598.1|571059_572221_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 31
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	593592	595095	5135675		Burkholderia_virus(100.0%)	1	NA	NA
WP_032206021.1|593592_595095_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 32
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	599917	600706	5135675		Cedratvirus(100.0%)	1	NA	NA
WP_032206023.1|599917_600706_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 33
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	606309	607925	5135675		Bacillus_virus(50.0%)	2	NA	NA
WP_001075518.1|606309_607068_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
WP_000611429.1|607244_607925_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 34
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	611910	613896	5135675		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032206030.1|611910_613896_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	2.1e-148
>prophage 35
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	619141	621289	5135675		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|619141_621289_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 36
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	630685	632644	5135675		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032206035.1|630685_632644_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 37
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	638227	639577	5135675		Moraxella_phage(100.0%)	1	NA	NA
WP_047087756.1|638227_639577_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	70.2	2.3e-159
>prophage 38
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	643394	647007	5135675		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|643394_643931_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|644184_647007_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 39
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	651196	695502	5135675	tRNA,terminase,integrase,tail,holin,head,capsid,transposase	Stx2-converting_phage(42.86%)	49	654460:654476	688236:688252
WP_032206040.1|651196_652276_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	6.8e-29
WP_000918363.1|652328_653744_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235516.1|653826_654810_+	quinone oxidoreductase	NA	NA	NA	NA	NA
654460:654476	attL	GTGGTGTACGATTCCGT	NA	NA	NA	NA
WP_000891404.1|654975_655218_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543841.1|655351_656389_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332258.1|656477_657575_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	8.1e-211
WP_047618033.1|657636_657885_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	5.0e-36
WP_001143783.1|658045_658687_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.5	1.3e-107
WP_072140863.1|658768_659398_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118085.1|659465_660047_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_047619066.1|660157_660427_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	3.9e-42
WP_060552894.1|660428_661742_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	3.1e-76
WP_060552836.1|661806_662406_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	2.9e-106
WP_060552895.1|662472_665952_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.8	0.0e+00
WP_122993104.1|666197_666830_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	3.4e-105
WP_060552896.1|666775_667519_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	3.3e-147
WP_001357740.1|667524_668223_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807944.1|668222_668564_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_060552897.1|668556_671799_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.6	0.0e+00
WP_122993099.1|671846_672056_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_001030063.1|672151_672526_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275477.1|672531_673248_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	1.9e-128
WP_000133391.1|673314_673659_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|673655_674102_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|674098_674449_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_047619202.1|674458_674785_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	3.5e-53
WP_032274028.1|676825_677047_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	9.9e-36
WP_047619207.1|677091_679029_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	96.7	0.0e+00
WP_060552898.1|679092_680754_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958416.1|680750_681314_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_024224188.1|681599_681965_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	97.5	5.4e-63
WP_000095741.1|682006_682207_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_001283921.1|682499_682757_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|682753_683251_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001135289.1|683887_684385_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000411802.1|684384_684591_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_060552899.1|684883_686734_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_060552900.1|687304_687736_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.6	8.7e-68
WP_106918768.1|687903_688134_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	3.0e-19
WP_047619199.1|688186_688411_-	hypothetical protein	NA	NA	NA	NA	NA
688236:688252	attR	ACGGAATCGTACACCAC	NA	NA	NA	NA
WP_047619201.1|688824_689313_-	antiterminator	NA	H6WZJ5	Escherichia_phage	99.4	1.6e-89
WP_106888148.1|690031_691244_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_001014286.1|692145_692334_+	hypothetical protein	NA	G9L660	Escherichia_phage	92.1	2.2e-23
WP_047087994.1|692336_693005_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.6	5.5e-61
WP_001061348.1|693004_693577_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	1.2e-109
WP_001093921.1|693613_693895_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
WP_014640052.1|694155_694542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249875.1|694571_695117_-	SocA family protein	NA	NA	NA	NA	NA
WP_071887528.1|695367_695502_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
>prophage 40
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	699447	700056	5135675		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|699447_700056_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 41
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	709178	710294	5135675		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|709178_710294_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 42
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	735757	739441	5135675		Dickeya_phage(100.0%)	1	NA	NA
WP_000095999.1|735757_739441_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 43
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	755521	757111	5135675		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|755521_757111_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 44
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	762478	764242	5135675		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|762478_762751_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|762937_763528_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|763570_764242_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 45
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	773605	781934	5135675		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|773605_777829_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|777905_781934_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 46
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	786053	789106	5135675		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|786053_787238_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|788155_789106_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 47
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	797609	799454	5135675		Acinetobacter_phage(100.0%)	1	NA	NA
WP_032206072.1|797609_799454_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 48
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	820617	823792	5135675		Hokovirus(50.0%)	3	NA	NA
WP_074433482.1|820617_822663_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	8.4e-12
WP_136757714.1|822584_823118_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_032206080.1|823129_823792_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	3.2e-29
>prophage 49
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	836659	838801	5135675		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032206089.1|836659_838801_-	DUF4329 domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	32.7	1.1e-14
>prophage 50
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	844438	848956	5135675		Erwinia_phage(50.0%)	5	NA	NA
WP_032206093.1|844438_845770_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.5	1.3e-45
WP_000139496.1|845836_846763_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|846869_847355_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|847439_847685_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_032206095.1|848110_848956_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.3	4.4e-15
>prophage 51
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	860531	865390	5135675		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_001033722.1|860531_861230_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|861226_862600_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|862705_863380_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001297064.1|864769_865390_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 52
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	880148	883199	5135675		Escherichia_phage(100.0%)	1	NA	NA
WP_077790937.1|880148_883199_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.4	2.2e-08
>prophage 53
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	890519	893299	5135675		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|890519_891305_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_032206114.1|891338_892235_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_032206115.1|892402_893299_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	89.9	8.1e-60
>prophage 54
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	909523	911994	5135675		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|909523_910573_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|910584_911994_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 55
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	916072	918859	5135675		Bacillus_phage(100.0%)	1	NA	NA
WP_032206120.1|916072_918859_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	34.0	1.6e-74
>prophage 56
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	932453	933068	5135675		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|932453_933068_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 57
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	941858	945145	5135675		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|941858_942635_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|942637_943153_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|943156_943426_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_032206423.1|943504_945145_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	6.3e-42
>prophage 58
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	957557	959387	5135675		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|957557_959387_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 59
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	966863	970722	5135675		Bacillus_phage(100.0%)	3	NA	NA
WP_000383411.1|966863_969026_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
WP_001213584.1|969109_969826_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_032206417.1|969828_970722_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 60
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	989163	995307	5135675		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|989163_990294_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145172.1|990298_990973_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|990950_991832_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_032206409.1|991850_992918_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	8.6e-101
WP_000006625.1|992917_994180_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|994176_995307_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 61
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	999349	999679	5135675		Indivirus(100.0%)	1	NA	NA
WP_001280776.1|999349_999679_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 62
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1002732	1004754	5135675		Bacillus_phage(100.0%)	1	NA	NA
WP_032206407.1|1002732_1004754_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
>prophage 63
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1013226	1014873	5135675		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012621.1|1013226_1014873_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	7.4e-67
>prophage 64
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1018413	1019626	5135675	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_106888077.1|1018413_1019626_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
>prophage 65
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1029668	1035520	5135675		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|1029668_1030559_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|1030583_1031549_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_032207986.1|1031552_1033058_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.6e-15
WP_032208010.1|1033065_1033485_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_032207989.1|1033651_1035520_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.7e-64
>prophage 66
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1038688	1039681	5135675		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_032207992.1|1038688_1039681_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 67
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1051633	1054995	5135675		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_024226301.1|1051633_1053004_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	1.8e-34
WP_032207995.1|1053165_1054995_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	9.5e-132
>prophage 68
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1060525	1064365	5135675		Cyanophage(50.0%)	4	NA	NA
WP_032208002.1|1060525_1061566_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	39.3	2.1e-51
WP_032208004.1|1061652_1062612_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|1062611_1063502_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_051123883.1|1063621_1064365_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.6	4.3e-14
>prophage 69
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1069806	1073699	5135675	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_106888184.1|1069806_1071079_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.1e-174
WP_032207471.1|1071531_1072197_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000019346.1|1072361_1073699_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
>prophage 70
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1083896	1091265	5135675		Staphylococcus_phage(33.33%)	8	NA	NA
WP_032207464.1|1083896_1084154_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|1084117_1084477_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|1084493_1084634_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|1084863_1084944_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|1085240_1086644_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_032207461.1|1086648_1087749_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	5.3e-53
WP_000060112.1|1087748_1088822_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_032207460.1|1088850_1091265_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	1.3e-115
>prophage 71
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1095970	1097119	5135675		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|1095970_1097119_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 72
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1101546	1102500	5135675		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|1101546_1101960_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|1102071_1102500_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 73
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1108845	1118006	5135675		Aeromonas_phage(25.0%)	10	NA	NA
WP_032207447.1|1108845_1110561_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.4	5.6e-41
WP_000828470.1|1110557_1112051_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.0	7.2e-29
WP_032207445.1|1112097_1112547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|1112655_1113003_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|1112992_1113355_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148053.1|1113351_1113849_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001362492.1|1113856_1115041_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|1115459_1115549_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|1116113_1116212_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_032207442.1|1116317_1118006_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	7.1e-57
>prophage 74
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1125311	1126646	5135675		Moraxella_phage(100.0%)	1	NA	NA
WP_074433555.1|1125311_1126646_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	2.5e-65
>prophage 75
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1136083	1138962	5135675		Enterobacteria_phage(100.0%)	5	NA	NA
WP_000459294.1|1136083_1136539_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_060552904.1|1136531_1136819_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	94.7	2.1e-46
WP_032207428.1|1136811_1137402_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	88.1	1.0e-58
WP_001149160.1|1137398_1137665_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_032207427.1|1138227_1138962_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	5.2e-129
>prophage 76
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1142045	1143215	5135675	integrase	Enterobacteria_phage(100.0%)	1	1133337:1133350	1148007:1148020
1133337:1133350	attL	CAGCGTCAGGTTGG	NA	NA	NA	NA
WP_032207422.1|1142045_1143215_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.0	1.8e-200
WP_032207422.1|1142045_1143215_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.0	1.8e-200
1148007:1148020	attR	CAGCGTCAGGTTGG	NA	NA	NA	NA
>prophage 77
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1149377	1150769	5135675		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|1149377_1150769_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 78
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1155890	1162641	5135675		Bordetella_phage(33.33%)	5	NA	NA
WP_000280488.1|1155890_1157999_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|1158017_1158293_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|1158347_1158971_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000924289.1|1160906_1161524_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032207412.1|1161816_1162641_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.6	2.9e-96
>prophage 79
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1166014	1170577	5135675		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|1166014_1166470_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_032207408.1|1166450_1167671_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|1167842_1168511_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|1168727_1168964_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|1168984_1169152_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|1169249_1170059_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|1170097_1170577_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 80
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1182508	1193237	5135675		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|1182508_1183441_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001307464.1|1183729_1184602_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|1184876_1186073_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646002.1|1186082_1187108_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
WP_032207397.1|1187346_1188381_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000483856.1|1188367_1189327_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|1189330_1190614_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|1190623_1192168_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|1192412_1192844_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_032207396.1|1192985_1193237_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.6e-16
>prophage 81
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1215303	1216077	5135675		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_136762826.1|1215303_1216077_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	49.0	6.0e-19
>prophage 82
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1221741	1223586	5135675		Tupanvirus(100.0%)	1	NA	NA
WP_000582456.1|1221741_1223586_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 83
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1247771	1249313	5135675		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146509.1|1247771_1249313_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 84
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1254627	1255623	5135675		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|1254627_1255623_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 85
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1259847	1260060	5135675		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|1259847_1260060_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 86
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1263714	1266048	5135675		Escherichia_phage(100.0%)	1	NA	NA
WP_071887535.1|1263714_1266048_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	1.4e-71
>prophage 87
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1276262	1278247	5135675		Planktothrix_phage(50.0%)	2	NA	NA
WP_032207329.1|1276262_1277246_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107031.1|1277242_1278247_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
>prophage 88
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1325152	1325800	5135675		Bacillus_virus(100.0%)	1	NA	NA
WP_032207372.1|1325152_1325800_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 89
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1330682	1332817	5135675		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|1330682_1331108_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_032207308.1|1331120_1332410_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.1	5.6e-171
WP_000008957.1|1332463_1332817_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 90
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1336162	1338205	5135675		Indivirus(100.0%)	1	NA	NA
WP_032207306.1|1336162_1338205_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	1.4e-46
>prophage 91
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1351617	1357514	5135675		Staphylococcus_phage(33.33%)	6	NA	NA
WP_032207297.1|1351617_1354353_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	7.1e-22
WP_032207295.1|1354352_1355477_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001259385.1|1355549_1355825_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
WP_000593555.1|1355821_1356181_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|1356300_1356702_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|1356707_1357514_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 92
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1365406	1369538	5135675		Dickeya_phage(50.0%)	4	NA	NA
WP_001100469.1|1365406_1366072_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
WP_000130621.1|1366292_1366538_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106535.1|1366639_1368838_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	6.5e-119
WP_032207287.1|1368911_1369538_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 93
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1372541	1375360	5135675		Staphylococcus_phage(50.0%)	3	NA	NA
WP_032207283.1|1372541_1373210_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|1373202_1374261_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|1374505_1375360_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 94
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1381094	1382577	5135675		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_032207279.1|1381094_1381889_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	5.1e-13
WP_000947905.1|1381875_1382577_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	6.9e-14
>prophage 95
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1386118	1387929	5135675		Planktothrix_phage(50.0%)	2	NA	NA
WP_032207274.1|1386118_1387189_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073597.1|1387185_1387929_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	3.7e-10
>prophage 96
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1407956	1410404	5135675		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|1407956_1410404_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 97
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1419626	1420853	5135675		Ralstonia_phage(100.0%)	1	NA	NA
WP_032207257.1|1419626_1420853_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.5	2.9e-132
>prophage 98
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1425232	1427626	5135675		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|1425232_1427626_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 99
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1433595	1434474	5135675		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|1433595_1434474_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 100
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1441036	1444803	5135675		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|1441036_1441756_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_032207243.1|1441752_1443105_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|1443180_1444803_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 101
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1461714	1462551	5135675		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|1461714_1462551_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 102
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1486769	1496309	5135675		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601849.1|1486769_1487333_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.2	3.5e-61
WP_032207219.1|1487418_1488639_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001297515.1|1488704_1490795_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|1490845_1491478_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|1491779_1492184_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|1492238_1493108_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|1493161_1493380_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057379.1|1493373_1494396_-	hydrolase	NA	NA	NA	NA	NA
WP_032207216.1|1494395_1496309_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
>prophage 103
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1501867	1507441	5135675		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|1501867_1502254_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|1502253_1502613_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|1502620_1502908_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|1503033_1503408_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|1503504_1503975_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|1504071_1506186_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|1506256_1507441_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 104
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1527318	1528790	5135675	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004476.1|1527318_1528266_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
WP_000114986.1|1528280_1528790_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 105
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1539124	1616770	5135675	tRNA,protease,transposase	Vibrio_phage(12.5%)	59	NA	NA
WP_000078316.1|1539124_1539883_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.5e-19
WP_001364972.1|1539890_1540994_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106888148.1|1541046_1542260_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_032208684.1|1543502_1553174_-	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_032208683.1|1555048_1555723_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953023.1|1555771_1556761_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	4.9e-98
WP_032208682.1|1557368_1559018_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_106918773.1|1559868_1561142_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	9.8e-176
WP_096913369.1|1561387_1562549_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_106918774.1|1563660_1564230_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032208314.1|1564266_1565964_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|1565939_1566278_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|1566393_1567695_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|1567812_1569249_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|1569585_1570062_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_032208312.1|1570077_1571334_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|1571610_1571904_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|1571947_1573594_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|1573731_1574085_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_032208310.1|1574287_1575157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032208308.1|1575546_1576575_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|1576616_1577183_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|1577234_1577360_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|1577470_1577617_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|1577791_1578109_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238369.1|1578105_1578639_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299198.1|1579922_1580282_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|1580292_1580688_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|1580698_1581433_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192973.1|1581425_1583234_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|1583558_1584536_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_032208307.1|1584754_1586257_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_032208306.1|1586407_1589731_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934912.1|1589752_1590721_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|1590817_1591870_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|1591964_1592510_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|1593372_1593426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|1593408_1594548_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_072097076.1|1594546_1596094_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|1596065_1596527_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_032208305.1|1596545_1597880_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122503.1|1597889_1599737_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_032208303.1|1599729_1600680_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|1600765_1601074_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|1601150_1602431_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|1602516_1603776_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|1603778_1604783_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089294.1|1604864_1605062_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|1605165_1606464_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|1606668_1607094_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_032208301.1|1607132_1609574_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.1e-66
WP_032208299.1|1609754_1610486_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|1610610_1611012_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|1611030_1611729_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000547760.1|1612456_1612855_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|1612864_1613503_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943982.1|1613505_1614669_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001299838.1|1614752_1616378_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|1616494_1616770_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 106
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1658017	1664505	5135675		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|1658017_1658548_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|1658857_1659814_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205800.1|1659953_1661456_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	3.1e-11
WP_001353963.1|1661469_1662492_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595985.1|1662478_1663474_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|1663506_1664505_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 107
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1668742	1671503	5135675		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106228.1|1668742_1669207_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	56.4	2.5e-52
WP_000187778.1|1669364_1671503_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 108
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1675141	1681238	5135675		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_032208268.1|1675141_1676089_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	1.0e-12
WP_001387276.1|1676273_1676327_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|1676467_1679164_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|1679369_1679756_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|1679828_1680290_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|1680302_1681238_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 109
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1689596	1694653	5135675	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_032208262.1|1689596_1692452_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	2.3e-140
WP_000786399.1|1692451_1692895_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|1693141_1694653_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
>prophage 110
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1701590	1707924	5135675	integrase,transposase	Enterobacteria_phage(33.33%)	5	1692174:1692187	1708635:1708648
1692174:1692187	attL	CTTGCGCTCAACGA	NA	NA	NA	NA
WP_106888148.1|1701590_1702804_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_001197416.1|1703348_1704380_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|1704596_1705160_+	gluconokinase	NA	NA	NA	NA	NA
WP_032208422.1|1705163_1706183_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	2.4e-44
WP_032208424.1|1706661_1707924_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.5	3.7e-82
1708635:1708648	attR	CTTGCGCTCAACGA	NA	NA	NA	NA
>prophage 111
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1711427	1716441	5135675	transposase	Serratia_phage(50.0%)	4	NA	NA
WP_047087888.1|1711427_1712465_-	site-specific DNA-methyltransferase	NA	A0A1S6UAA7	Serratia_phage	27.2	3.1e-18
WP_024188495.1|1714546_1714846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074433496.1|1714903_1715083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106888148.1|1715227_1716441_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
>prophage 112
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1722569	1723862	5135675		Yersinia_phage(50.0%)	2	NA	NA
WP_032208434.1|1722569_1723391_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.3	6.8e-45
WP_001616563.1|1723421_1723862_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	7.9e-16
>prophage 113
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1728733	1729714	5135675		Escherichia_phage(100.0%)	1	NA	NA
WP_032208436.1|1728733_1729714_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	54.7	2.1e-101
>prophage 114
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1733075	1734752	5135675		Escherichia_phage(100.0%)	2	NA	NA
WP_032208450.1|1733075_1733678_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	9.0e-55
WP_000044711.1|1734155_1734752_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 115
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1745018	1746479	5135675		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|1745018_1746479_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 116
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1753001	1753556	5135675		Clostridioides_phage(100.0%)	1	NA	NA
WP_001445961.1|1753001_1753556_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	4.6e-37
>prophage 117
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1761061	1762018	5135675	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_032208465.1|1761061_1762018_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	8.7e-60
>prophage 118
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1782077	1787441	5135675		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_032208482.1|1782077_1783742_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000091572.1|1785365_1786280_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032208488.1|1786418_1787441_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	9.4e-12
>prophage 119
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1790667	1791947	5135675		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|1790667_1791405_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|1791407_1791947_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 120
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1800136	1884121	5135675	tRNA,head,terminase,integrase,tail,holin,protease,capsid	Stx2-converting_phage(42.86%)	98	1792763:1792778	1862979:1862994
1792763:1792778	attL	GCGGCGAAAGCGGTGA	NA	NA	NA	NA
WP_001218294.1|1800136_1801360_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
WP_001400035.1|1803883_1804702_-	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	96.5	1.7e-120
WP_155701557.1|1804698_1805031_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	98.2	4.9e-63
WP_001289923.1|1805215_1805986_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	97.7	4.0e-140
WP_000763383.1|1805982_1806204_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001447688.1|1806302_1806584_-	hypothetical protein	NA	Q08J56	Stx2-converting_phage	100.0	6.5e-48
WP_000548528.1|1806594_1806786_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682304.1|1806758_1806941_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000186781.1|1806937_1807618_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	6.0e-132
WP_000100847.1|1807614_1808400_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995407.1|1808405_1808702_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000361826.1|1808777_1808921_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_001198858.1|1808913_1809054_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000065373.1|1809126_1809495_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_000095081.1|1809675_1810299_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	96.6	2.8e-107
WP_000198445.1|1810360_1810744_-	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000687675.1|1811251_1811656_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_001082382.1|1811652_1812309_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|1812305_1812593_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|1812729_1813434_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1813547_1813781_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438541.1|1813919_1814216_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_032208537.1|1814248_1815187_+	replication protein	NA	C1JJ53	Enterobacteria_phage	99.7	4.1e-171
WP_032208536.1|1815183_1815885_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	6.4e-129
WP_000145907.1|1815881_1816172_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_001000127.1|1816242_1816521_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1816653_1816869_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1816879_1817116_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1817072_1817519_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|1817515_1818043_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|1818039_1818222_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|1818496_1819231_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004018.1|1819305_1820028_+	DNA-binding protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_001107998.1|1820027_1820633_+	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_000144759.1|1820629_1820824_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|1820816_1821251_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|1821757_1822705_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1822714_1822984_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_032362364.1|1823483_1825334_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.5	0.0e+00
WP_000411802.1|1825781_1825988_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|1825992_1826337_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992166.1|1826387_1826921_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	5.6e-101
WP_001056806.1|1827191_1827761_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539794.1|1827760_1827907_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_012816791.1|1828134_1828320_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|1828744_1828972_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1829013_1829379_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958390.1|1829667_1830231_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	1.5e-88
WP_001365116.1|1830227_1831889_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.8	0.0e+00
WP_060552799.1|1831952_1833890_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.6	0.0e+00
WP_001063096.1|1833934_1834156_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|1836682_1837009_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1837018_1837369_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1837365_1837812_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133391.1|1837808_1838153_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275510.1|1838211_1838928_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|1838933_1839308_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_106918812.1|1839363_1839603_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.5	2.3e-30
WP_032207138.1|1839650_1842893_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.7	0.0e+00
WP_000807944.1|1842885_1843227_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_001357740.1|1843226_1843925_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194767.1|1843935_1844679_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	3.8e-148
WP_122994371.1|1844624_1845257_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	2.5e-103
WP_060552800.1|1845495_1848909_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	85.8	0.0e+00
WP_001230466.1|1848978_1849578_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_015740448.1|1849642_1850956_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.7e-80
WP_001101699.1|1850957_1851227_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_001121225.1|1851511_1852162_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001217548.1|1852754_1853015_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.3	8.1e-37
WP_000202564.1|1853234_1854821_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|1855213_1855819_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|1855945_1856107_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|1856228_1857302_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563058.1|1857298_1858081_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088405.1|1858193_1859057_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143257.1|1859028_1860579_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|1860836_1861616_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_032205954.1|1861742_1863065_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
1862979:1862994	attR	GCGGCGAAAGCGGTGA	NA	NA	NA	NA
WP_032205953.1|1863116_1864340_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|1864419_1865139_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000105889.1|1865594_1866611_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|1866638_1867283_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_032205952.1|1867388_1868357_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029697.1|1868405_1869788_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|1869808_1871041_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|1871347_1873015_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409459.1|1873225_1875163_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|1875252_1875579_+	trp operon repressor	NA	NA	NA	NA	NA
WP_032205957.1|1875725_1876238_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_032205951.1|1876289_1876937_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|1876933_1877803_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|1878013_1878487_+	protein CreA	NA	NA	NA	NA	NA
WP_001188659.1|1878499_1879189_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219614.1|1879188_1880613_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_032205950.1|1880670_1882023_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|1882082_1882799_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|1882894_1883035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223181.1|1883434_1884121_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 121
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1892375	1901434	5135675		Cyanophage(20.0%)	9	NA	NA
WP_000130189.1|1892375_1893329_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001295414.1|1893443_1894031_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|1894064_1894631_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_032205948.1|1894779_1895484_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843568.1|1895509_1895914_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|1896290_1898207_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|1898295_1899426_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|1899529_1899739_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_032205947.1|1900267_1901434_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 122
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1908475	1911292	5135675	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_032205943.1|1908475_1911292_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.0	4.6e-77
>prophage 123
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1915735	1916884	5135675		Halovirus(100.0%)	1	NA	NA
WP_032205941.1|1915735_1916884_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	6.3e-49
>prophage 124
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1922354	1928015	5135675		Tupanvirus(50.0%)	4	NA	NA
WP_032205938.1|1922354_1923908_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2K9KZV5	Tupanvirus	21.7	6.6e-17
WP_000349926.1|1923981_1925199_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_032205937.1|1925327_1926470_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|1926500_1928015_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 125
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1935909	1937309	5135675		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|1935909_1936389_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|1936466_1937309_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 126
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1945053	1950475	5135675		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_032205931.1|1945053_1947960_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_032205930.1|1948123_1950475_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	26.5	1.5e-33
>prophage 127
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1956794	1957493	5135675		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916287.1|1956794_1957493_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 128
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1970194	1971919	5135675		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_016244264.1|1970194_1971919_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.1e-36
>prophage 129
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	1997897	1998941	5135675		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|1997897_1998941_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 130
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2003186	2003738	5135675		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923727.1|2003186_2003738_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 131
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2012365	2013790	5135675		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2012365_2013790_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 132
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2021438	2028061	5135675		Mamastrovirus(33.33%)	5	NA	NA
WP_032205913.1|2021438_2022989_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_032205912.1|2023190_2025581_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|2025786_2026323_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_032205911.1|2026363_2027026_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|2027134_2028061_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 133
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2031323	2032220	5135675		Sodalis_phage(100.0%)	1	NA	NA
WP_032205910.1|2031323_2032220_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.8	4.8e-60
>prophage 134
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2036301	2037575	5135675	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_106918776.1|2036301_2037575_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 135
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2043668	2050474	5135675	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|2043668_2045087_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_021565407.1|2045125_2046052_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|2046088_2046544_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|2046721_2047426_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_032206565.1|2047440_2047971_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001365309.1|2048044_2050474_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
>prophage 136
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2055717	2056515	5135675		Planktothrix_phage(100.0%)	1	NA	NA
WP_032206567.1|2055717_2056515_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
>prophage 137
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2062426	2062771	5135675		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2062426_2062771_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 138
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2066700	2068125	5135675	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|2066700_2068125_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 139
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2080009	2080768	5135675		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|2080009_2080768_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 140
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2089596	2093712	5135675		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569419.1|2089596_2090193_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294774.1|2090229_2093712_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 141
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2106669	2107701	5135675		Planktothrix_phage(100.0%)	1	NA	NA
WP_032206584.1|2106669_2107701_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.6	3.6e-35
>prophage 142
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2117652	2121854	5135675		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_032207024.1|2117652_2119011_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.3	9.9e-09
WP_001052720.1|2119082_2119838_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|2119871_2120594_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032207022.1|2120590_2121058_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.4e-50
WP_074433528.1|2121122_2121854_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	9.9e-40
>prophage 143
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2131021	2202487	5135675	holin,transposase	Shigella_phage(14.29%)	60	NA	NA
WP_060552803.1|2131021_2132158_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_032207054.1|2132199_2132970_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|2133123_2133597_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_032207055.1|2133639_2136084_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|2136323_2136902_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001365365.1|2137107_2137875_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|2137845_2138586_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615979.1|2138741_2139020_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|2139022_2139283_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543899.1|2139468_2140242_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001030484.1|2140298_2140655_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000598760.1|2140647_2140926_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_032207056.1|2141030_2142770_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_032207059.1|2142729_2143500_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|2143570_2144626_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059855.1|2144622_2145075_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_106918778.1|2145779_2147052_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.4e-174
WP_032206471.1|2147763_2148378_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_032206470.1|2148434_2149892_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|2150152_2150611_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_032206469.1|2150702_2151947_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|2152004_2152406_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749879.1|2152444_2153500_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
WP_001285288.1|2153787_2154891_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_032206468.1|2154902_2156156_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	1.3e-95
WP_001436958.1|2157392_2157704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873435.1|2159942_2160125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206464.1|2160367_2161042_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032206460.1|2161849_2162074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206458.1|2162073_2162382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|2163366_2163564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000013184.1|2163568_2163952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206457.1|2163966_2164998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091092.1|2165149_2165347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106918779.1|2165529_2166742_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_032206455.1|2168018_2168870_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032206454.1|2169118_2169988_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.0	3.0e-51
WP_001299021.1|2170147_2170741_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|2170752_2170989_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_032206452.1|2171097_2172423_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.4e-113
WP_000339588.1|2172648_2173503_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001102119.1|2174029_2174749_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_032206451.1|2174759_2176187_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_032206450.1|2176179_2176875_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_024230919.1|2177117_2177786_-	membrane protein	NA	NA	NA	NA	NA
WP_032206449.1|2177998_2179669_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	2.8e-61
WP_000089075.1|2179682_2181155_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001299022.1|2181168_2181756_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|2181884_2183918_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_074433533.1|2184490_2188474_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	1.4e-124
WP_001084399.1|2189746_2190679_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206446.1|2190770_2191268_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_000023635.1|2191525_2192131_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_032206444.1|2192170_2193034_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000111809.1|2193023_2194571_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_032206442.1|2194570_2195989_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_032206440.1|2196131_2197082_+	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_000692744.1|2198850_2199900_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
WP_032206438.1|2200142_2200958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085972493.1|2201214_2202487_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 144
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2209613	2211500	5135675		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032206729.1|2209613_2211500_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	4.1e-53
>prophage 145
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2214589	2215489	5135675		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032206730.1|2214589_2215489_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 146
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2220028	2224308	5135675		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_032206732.1|2220028_2223103_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.2	0.0e+00
WP_000805910.1|2223225_2224308_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.4	1.1e-191
>prophage 147
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2229718	2231679	5135675		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|2229718_2230669_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_032206737.1|2230665_2231679_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	7.1e-44
>prophage 148
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2234869	2235979	5135675		Synechococcus_phage(100.0%)	1	NA	NA
WP_000842103.1|2234869_2235979_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	1.2e-31
>prophage 149
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2241291	2242059	5135675		Planktothrix_phage(100.0%)	1	NA	NA
WP_032206743.1|2241291_2242059_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 150
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2245463	2246626	5135675	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947598.1|2245463_2246626_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 151
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2250261	2251419	5135675		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032208403.1|2250261_2251419_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 152
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2258834	2259950	5135675		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|2258834_2259950_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 153
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2264239	2274211	5135675		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|2264239_2265151_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219312.1|2265275_2266184_+	fructokinase	NA	NA	NA	NA	NA
WP_032208410.1|2266326_2267511_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_032208398.1|2267636_2270780_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221327.1|2270776_2271979_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|2272168_2272858_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_032208397.1|2272915_2274211_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.2e-26
>prophage 154
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2281163	2290144	5135675	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|2281163_2282291_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|2282313_2282646_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|2282673_2284521_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|2284531_2285503_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_032208392.1|2285631_2285979_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|2286155_2287040_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|2287338_2287878_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|2288028_2288478_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_032208391.1|2288481_2289585_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.3e-54
WP_001021161.1|2289673_2290144_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 155
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2313850	2318897	5135675	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_032208382.1|2313850_2314474_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.4	6.4e-64
WP_000130305.1|2314599_2315874_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001514981.1|2316061_2318416_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|2318624_2318897_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 156
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2322025	2322721	5135675		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032208373.1|2322025_2322721_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	9.3e-88
>prophage 157
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2326044	2329591	5135675		Bacillus_phage(100.0%)	2	NA	NA
WP_001235610.1|2326044_2327817_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_032208367.1|2327809_2329591_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	4.0e-42
>prophage 158
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2338427	2341577	5135675		Leptospira_phage(100.0%)	1	NA	NA
WP_032208365.1|2338427_2341577_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.8	6.2e-54
>prophage 159
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2348585	2357043	5135675		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|2348585_2349137_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|2349265_2351197_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|2351249_2351579_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|2351578_2352184_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_032208360.1|2352293_2354168_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	6.8e-117
WP_001220233.1|2354348_2354993_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250105.1|2355124_2356087_+	ferrochelatase	NA	NA	NA	NA	NA
WP_032208358.1|2356083_2357043_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	8.5e-15
>prophage 160
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2365287	2368348	5135675		Escherichia_phage(50.0%)	2	NA	NA
WP_001344274.1|2365287_2365629_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
WP_032208353.1|2365843_2368348_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	8.5e-115
>prophage 161
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2372887	2373565	5135675		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|2372887_2373565_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 162
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2376701	2377388	5135675		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|2376701_2377388_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 163
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2389693	2391475	5135675		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_032208406.1|2389693_2391475_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.9	6.0e-38
>prophage 164
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2397625	2398771	5135675		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706344.1|2397625_2398771_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 165
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2410288	2450557	5135675	tRNA,protease,tail,transposase	Escherichia_phage(41.67%)	44	NA	NA
WP_032208334.1|2410288_2411674_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|2411709_2412231_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|2412338_2412551_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|2412552_2413419_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|2413899_2414442_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|2414661_2415354_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_032208332.1|2419539_2420172_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_106888078.1|2421221_2422377_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888148.1|2422686_2423899_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_071887448.1|2423902_2424019_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	84.4	1.0e-07
WP_060552806.1|2424009_2424690_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	1.0e-131
WP_000100847.1|2424686_2425472_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995409.1|2425477_2425774_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372937.1|2425849_2425993_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2425961_2426126_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_047088220.1|2426198_2426567_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_032207130.1|2426762_2427212_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.3e-69
WP_032207131.1|2427270_2427543_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	9.7e-41
WP_032208417.1|2429182_2429644_-	hypothetical protein	NA	G9L674	Escherichia_phage	99.3	3.8e-77
WP_000885926.1|2429711_2430053_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_001302016.1|2430062_2430758_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2430832_2431048_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_032208418.1|2431189_2431492_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	97.8	3.3e-42
WP_106888148.1|2431494_2432708_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_047087890.1|2432831_2433731_+	replication protein	NA	M1FN81	Enterobacteria_phage	99.7	2.9e-174
WP_001510925.1|2433727_2434429_+	replication P family protein	NA	Q6H9X6	Enterobacteria_phage	99.6	1.7e-129
WP_047087893.1|2434425_2434716_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	97.9	1.8e-45
WP_024219806.1|2434789_2435230_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	9.1e-81
WP_000153280.1|2435226_2435754_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_029784131.1|2435770_2435932_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	98.1	3.4e-25
WP_000290552.1|2436207_2436885_+	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	98.7	1.5e-127
WP_096913305.1|2436959_2437682_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.2	3.3e-128
WP_000002243.1|2437681_2437972_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_032207075.1|2437968_2438331_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	98.3	8.6e-61
WP_032207073.1|2438473_2439304_+	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	80.4	6.7e-117
WP_032207072.1|2439419_2440340_-	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	86.5	1.5e-64
WP_047087897.1|2440665_2440818_+	DNA methylase	NA	A0A0N7C2V5	Escherichia_phage	96.0	1.5e-19
WP_047087898.1|2441185_2441614_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.4	1.4e-62
WP_106888146.1|2444182_2444377_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	73.0	3.8e-07
WP_077744828.1|2446301_2446640_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.9	3.7e-05
WP_129014751.1|2446719_2447379_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032207501.1|2447443_2447749_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_047088067.1|2447932_2449417_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|2449603_2450557_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 166
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2465547	2470307	5135675		Ralstonia_phage(33.33%)	3	NA	NA
WP_032205809.1|2465547_2467449_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	1.7e-27
WP_016244362.1|2468185_2469634_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770953.1|2469623_2470307_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 167
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2473452	2476596	5135675		Leptospira_phage(100.0%)	1	NA	NA
WP_032205803.1|2473452_2476596_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.0	1.7e-59
>prophage 168
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2488038	2494080	5135675		Tupanvirus(50.0%)	3	NA	NA
WP_032205794.1|2488038_2491920_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.7	2.6e-62
WP_101967132.1|2492135_2493248_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|2493264_2494080_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 169
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2509307	2510528	5135675		Streptococcus_phage(100.0%)	1	NA	NA
WP_000029808.1|2509307_2510528_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	6.1e-58
>prophage 170
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2513638	2515753	5135675		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|2513638_2515204_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_032205782.1|2515324_2515753_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	2.5e-19
>prophage 171
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2531178	2531825	5135675		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|2531178_2531388_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_020218941.1|2531441_2531825_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 172
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2536640	2539091	5135675		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|2536640_2537852_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_032205766.1|2537990_2539091_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 173
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2546101	2548684	5135675	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_024226883.1|2546101_2548684_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	8.9e-184
>prophage 174
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2554867	2558400	5135675		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_032205759.1|2554867_2556538_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	8.8e-76
WP_032205758.1|2556621_2557557_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|2557674_2558400_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 175
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2566296	2567376	5135675		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|2566296_2567376_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 176
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2571471	2573136	5135675		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337087.1|2571471_2573136_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.0e-84
>prophage 177
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2577903	2581717	5135675	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|2577903_2579850_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|2580052_2581717_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 178
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2593283	2609494	5135675		Hokovirus(33.33%)	12	NA	NA
WP_000186076.1|2593283_2593961_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_032205749.1|2593957_2596642_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	27.2	2.2e-12
WP_032205747.1|2596634_2597207_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_047087449.1|2597215_2599264_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_032205744.1|2599286_2600960_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001365534.1|2600959_2601049_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424925.1|2601361_2601568_+	YbfA family protein	NA	NA	NA	NA	NA
WP_060552814.1|2601808_2603965_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	3.0e-15
WP_000832345.1|2603961_2604531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053305.1|2606046_2606556_+	YbgA family protein	NA	NA	NA	NA	NA
WP_032207542.1|2606552_2607971_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	8.1e-62
WP_032207540.1|2608012_2609494_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.0	5.5e-45
>prophage 179
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2612872	2613664	5135675		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|2612872_2613664_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 180
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2649511	2653031	5135675		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|2649511_2650231_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|2650227_2651169_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|2651282_2651663_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109192.1|2651978_2653031_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.6e-81
>prophage 181
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2657386	2663959	5135675		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|2657386_2658403_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_032207521.1|2658663_2660136_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.6	2.1e-12
WP_001147439.1|2660203_2660992_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|2661120_2661270_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101999.1|2661435_2662209_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|2662208_2662898_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|2662900_2663959_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 182
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2673669	2689618	5135675	integrase,tail,holin,protease,transposase	Enterobacteria_phage(55.56%)	14	2673582:2673596	2687689:2687703
2673582:2673596	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_064717027.1|2673669_2674551_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	9.5e-162
WP_001235472.1|2675804_2676428_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|2676680_2677424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|2677509_2677668_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_032208531.1|2678290_2678506_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	5.5e-31
WP_106918781.1|2678916_2680072_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.8e-67
WP_060552816.1|2680100_2680256_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	1.1e-17
WP_085972493.1|2682325_2683599_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000701341.1|2683658_2684651_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|2685146_2685308_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|2685476_2686358_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_032208109.1|2686588_2687287_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000767389.1|2687793_2688270_-	kinase inhibitor	NA	NA	NA	NA	NA
2687689:2687703	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_071887456.1|2688328_2689618_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	6.9e-20
>prophage 183
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2696099	2697008	5135675		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|2696099_2697008_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 184
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2707606	2722416	5135675		Anomala_cuprea_entomopoxvirus(14.29%)	12	NA	NA
WP_000996107.1|2707606_2709343_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_032208099.1|2709335_2710331_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001361582.1|2710333_2711005_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_032208097.1|2711233_2712598_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.6	3.3e-52
WP_001145127.1|2712829_2713312_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_001218658.1|2713431_2715582_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_032208095.1|2715609_2716572_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443513.1|2716712_2717798_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|2718025_2718286_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|2718550_2718817_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_032208093.1|2718890_2719568_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	2.0e-18
WP_000710619.1|2722155_2722416_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 185
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2725956	2731181	5135675		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|2725956_2726679_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|2726675_2727335_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_032208091.1|2727473_2728220_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|2728623_2729127_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_032208089.1|2729425_2730313_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|2730547_2730613_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|2730665_2731181_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 186
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2736177	2744519	5135675		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|2736177_2737770_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_032208085.1|2738010_2739276_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|2739427_2740243_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_032208084.1|2740388_2742821_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_032208083.1|2743856_2744519_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	4.3e-26
>prophage 187
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2747734	2749606	5135675		Planktothrix_phage(100.0%)	1	NA	NA
WP_032208081.1|2747734_2749606_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 188
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2760941	2762144	5135675		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|2760941_2762144_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 189
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2770710	2779860	5135675		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|2770710_2770968_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|2771127_2771415_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|2771398_2772121_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|2772181_2773084_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|2773171_2773648_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126069.1|2773998_2775111_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_060552817.1|2775205_2776339_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105417.1|2776348_2777302_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|2777298_2778144_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|2778203_2778692_+	YbjO family protein	NA	NA	NA	NA	NA
WP_032208074.1|2778732_2779860_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.7	3.0e-27
>prophage 190
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2783196	2785934	5135675		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|2783196_2783925_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|2784142_2784658_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|2784783_2785107_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|2785103_2785934_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 191
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2789521	2791240	5135675		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|2789521_2791240_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 192
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2800537	2882532	5135675	tRNA,lysis,terminase,portal,integrase,protease,tail,holin,plate,head,capsid,transposase	Escherichia_phage(35.59%)	80	2786811:2786829	2888625:2888643
2786811:2786829	attL	GCGCCCATTTTTTCCAGCA	NA	NA	NA	NA
WP_032208066.1|2800537_2802484_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2802556_2802781_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_032208065.1|2803185_2804424_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.7	1.8e-126
WP_001206970.1|2804842_2805052_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_032208063.1|2805400_2805580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918783.1|2805985_2806312_+	host cell division inhibitor Icd-like protein	NA	A0A1C9IHV9	Salmonella_phage	55.7	1.7e-07
WP_032208062.1|2806304_2806625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208060.1|2806631_2806931_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001475690.1|2809028_2809274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208058.1|2809270_2809681_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_024166342.1|2809690_2809963_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001475693.1|2810088_2810313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001475695.1|2810609_2811767_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.6e-137
WP_001475696.1|2811822_2812380_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	4.1e-62
WP_122993077.1|2812417_2813593_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	1.1e-184
WP_016241300.1|2813589_2813928_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	2.5e-30
WP_000134111.1|2813924_2814221_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145908.1|2814220_2814661_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.8	7.8e-56
WP_000113648.1|2814949_2815306_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_032208053.1|2816963_2817245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|2818139_2818460_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_032208047.1|2818490_2820767_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	2.1e-165
WP_001040187.1|2821511_2821730_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_032208045.1|2822014_2822719_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|2822760_2824482_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_032208042.1|2824482_2826249_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	1.6e-22
WP_000537418.1|2826371_2827337_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|2827880_2828375_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_032208039.1|2828509_2832343_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.1e-86
WP_001295343.1|2832497_2833109_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067756.1|2833119_2834463_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
WP_032208036.1|2834553_2835846_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	8.6e-95
WP_000850303.1|2836083_2838528_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|2838538_2839156_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_032208034.1|2840055_2840682_-	hydrolase	NA	NA	NA	NA	NA
WP_000109295.1|2840995_2842144_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918506.1|2842353_2843784_+	amino acid permease	NA	NA	NA	NA	NA
WP_032208033.1|2843784_2844693_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190367.1|2844792_2845383_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000067977.1|2845464_2846262_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_032208032.1|2846293_2847289_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.4	6.0e-189
WP_024182500.1|2847382_2847682_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	79.8	3.8e-38
WP_032208031.1|2848150_2848747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208029.1|2848749_2848956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918784.1|2849027_2850300_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	7.7e-173
WP_032208026.1|2850558_2851059_+	hypothetical protein	NA	M1SV55	Escherichia_phage	98.8	3.8e-91
WP_032208023.1|2851122_2851347_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	8.8e-32
WP_001277958.1|2851346_2851649_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113264.1|2851648_2851873_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_032208021.1|2851869_2852145_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	97.8	2.5e-44
WP_032208018.1|2854427_2854871_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	93.9	3.1e-76
WP_085972493.1|2855004_2856278_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001620979.1|2856486_2857428_-	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	81.5	5.4e-147
WP_032206254.1|2857854_2858889_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	9.3e-201
WP_032206253.1|2858888_2860661_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.2	0.0e+00
WP_032206252.1|2860834_2861689_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.1	2.4e-130
WP_032206251.1|2861747_2862821_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	2.8e-200
WP_032206249.1|2862824_2863568_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	99.6	3.6e-122
WP_032206247.1|2863667_2864174_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	1.0e-88
WP_032206246.1|2864173_2864377_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	4.4e-30
WP_000123123.1|2864380_2864662_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001530534.1|2864661_2865159_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_032206243.1|2865173_2865608_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	87.5	7.2e-54
WP_032206242.1|2865595_2866021_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.7	3.0e-65
WP_001300730.1|2865992_2866166_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_032206241.1|2866128_2866596_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_032206240.1|2866588_2867041_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	3.8e-74
WP_024245775.1|2867112_2867898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093707.1|2867981_2868617_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	4.1e-114
WP_032206239.1|2868613_2868961_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	98.3	5.5e-57
WP_032206238.1|2868965_2869874_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	7.5e-162
WP_032206237.1|2869866_2870397_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	1.9e-101
WP_032206234.1|2872728_2873256_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	96.0	5.2e-91
WP_000257039.1|2873537_2874881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206231.1|2875139_2876330_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001251408.1|2876342_2876861_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|2876917_2877193_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|2877225_2877345_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000468308.1|2879712_2879931_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292815.1|2880249_2882532_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
2888625:2888643	attR	TGCTGGAAAAAATGGGCGC	NA	NA	NA	NA
>prophage 193
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2886630	2887719	5135675		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057136.1|2886630_2887719_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
>prophage 194
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2892805	2897346	5135675		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|2892805_2893090_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_024226769.1|2893296_2895561_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|2895597_2897346_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 195
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2912051	2923184	5135675	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|2912051_2912600_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_032206222.1|2912626_2913274_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|2913495_2914686_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|2914870_2915959_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|2916560_2917961_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|2918129_2919332_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193831.1|2919597_2922210_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001090495.1|2922416_2923184_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	2.2e-29
>prophage 196
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2939105	2941013	5135675		Tupanvirus(100.0%)	1	NA	NA
WP_032206212.1|2939105_2941013_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	8.3e-54
>prophage 197
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	2945680	3010979	5135675	head,terminase,portal,integrase,tail,holin,protease,capsid	Enterobacteria_phage(36.96%)	77	2960762:2960821	3006242:3006306
WP_032206208.1|2945680_2947441_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|2947626_2948079_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|2948154_2949195_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|2949551_2950061_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|2950279_2950909_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_074433556.1|2950871_2953034_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|2953043_2953490_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_032206206.1|2953612_2955667_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424181.1|2955698_2956157_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|2956252_2956915_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001343235.1|2957087_2957501_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|2957545_2957863_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_106918785.1|2957920_2959111_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|2959205_2959484_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|2959480_2959810_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|2959900_2960560_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
2960762:2960821	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_032206255.1|2960967_2961777_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.6	1.1e-76
WP_000273151.1|2961964_2962207_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_032206202.1|2962274_2964749_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_001098307.1|2964842_2965034_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|2965030_2965219_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000373334.1|2965931_2966378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000367377.1|2966476_2966629_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_021568727.1|2966903_2967194_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000108762.1|2967193_2967385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021568728.1|2967402_2967903_-	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.8e-16
WP_001048459.1|2968010_2968274_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000693918.1|2968270_2968696_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262367.1|2968767_2969838_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
WP_047087727.1|2969878_2970304_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.9	5.7e-64
WP_032206196.1|2970357_2970717_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	8.0e-59
WP_032206194.1|2970762_2970975_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	1.7e-32
WP_032206192.1|2971010_2971844_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	65.7	5.5e-26
WP_001278459.1|2971953_2972058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128514.1|2972245_2972458_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_001219082.1|2972702_2973062_+	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.9	7.1e-23
WP_000284536.1|2973064_2973541_+	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	33.3	1.7e-16
WP_032207160.1|2973973_2974252_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_032207158.1|2974253_2975312_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.6	1.1e-90
WP_032207155.1|2975312_2975693_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
WP_000762928.1|2975689_2976511_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001344632.1|2977107_2977239_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_053888468.1|2977681_2979532_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000411804.1|2979977_2980184_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000138558.1|2980439_2980712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|2980871_2981405_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|2981625_2981739_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|2981960_2982146_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|2982673_2982988_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|2983069_2983294_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|2983696_2984206_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_032207005.1|2984177_2986106_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	6.1e-262
WP_000258991.1|2986089_2986296_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001430223.1|2986292_2987885_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_001254039.1|2987874_2989380_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256818.1|2989416_2989764_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|2989821_2990850_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|2990901_2991276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|2991268_2991622_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_032207006.1|2991636_2992212_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	6.4e-50
WP_032207007.1|2992208_2992604_+	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	91.6	1.3e-65
WP_001342267.1|2992611_2993352_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|2993367_2993790_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|2993771_2994206_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000847347.1|2996756_2997086_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_032207009.1|2997085_2997784_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.2e-132
WP_032207010.1|2997789_2998533_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_071887464.1|2998469_2999102_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	7.2e-95
WP_032207011.1|2999162_3002558_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.8	0.0e+00
WP_047617645.1|3002625_3003225_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.0	6.3e-109
WP_060552821.1|3003289_3004495_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.8	1.9e-80
WP_001023379.1|3004496_3004766_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_047618562.1|3004891_3005644_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_001058323.1|3006760_3007879_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
3006242:3006306	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107384.1|3007875_3009669_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|3009687_3010395_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|3010391_3010979_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 198
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3025304	3037560	5135675		Morganella_phage(20.0%)	12	NA	NA
WP_000066490.1|3025304_3025517_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071528578.1|3025527_3025716_+	cold-shock protein	NA	NA	NA	NA	NA
WP_021292990.1|3025690_3025921_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|3025910_3026084_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_071887465.1|3027277_3030022_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.6	5.1e-36
WP_001264919.1|3030104_3031133_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_032206543.1|3031105_3031798_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.4	1.6e-18
WP_001230242.1|3031927_3033100_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_032206541.1|3033099_3035646_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.5	1.1e-72
WP_000209866.1|3035642_3036242_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_032206557.1|3036334_3036640_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420617.1|3036639_3037560_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 199
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3041866	3043744	5135675		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|3041866_3042040_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_032206537.1|3042122_3043229_-	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	81.9	5.5e-183
WP_001028096.1|3043249_3043744_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 200
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3058507	3059572	5135675		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|3058507_3059572_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 201
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3064462	3065625	5135675	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_096913369.1|3064462_3065625_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 202
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3069015	3069849	5135675		Pelagibacter_phage(100.0%)	1	NA	NA
WP_032206959.1|3069015_3069849_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	2.5e-39
>prophage 203
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3073982	3074516	5135675		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|3073982_3074516_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 204
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3084022	3085578	5135675		Mycobacterium_phage(50.0%)	2	NA	NA
WP_032206956.1|3084022_3084571_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.7	9.1e-22
WP_047618667.1|3084915_3085578_+	DNA methylase	NA	A0A2C9CWW2	Yersinia_phage	27.5	7.7e-07
>prophage 205
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3091137	3092058	5135675		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|3091137_3092058_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 206
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3096719	3096965	5135675		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|3096719_3096965_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 207
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3112815	3113757	5135675		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|3112815_3113757_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 208
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3126111	3127293	5135675		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|3126111_3126846_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|3127056_3127293_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 209
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3130565	3132208	5135675		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|3130565_3131207_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_032206328.1|3131203_3132208_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 210
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3144538	3144796	5135675		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|3144538_3144796_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 211
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3152085	3240631	5135675	tRNA,terminase,portal,integrase,tail,holin,protease,transposase	Enterobacteria_phage(35.62%)	99	3186246:3186262	3240265:3240281
WP_032206331.1|3152085_3152787_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	2.4e-35
WP_024191477.1|3152786_3154031_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291257.1|3154059_3154971_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|3154986_3155808_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_032206332.1|3155963_3157010_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|3157006_3157801_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000824186.1|3158109_3158313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001113310.1|3158290_3158758_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000948454.1|3159733_3160210_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|3160334_3160658_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693928.1|3160641_3161067_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206333.1|3161138_3162209_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.3e-64
WP_032206334.1|3162215_3162962_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	1.1e-113
WP_032206335.1|3162983_3163709_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.2	2.0e-77
WP_001118161.1|3163724_3164120_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001278450.1|3164877_3164982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|3165170_3165383_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_032206337.1|3165501_3165846_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	98.2	1.4e-55
WP_032206341.1|3165967_3166240_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	51.5	5.5e-12
WP_032207210.1|3167302_3167677_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	1.3e-35
WP_047619233.1|3167673_3168495_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	57.5	5.1e-77
WP_000143458.1|3171460_3171640_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|3171680_3171953_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284518.1|3172029_3172245_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_074433498.1|3172249_3173239_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.1	7.5e-107
WP_032207060.1|3173275_3173812_+	lysozyme	NA	G9L6J6	Escherichia_phage	94.9	4.5e-98
WP_012816791.1|3174329_3174515_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032207063.1|3174600_3174825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373407.1|3175244_3175721_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|3175717_3177841_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|3177837_3178050_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_032208647.1|3178049_3179552_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.2	7.2e-287
WP_122993092.1|3179541_3181521_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.6	0.0e+00
WP_001097065.1|3181608_3181935_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281346.1|3181927_3182209_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_000974958.1|3182211_3182835_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682718.1|3182847_3183246_+	hypothetical protein	NA	Q9EYD7	Enterobacteria_phage	99.2	1.7e-70
WP_032208644.1|3183253_3184003_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	4.8e-130
WP_000479056.1|3184018_3184441_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	98.6	4.3e-72
WP_000532075.1|3184467_3184776_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_060552832.1|3184819_3187465_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.2	0.0e+00
3186246:3186262	attL	AAGAGCTGACAGGTAAA	NA	NA	NA	NA
WP_000847304.1|3187461_3187791_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_060552833.1|3187790_3188489_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	8.9e-131
WP_096913390.1|3188974_3189109_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	84.4	1.3e-06
WP_106888148.1|3189074_3190288_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_123007084.1|3190501_3191134_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	1.0e-104
WP_060552835.1|3191379_3194859_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.0	0.0e+00
WP_060552836.1|3194925_3195525_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	2.9e-106
WP_071887548.1|3195589_3196705_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	93.6	1.8e-80
WP_001023446.1|3196706_3196976_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	1.2e-43
WP_047088273.1|3197430_3198792_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_000799400.1|3200467_3201331_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_032206984.1|3201314_3202451_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359446.1|3202700_3203927_+	peptidase T	NA	NA	NA	NA	NA
WP_032206983.1|3203975_3205097_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032206982.1|3205172_3206633_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|3206632_3207304_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|3207472_3208843_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|3208846_3209488_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_032206981.1|3209523_3210630_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|3210683_3211145_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_032206979.1|3211154_3211808_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_032206978.1|3211979_3213230_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	2.5e-22
WP_000741335.1|3213331_3214474_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|3214463_3214700_-	excisionase	NA	NA	NA	NA	NA
WP_106918786.1|3214897_3216128_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.7e-172
WP_032207484.1|3216216_3216417_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.5	4.2e-33
WP_000763385.1|3216464_3216683_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|3216781_3217063_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_032207486.1|3217073_3217631_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	61.7	7.8e-61
WP_000682319.1|3217623_3217785_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_032207488.1|3217781_3218462_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	7.9e-132
WP_001438244.1|3218458_3219244_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000995409.1|3219249_3219546_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372937.1|3219621_3219765_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|3219733_3219898_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_047088220.1|3219970_3220339_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_032207130.1|3220534_3220984_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.3e-69
WP_032207131.1|3221268_3221541_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	9.7e-41
WP_001278657.1|3221982_3222603_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
WP_001207141.1|3222599_3223034_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	6.0e-77
WP_096913377.1|3223084_3223780_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	4.3e-133
WP_000067727.1|3223854_3224070_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_106918787.1|3224193_3225406_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	3.5e-167
WP_071887470.1|3225487_3225907_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.0	1.7e-68
WP_032206875.1|3226026_3226917_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_032206874.1|3226935_3227442_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001546534.1|3227478_3227979_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|3228057_3228240_-	general stress protein	NA	NA	NA	NA	NA
WP_129014756.1|3228737_3229406_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|3229462_3229768_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_060552842.1|3229951_3231436_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032207030.1|3231622_3232576_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|3233074_3233659_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074433656.1|3234600_3234753_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.0	2.4e-20
WP_001307134.1|3234855_3235179_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|3235711_3235822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106888170.1|3238131_3239345_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	1.6e-167
WP_097746533.1|3239475_3240631_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
3240265:3240281	attR	AAGAGCTGACAGGTAAA	NA	NA	NA	NA
>prophage 212
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3247262	3248950	5135675		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|3247262_3247682_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_032208520.1|3247681_3248950_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	3.3e-208
>prophage 213
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3271724	3397792	5135675	tRNA,portal,integrase,tail,protease,holin,head,transposase	Escherichia_phage(25.0%)	117	3323066:3323125	3374818:3376128
WP_001033352.1|3271724_3273404_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|3273528_3274476_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001260333.1|3274626_3275478_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001130692.1|3275477_3276101_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_000173200.1|3276314_3277571_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_024226915.1|3277612_3278695_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456461.1|3278694_3279528_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|3279524_3279917_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|3279920_3280730_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|3280765_3281620_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170926.1|3281768_3281876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170965.1|3282304_3282412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295620.1|3282816_3283917_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146440.1|3284186_3284417_+	putative cation transport regulator ChaB	NA	NA	NA	NA	NA
WP_001336325.1|3284574_3285270_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001169669.1|3285313_3285667_-	DsrE/F sulfur relay family protein YchN	NA	NA	NA	NA	NA
WP_000086217.1|3285851_3287246_+	inverse autotransporter invasin YchO	NA	NA	NA	NA	NA
WP_000070491.1|3287246_3287897_-	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_000918073.1|3287889_3289686_-	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_000019827.1|3290024_3291416_+	nitrate transporter NarK	NA	NA	NA	NA	NA
WP_000032935.1|3291931_3295675_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000702660.1|3295671_3297210_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|3297206_3297917_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|3297916_3298594_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|3299200_3300043_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|3300092_3300551_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|3300663_3301569_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|3301660_3302674_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|3302875_3303784_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|3303927_3304341_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|3304945_3305563_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_000301651.1|3305864_3308540_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001211521.1|3309820_3310117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032208522.1|3310400_3312032_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911112.1|3312117_3313038_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979648.1|3313052_3313961_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_032208507.1|3313972_3314986_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	9.0e-15
WP_000994905.1|3314982_3315987_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000366959.1|3316039_3316369_-	YciU family protein	NA	NA	NA	NA	NA
WP_032208505.1|3316403_3317864_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|3318006_3318180_+	YciY family protein	NA	NA	NA	NA	NA
WP_001299682.1|3318234_3319488_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|3319787_3320084_-	YciI family protein	NA	NA	NA	NA	NA
WP_050439363.1|3320654_3321008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000447713.1|3321676_3322228_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.0	4.7e-26
3323066:3323125	attL	TGAACCGCCCCGGGAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_106888077.1|3323119_3324332_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_032206800.1|3324787_3325507_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_032206794.1|3325546_3325945_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_032206795.1|3326049_3326589_-	septation protein A	NA	NA	NA	NA	NA
WP_000028540.1|3326618_3327362_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|3327718_3328357_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_097746533.1|3328753_3329910_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000113189.1|3330765_3331014_-	excisionase	NA	NA	NA	NA	NA
WP_096913369.1|3332104_3333266_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001449026.1|3334178_3334937_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|3335215_3335428_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|3335648_3335906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|3335975_3336254_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_047618788.1|3337292_3337658_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	7.9e-38
WP_047618791.1|3337654_3338344_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.7	2.6e-58
WP_024225593.1|3339383_3339515_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	83.3	1.5e-07
WP_097746533.1|3341234_3342391_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_060552847.1|3342464_3342986_+|portal	portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	96.4	1.5e-74
WP_000125990.1|3342982_3343309_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|3343318_3343669_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_047619061.1|3346211_3346481_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	6.4e-45
WP_000767050.1|3346701_3347244_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106409363.1|3347188_3347383_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_032207133.1|3347725_3349048_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	83.9	4.6e-221
WP_096913369.1|3349799_3350962_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000935464.1|3351149_3351788_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	76.9	5.4e-82
WP_000938103.1|3351853_3352423_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|3353590_3353869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|3355606_3355753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032207081.1|3355889_3356537_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_032207080.1|3356720_3357311_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_101967138.1|3360164_3360599_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	56.8	6.3e-42
WP_097746533.1|3360679_3361835_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000199475.1|3363034_3363223_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|3363219_3363408_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|3363808_3363973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208669.1|3363976_3364195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|3364286_3364487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000444611.1|3364898_3365543_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	6.1e-09
WP_001261756.1|3365642_3365870_+	cell division protein	NA	NA	NA	NA	NA
WP_000917749.1|3366535_3366733_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_032208672.1|3366883_3367960_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	87.3	3.8e-181
WP_001443281.1|3368552_3368879_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_000143458.1|3371253_3371433_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|3371473_3371719_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|3371796_3372012_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_047618934.1|3372016_3372550_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	98.9	1.5e-101
WP_001056885.1|3372824_3373394_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|3373393_3373543_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_106888077.1|3373609_3374823_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_129014757.1|3375083_3375269_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	4.9e-20
WP_001302717.1|3375794_3376109_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032208325.1|3376190_3376415_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	5.0e-19
3374818:3376128	attR	AGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCAGTGTGTGGTGATTATTGTCCTGCTGGTAGCCTGTGGTGCGCTTAGTCTGGGGCTGAATCATTACCGCGATAACGCCATAACCTACAAAGAGCAGCGCGATAAAAAAGTCAGTGAGCTGGAGCTGGCAAATGCAACCATTACTGATATGCAGCAGCGCCAGCGTGATGTTGCTGCACTTGATGCCAGATACTCGAGGGAATTAGCCGATGCGAGAGCTGAAAATGAAACTCTGCGTGCTGATGTTGCCGCTGGTCGTAAGCGCCTGCGCATCAACGCCAACTGCCCAGGCTCCTTGCGTAAAGCCCCCATCACCTCCGGCGTGGATAATGCAACCGGTCCCCGACTGGCAGAAGCCGCTGAACGGGATTATTTCATCCTCAGAGAACGGCTGATGGCAATGCAGAAGCAACTGGAAGGAGCACAGGAATATATCCGTACCCAGTGTATACCGTGATGTTTTGTTACGAAGGTGTTACTGGTAACATTAAGGTAATTTAACAAAGAGTCAGTTCCGGACTTTATAGTGTGCTCAGTTCATGGCCAAAAACGATTTCTGTGATAAATATTTTGAATATTATTTACAGGTAAATGGAGTGGGGCGCATGGATAGAAATATTACAATAGAGTATGAAGTATATGCCCGTATTGTATGGGCAGAGAAGGCAAAAACATGGTAATTCCGTGTGTTGCCATGATACCTGATTGGCAGAATTGTTGTTTGGTTTTGAGTATATAGTCAGCGTCTTTTGTTCGGTAATTGCTCTTTCAATTAAAATGCCAGATATGATTTGCTTTTCTTTGTTGTTTAGTTTTTTTGTATATTATTTTTATTGTTTTTATATAATTAGTTTTTTATTGTTGTCTTATTAAGGACGGTAAATTCAGGATGGCAGTCTGTAGATAAACGGAGGTTACTTATGCTACATGATCACCTGGCAGAATGTCTGGAGAAAAAAGGACTGTACCGGAGAGCAGCTGAACGATGGGCAAAAGTGATGGTACAGCTAAGTGATGACCAGAAAAGAAAAGTGGCGGCACAGAAACGAGCAGAGTGTTTGCGTAAGGCGCGCCGGACTCCGGTTTCACCGGTGAACCTGACCGAAATAAAACAAGCGGTCAACAGACTACATTCTGAGTTGGGAATGGGATTTGAAGAGCGGCGGGTATTCCGACGATATAAAGGGACAGGAGAACAGAATACGTCCGGAAACGCGCGGTCAAAAAAATGCTAAAAAATATCTGAGAGCGTTA	NA	NA	NA	NA
WP_106918788.1|3377703_3377811_+	hypothetical protein	NA	A0A2R2Z352	Escherichia_phage	100.0	3.2e-08
WP_001023986.1|3377869_3378139_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_000692020.1|3379272_3379863_+	protein kinase	NA	NA	NA	NA	NA
WP_001079499.1|3380900_3381407_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|3382038_3382218_-	general stress protein	NA	NA	NA	NA	NA
WP_000443055.1|3382598_3383405_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|3383404_3384598_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_032206824.1|3384609_3385968_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	5.0e-37
WP_000763511.1|3385971_3387567_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_032206802.1|3387566_3389129_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|3389220_3389265_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_032206803.1|3389402_3390284_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|3390280_3390901_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|3391001_3391874_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|3391913_3392504_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_032206806.1|3392500_3393259_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	5.2e-07
WP_032206807.1|3393478_3394528_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	6.0e-22
WP_001031530.1|3394563_3394815_-	YciN family protein	NA	NA	NA	NA	NA
WP_032206808.1|3395194_3397792_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.0e-86
>prophage 214
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3402716	3403307	5135675		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3402716_3403307_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 215
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3411122	3506281	5135675	lysis,integrase,tail,holin,transposase	Escherichia_phage(61.19%)	100	3416098:3416114	3494854:3494870
WP_000484984.1|3411122_3413057_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_032206815.1|3413124_3414252_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3414396_3415185_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_074433631.1|3415552_3415906_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|3415973_3416780_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
3416098:3416114	attL	TCGCCCTGATGCATCAC	NA	NA	NA	NA
WP_001128858.1|3416781_3417774_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146163.1|3417773_3418664_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_032206827.1|3418840_3420028_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	4.6e-119
WP_001563185.1|3419991_3420234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021351637.1|3420515_3420749_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000994793.1|3420892_3421273_-	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_001291843.1|3421308_3421521_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_032206818.1|3421480_3422107_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	99.5	4.0e-122
WP_000809302.1|3422103_3422535_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211992.1|3422590_3423268_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_001260979.1|3423592_3423850_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	4.2e-38
WP_001451755.1|3423978_3424176_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001302866.1|3424265_3424571_+	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451754.1|3424613_3425183_-	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_000206752.1|3425444_3426068_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_000212746.1|3426071_3426359_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|3426360_3426579_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_032206820.1|3426580_3426796_-	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	97.2	8.7e-37
WP_001301469.1|3426755_3427262_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001303141.1|3427263_3428211_-	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_000157000.1|3428434_3428638_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000995345.1|3430814_3431096_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|3431116_3431398_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000917252.1|3431409_3431622_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_071887479.1|3431692_3432589_-	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	72.0	5.2e-99
WP_032207145.1|3433091_3434045_-	restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	99.7	3.5e-186
WP_032207143.1|3434041_3435511_-	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	100.0	2.7e-286
WP_001056250.1|3435605_3436319_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|3436414_3436618_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_077744819.1|3436788_3436983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032207142.1|3437149_3437527_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	99.2	1.2e-60
WP_000913117.1|3437520_3439041_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	98.2	4.0e-301
WP_001193569.1|3439030_3440002_+	DNA primase	NA	A0A0H4IPK0	Shigella_phage	96.6	3.8e-188
WP_000402090.1|3440001_3440451_+	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	98.0	1.0e-79
WP_001187434.1|3440458_3441022_+	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000144764.1|3441018_3441213_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204844.1|3441205_3441640_+	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_001356551.1|3441888_3442041_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|3442423_3443383_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|3443394_3443664_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000143458.1|3446223_3446403_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|3446443_3446689_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|3446766_3446982_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_047618934.1|3446986_3447520_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	98.9	1.5e-101
WP_001056885.1|3447794_3448364_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|3448363_3448513_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|3448520_3448985_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|3449016_3449310_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|3449459_3449663_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_106888077.1|3449937_3451151_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_000479105.1|3451964_3452396_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_044861160.1|3452422_3452827_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.6e-42
WP_032206995.1|3455382_3455712_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	1.2e-56
WP_060552849.1|3455711_3456410_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_060552850.1|3456415_3457159_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	99.2	2.1e-146
WP_123007084.1|3457104_3457737_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	1.0e-104
WP_106918789.1|3457982_3461462_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.4	0.0e+00
WP_106918790.1|3461528_3462128_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	3.7e-109
WP_129014758.1|3462192_3463776_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	100.0	4.2e-59
WP_122988840.1|3463886_3463964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|3464178_3465192_+	peptidase M85	NA	NA	NA	NA	NA
WP_106918763.1|3465645_3466802_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.6e-68
WP_096845570.1|3466853_3467144_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	82.0	2.6e-20
WP_000347482.1|3467203_3468487_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527756.1|3468575_3470036_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	8.6e-43
WP_000214712.1|3470071_3470275_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_032208665.1|3470451_3471138_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000636571.1|3471226_3471973_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_032208663.1|3472109_3474155_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_032208661.1|3474198_3474744_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_106918763.1|3474754_3475911_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.6e-68
WP_000671731.1|3476258_3476651_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592822.1|3476905_3477796_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
WP_000901367.1|3478014_3478110_-	protein MgtS	NA	NA	NA	NA	NA
WP_071887482.1|3478236_3478425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087214.1|3478619_3479519_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803659.1|3479549_3479768_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|3479799_3480183_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|3480202_3480637_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|3480848_3481514_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_032206991.1|3481538_3482729_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_032206990.1|3482878_3483994_-	putative protein YneK	NA	NA	NA	NA	NA
WP_032206989.1|3484070_3484952_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001364729.1|3485052_3486441_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077744806.1|3486504_3488553_+	glutaminase B	NA	NA	NA	NA	NA
WP_000637082.1|3488759_3489674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286590.1|3489677_3490436_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558524.1|3490492_3490783_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774169.1|3490806_3491682_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_032206988.1|3491708_3492731_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000911184.1|3493734_3494763_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194905.1|3494756_3496292_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
3494854:3494870	attR	TCGCCCTGATGCATCAC	NA	NA	NA	NA
WP_000154339.1|3496539_3497493_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_085972493.1|3501396_3502669_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_074433597.1|3502654_3506281_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	35.0	1.1e-115
>prophage 216
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3521579	3528515	5135675		Bacillus_phage(50.0%)	3	NA	NA
WP_032205826.1|3521579_3523265_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	1.7e-10
WP_032205827.1|3523302_3525675_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_074433596.1|3525719_3528515_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
>prophage 217
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3533793	3537600	5135675		Bacillus_virus(50.0%)	2	NA	NA
WP_000426277.1|3533793_3535176_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_074433598.1|3535200_3537600_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 218
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3541917	3543823	5135675		Planktothrix_phage(100.0%)	2	NA	NA
WP_032205833.1|3541917_3542904_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	6.5e-18
WP_032205834.1|3542896_3543823_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
>prophage 219
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3548261	3548546	5135675		Escherichia_phage(100.0%)	1	NA	NA
WP_000781370.1|3548261_3548546_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 220
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3554558	3554849	5135675		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|3554558_3554849_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 221
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3561661	3563206	5135675		Escherichia_phage(100.0%)	1	NA	NA
WP_032205836.1|3561661_3563206_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 222
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3569518	3573736	5135675		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_060552862.1|3569518_3573736_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	4.9e-22
>prophage 223
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3578594	3580703	5135675		Ralstonia_phage(100.0%)	1	NA	NA
WP_047617779.1|3578594_3580703_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.4	1.4e-25
>prophage 224
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3585609	3587712	5135675		Salmonella_phage(100.0%)	1	NA	NA
WP_032206943.1|3585609_3587712_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 225
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3591977	3592787	5135675		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_032206939.1|3591977_3592787_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	5.9e-17
>prophage 226
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3596168	3600713	5135675		Mycoplasma_phage(33.33%)	5	NA	NA
WP_032206935.1|3596168_3597182_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	4.6e-27
WP_000047429.1|3597199_3598345_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760626.1|3598589_3599996_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|3600074_3600491_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|3600536_3600713_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
>prophage 227
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3605133	3715867	5135675	tRNA,terminase,portal,integrase,tail,holin,protease,transposase	Escherichia_phage(39.06%)	107	3661768:3661793	3707121:3707146
WP_000826403.1|3605133_3606342_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.5e-205
WP_000586732.1|3607844_3608438_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_032206931.1|3609552_3610509_+	acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|3611126_3611351_-	YdcH family protein	NA	NA	NA	NA	NA
WP_047087872.1|3611490_3613146_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000414564.1|3615254_3616178_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206697.1|3616215_3617856_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|3618254_3618404_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|3618475_3618649_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|3618893_3619424_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_106918791.1|3619612_3620614_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032206698.1|3622063_3625966_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	7.6e-54
WP_000048948.1|3626166_3626772_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_032206699.1|3627451_3628057_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_032206701.1|3628227_3630534_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_024226022.1|3630597_3631458_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_024226021.1|3631689_3632280_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039879.1|3632261_3633212_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_032206703.1|3633312_3634626_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_032206704.1|3634652_3635858_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|3635857_3636280_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_032206706.1|3636269_3637697_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969780.1|3637698_3638487_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292357.1|3638486_3639254_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_032206707.1|3639250_3640321_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189193.1|3640328_3640826_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_024226016.1|3640840_3641587_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|3641595_3641883_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|3641894_3642824_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_032206709.1|3643108_3645154_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_032206710.1|3645401_3647675_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138622.1|3647733_3649233_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_032206711.1|3649468_3650374_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001296730.1|3650545_3650872_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|3650879_3651065_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_032206712.1|3651061_3653701_-	YdbH family protein	NA	NA	NA	NA	NA
WP_032206713.1|3653908_3654898_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	6.6e-71
WP_001298828.1|3655008_3655431_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_032206714.1|3655427_3655694_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032206716.1|3655967_3659492_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_032206718.1|3659859_3660993_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
WP_032206719.1|3661133_3661568_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	3.0e-28
3661768:3661793	attL	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_001143784.1|3662148_3662790_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|3662871_3663501_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|3663573_3664149_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023406.1|3664261_3664531_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_000279065.1|3664532_3665855_-|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001228289.1|3665919_3666519_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_032208636.1|3666586_3670060_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
WP_096851774.1|3670300_3670930_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000194798.1|3670875_3671619_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001356552.1|3671629_3672328_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000847298.1|3672327_3672657_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918276.1|3672653_3675299_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000532073.1|3675342_3675651_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|3675677_3676100_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|3676113_3676866_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3676873_3677272_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3677284_3677908_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3677910_3678192_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3678184_3678511_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_129014759.1|3678598_3680623_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|3680567_3682070_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|3682069_3682282_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|3682278_3684402_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|3684398_3684875_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|3684907_3685180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|3685391_3685577_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3685804_3685951_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3685950_3686520_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3686790_3687324_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001072899.1|3687328_3687544_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|3687621_3687867_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3687907_3688087_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000640110.1|3690870_3691413_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_000228017.1|3691409_3691700_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000940305.1|3691699_3692299_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_071525388.1|3692370_3692622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902698.1|3692858_3693071_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000418464.1|3693193_3694315_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001138877.1|3694301_3694952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014164.1|3695106_3695337_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001151116.1|3695333_3695756_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000450718.1|3695771_3696533_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_000788984.1|3696555_3697302_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_106918792.1|3697308_3698097_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000702017.1|3698174_3698597_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001033914.1|3698593_3698836_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|3698932_3699352_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|3699658_3699811_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000887681.1|3700222_3701071_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560226.1|3701117_3701339_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_001427414.1|3701338_3701509_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000102194.1|3701589_3704259_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000166315.1|3704251_3705061_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042853000.1|3705117_3705312_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|3705304_3705493_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_000079604.1|3705592_3705808_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040845.1|3705809_3707045_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_001157382.1|3707096_3708032_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
3707121:3707146	attR	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_000123758.1|3708160_3709534_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3710018_3711002_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|3711256_3712489_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_001046821.1|3712509_3713073_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_077744805.1|3713267_3713921_-	MFS transporter	NA	NA	NA	NA	NA
WP_032206929.1|3714197_3714809_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206920.1|3715351_3715867_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 228
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3728938	3795344	5135675	protease,integrase,holin,transposase	Escherichia_phage(34.78%)	52	3787388:3787403	3798887:3798902
WP_106918793.1|3728938_3730094_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.0e-68
WP_001365271.1|3731135_3732677_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_032206830.1|3732824_3733886_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_032206832.1|3733882_3735280_-	YcjX family protein	NA	NA	NA	NA	NA
WP_032206833.1|3735434_3736433_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206834.1|3736543_3737449_-	monomeric porin OmpG	NA	NA	NA	NA	NA
WP_032206836.1|3737493_3738576_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
WP_000775790.1|3738589_3739249_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_001299974.1|3741509_3742565_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000690242.1|3742574_3743363_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_032206837.1|3743380_3744433_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_032206838.1|3744463_3745306_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_032206839.1|3745292_3746174_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000597447.1|3746194_3747487_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032206840.1|3747500_3749180_-	sugar phosphorylase	NA	NA	NA	NA	NA
WP_000473109.1|3749391_3749706_-	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_000907387.1|3750010_3750370_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_001274963.1|3750369_3750594_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_000511025.1|3750647_3751316_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_000852835.1|3751482_3752460_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_000069226.1|3752577_3753843_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
WP_032206842.1|3753880_3755161_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_032206843.1|3755162_3756641_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_032206846.1|3756790_3757348_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_120795382.1|3759915_3760080_+	protein YmjE	NA	NA	NA	NA	NA
WP_024225995.1|3760069_3761455_+	putrescine/proton symporter PuuP	NA	NA	NA	NA	NA
WP_001015110.1|3761588_3761834_+	YmjA family protein	NA	NA	NA	NA	NA
WP_000583277.1|3763785_3764751_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_060552867.1|3764892_3773274_-	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	98.4	0.0e+00
WP_106888148.1|3774134_3775347_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_106918794.1|3778577_3779291_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3779385_3779625_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_032206343.1|3779911_3780730_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032206342.1|3780883_3781255_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	1.2e-52
WP_001217436.1|3781244_3781616_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_047618481.1|3781628_3782678_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	4.5e-110
WP_047088205.1|3782679_3782958_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013632.1|3783125_3783338_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_122083109.1|3783382_3783490_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_096913359.1|3783496_3783706_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	69.0	1.6e-06
WP_106888170.1|3783671_3784885_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	1.6e-167
WP_000284518.1|3785248_3785464_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290231.1|3785540_3785813_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|3785853_3786033_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
3787388:3787403	attL	CAGCACATTTTTCGGG	NA	NA	NA	NA
WP_000301787.1|3788916_3789630_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074433665.1|3789764_3789962_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	93.8	1.4e-25
WP_001452492.1|3790188_3790557_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	64.2	7.0e-34
WP_106888148.1|3790614_3791828_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_032207949.1|3792075_3793239_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.5	1.9e-226
WP_077744831.1|3793276_3793831_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	4.1e-62
WP_032207946.1|3793832_3794687_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|3794729_3795344_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
3798887:3798902	attR	CAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 229
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3813105	3814407	5135675		Bacillus_phage(100.0%)	1	NA	NA
WP_032207934.1|3813105_3814407_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	2.1e-16
>prophage 230
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3824302	3826114	5135675		Vaccinia_virus(100.0%)	1	NA	NA
WP_032207931.1|3824302_3826114_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 231
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3845995	3847270	5135675	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3845995_3847270_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 232
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3854181	3856644	5135675	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|3854181_3854703_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_085972493.1|3855371_3856644_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 233
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3865813	3874604	5135675		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101190.1|3865813_3866629_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|3866756_3867338_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_032207916.1|3867483_3868653_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|3868818_3868908_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|3869205_3870231_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_032207914.1|3870227_3871160_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106918795.1|3871272_3872484_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|3872774_3873923_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|3873962_3874604_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 234
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3880108	3882375	5135675		Edwardsiella_phage(50.0%)	3	NA	NA
WP_032207905.1|3880108_3880921_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069986.1|3880924_3881710_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_050439356.1|3881706_3882375_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	36.8	7.7e-23
>prophage 235
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3890673	3895757	5135675		environmental_halophage(33.33%)	5	NA	NA
WP_000144589.1|3890673_3891894_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	1.7e-92
WP_000908002.1|3891890_3893162_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948855.1|3893136_3893883_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_032207897.1|3893892_3895380_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|3895388_3895757_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 236
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3919606	3933741	5135675	tRNA	Tupanvirus(28.57%)	16	NA	NA
WP_001082229.1|3919606_3920653_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_005136485.1|3920784_3920976_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_032207883.1|3920979_3922416_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001300634.1|3922478_3923192_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209785.1|3923438_3923903_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_032207881.1|3923980_3924730_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	3.5e-08
WP_001154187.1|3924729_3925281_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|3925343_3926324_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229263.1|3926424_3926724_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.4e-11
WP_000672359.1|3926728_3929116_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|3929130_3930114_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|3930396_3930441_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|3930563_3930920_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3930972_3931170_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|3931266_3931809_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|3931812_3933741_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 237
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3942424	3944686	5135675		Tupanvirus(100.0%)	1	NA	NA
WP_032207871.1|3942424_3944686_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 238
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3951029	3951857	5135675		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|3951029_3951857_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 239
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3959333	3960554	5135675		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|3959333_3960554_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 240
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3967309	3967963	5135675		Planktothrix_phage(100.0%)	1	NA	NA
WP_001299561.1|3967309_3967963_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	3.8e-14
>prophage 241
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3973562	3975524	5135675		Streptococcus_phage(100.0%)	1	NA	NA
WP_032207849.1|3973562_3975524_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	9.2e-40
>prophage 242
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3980450	3984536	5135675		Tupanvirus(50.0%)	4	NA	NA
WP_032207846.1|3980450_3981092_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.3	1.1e-18
WP_032207957.1|3981184_3982543_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719093.1|3982660_3983419_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032207843.1|3983555_3984536_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.0e-07
>prophage 243
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3993336	3994191	5135675		Indivirus(100.0%)	1	NA	NA
WP_001186345.1|3993336_3994191_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 244
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	3997509	4002086	5135675		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|3997509_3998793_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|3998939_4000415_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_032207841.1|4000595_4002086_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 245
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4016836	4024941	5135675	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_077744832.1|4016836_4018522_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.4e-35
WP_032207819.1|4018726_4019308_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220994.1|4019347_4020043_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_032207816.1|4020100_4022011_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	7.7e-92
WP_001295493.1|4022142_4022487_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457334.1|4023326_4023506_-	YoaH family protein	NA	NA	NA	NA	NA
WP_032207815.1|4023579_4024941_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	1.5e-41
>prophage 246
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4028801	4030352	5135675		Moraxella_phage(100.0%)	1	NA	NA
WP_032207813.1|4028801_4030352_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 247
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4035992	4036202	5135675		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4035992_4036202_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 248
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4041519	4043568	5135675		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|4041519_4043568_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 249
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4051063	4055533	5135675		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|4051063_4051720_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976472.1|4052115_4052457_-	YebY family protein	NA	NA	NA	NA	NA
WP_032207804.1|4052469_4053342_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|4053345_4053720_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|4053858_4054089_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_032207802.1|4054190_4054847_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|4054870_4055533_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 250
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4063589	4065065	5135675		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|4063589_4065065_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 251
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4069064	4076131	5135675		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|4069064_4070387_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_032207954.1|4070402_4071335_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|4071413_4072169_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_032207795.1|4072165_4072951_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|4073099_4074110_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580326.1|4074118_4074730_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072095795.1|4074868_4074934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032207793.1|4075005_4075608_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4075609_4076131_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 252
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4080149	4085246	5135675		Escherichia_coli_phage(33.33%)	4	NA	NA
WP_000639268.1|4080149_4080644_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	3.0e-72
WP_106918797.1|4080694_4082218_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000460604.1|4082232_4082997_-	hypothetical protein	NA	A0A291AY96	Shigella_phage	67.4	1.9e-86
WP_106918798.1|4083170_4085246_-	tape measure protein	NA	A0A0D4DAK9	Salmonella_phage	32.0	6.3e-55
>prophage 253
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4092736	4168481	5135675	tRNA,terminase,portal,integrase,tail,holin,plate,head,capsid,transposase	Enterobacteria_phage(69.39%)	84	4129357:4129416	4169420:4169543
WP_000019588.1|4092736_4093480_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|4093476_4094448_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_074433494.1|4094612_4096661_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_032206488.1|4097048_4097795_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|4097808_4098375_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025342.1|4098590_4100324_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001297434.1|4100500_4100989_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|4101108_4101501_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|4101500_4103579_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|4103571_4104720_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|4104921_4105566_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|4105576_4105966_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|4105980_4107030_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|4107032_4107893_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_032206489.1|4107911_4109513_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	7.5e-16
WP_032206490.1|4109558_4111220_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|4111364_4111868_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001355823.1|4111888_4113853_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|4113857_4114784_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_032206491.1|4114780_4115668_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|4115794_4116373_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|4116375_4116726_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|4117506_4117935_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_032206493.1|4117941_4119366_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|4119340_4120141_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_032206495.1|4120307_4121294_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|4121308_4122823_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_032206497.1|4122892_4123738_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032206498.1|4124534_4125038_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|4125117_4125369_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|4125483_4125570_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|4125832_4126156_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|4126326_4126824_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377225.1|4126861_4127101_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|4127291_4128503_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847911.1|4128564_4129230_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
4129357:4129416	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_032206500.1|4129586_4130588_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	2.1e-104
WP_000865208.1|4130593_4130941_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290355.1|4130970_4131621_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|4131636_4132041_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|4132130_4132268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|4132339_4132543_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|4132564_4132915_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159462.1|4132925_4133204_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000514281.1|4133215_4133458_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	4.4e-37
WP_000021668.1|4133454_4133568_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985145.1|4133654_4133858_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.3e-26
WP_000153684.1|4133854_4134100_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_032206502.1|4134241_4134607_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	2.4e-58
WP_032206503.1|4134613_4137436_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.8	0.0e+00
WP_000686557.1|4137512_4138472_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	8.4e-180
WP_000211293.1|4138476_4138791_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_032206504.1|4138810_4139230_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	42.6	4.2e-19
WP_000224220.1|4139231_4139495_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_000236495.1|4140080_4140605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206507.1|4140619_4141666_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	1.9e-201
WP_050439336.1|4141665_4142967_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.6	2.0e-229
WP_097746533.1|4142982_4144138_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_050439337.1|4144135_4144684_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.0	1.4e-91
WP_001262679.1|4144838_4145675_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	5.1e-149
WP_000632313.1|4146797_4147598_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.5	6.9e-127
WP_000063100.1|4147699_4148194_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|4148193_4148394_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|4148396_4148720_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072343.1|4148716_4149109_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780554.1|4149105_4149654_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	7.4e-64
WP_001342220.1|4151552_4152020_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000356339.1|4152012_4152648_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271917.1|4152644_4153226_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	2.8e-101
WP_000127182.1|4153222_4153573_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	98.3	7.8e-59
WP_032206508.1|4154464_4155073_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	73.9	6.5e-85
WP_032206510.1|4155069_4157073_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	42.6	9.2e-96
WP_032206512.1|4157072_4157651_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.5	7.7e-96
WP_000954200.1|4157694_4158267_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|4158423_4158912_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_106918804.1|4160386_4161599_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_001391627.1|4163031_4163160_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_000665305.1|4163195_4163561_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000290443.1|4163615_4164128_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_032206883.1|4164127_4165312_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.7	1.1e-221
WP_032206881.1|4165469_4166579_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	9.0e-202
WP_050439343.1|4166621_4166882_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_097746533.1|4166878_4168035_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000078920.1|4168340_4168481_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
4169420:4169543	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 254
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4174733	4175486	5135675		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|4174733_4175486_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 255
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4187148	4187817	5135675		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334601.1|4187148_4187817_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	7.3e-82
>prophage 256
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4201831	4281872	5135675	lysis,terminase,integrase,tail,holin,head,capsid,transposase	Enterobacteria_phage(33.33%)	56	4209158:4209174	4286714:4286730
WP_077744804.1|4201831_4203526_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|4203696_4203879_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|4203957_4204875_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_032206887.1|4205047_4205968_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786005.1|4205956_4206427_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001157239.1|4206407_4207826_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365561.1|4207892_4208588_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_074433652.1|4208627_4208993_-	permease	NA	NA	NA	NA	NA
4209158:4209174	attL	TTTTTTGATTTCTGTGT	NA	NA	NA	NA
WP_085947598.1|4210204_4211366_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000218207.1|4212573_4213425_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_032207117.1|4213532_4214891_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.2	8.7e-05
WP_158707954.1|4214904_4215561_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	34.7	2.9e-30
WP_032205316.1|4215693_4216107_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740103.1|4216215_4217220_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240105.1|4217220_4217856_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001317164.1|4218091_4218763_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_085972493.1|4219233_4220506_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_032207191.1|4221970_4222624_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_071887496.1|4222948_4223680_+	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_158707953.1|4223805_4225389_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	100.0	4.2e-59
WP_001230532.1|4225453_4226053_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_106918805.1|4226119_4226320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106888148.1|4226848_4228061_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_115801847.1|4236804_4236894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129014760.1|4237000_4238584_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	100.0	4.2e-59
WP_001230532.1|4238648_4239248_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_060552875.1|4239314_4242791_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.1	0.0e+00
WP_000649829.1|4242924_4243452_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122993101.1|4243642_4244275_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	7.6e-105
WP_060552876.1|4244220_4244964_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	1.8e-145
WP_032207182.1|4244969_4245668_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_000807944.1|4245667_4246009_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_001513217.1|4249315_4249525_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|4249620_4249995_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_047619258.1|4250000_4250717_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	4.3e-128
WP_000133391.1|4250783_4251128_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|4251124_4251571_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_060552877.1|4251567_4251918_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	2.7e-59
WP_000125990.1|4251927_4252254_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063096.1|4254615_4254837_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_060552881.1|4254881_4256819_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.5	0.0e+00
WP_032207769.1|4258545_4259109_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	79.5	1.6e-58
WP_032207766.1|4259397_4259763_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.3e-64
WP_000736096.1|4261726_4261951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047618419.1|4261947_4262442_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	98.8	1.1e-82
WP_047087679.1|4262739_4263273_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	1.6e-100
WP_000731236.1|4263323_4263668_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411811.1|4263672_4263879_-|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_060552882.1|4264266_4266117_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_001344632.1|4266560_4266692_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_106888148.1|4268787_4270000_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_000096346.1|4271330_4271534_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|4271533_4272559_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001515476.1|4272794_4273592_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_064734930.1|4274054_4280654_+	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_106888148.1|4280659_4281872_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
4286714:4286730	attR	ACACAGAAATCAAAAAA	NA	NA	NA	NA
>prophage 257
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4296728	4297538	5135675		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000034.1|4296728_4297538_-	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.1	4.1e-10
>prophage 258
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4315031	4316198	5135675		Stx2-converting_phage(100.0%)	1	NA	NA
WP_032206763.1|4315031_4316198_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	2.5e-226
>prophage 259
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4323842	4324742	5135675		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|4323842_4324742_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 260
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4332096	4333263	5135675		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000704889.1|4332096_4333263_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	5.0e-110
>prophage 261
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4341921	4343325	5135675		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_047617809.1|4341921_4343325_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
>prophage 262
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4351612	4357304	5135675		uncultured_Mediterranean_phage(20.0%)	5	NA	NA
WP_032206598.1|4351612_4352323_-	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.4	1.1e-11
WP_032206600.1|4352319_4353474_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	32.8	2.0e-34
WP_032206630.1|4353473_4354472_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	38.5	1.7e-42
WP_000183060.1|4354841_4355735_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_032206602.1|4355909_4357304_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	29.6	2.2e-19
>prophage 263
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4363096	4369890	5135675		Bacillus_phage(25.0%)	6	NA	NA
WP_001360303.1|4363096_4364467_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.2	1.3e-32
WP_000079290.1|4364659_4366096_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.6	3.9e-48
WP_000699695.1|4366098_4367322_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479841.1|4367318_4367798_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043590.1|4367800_4368766_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.3e-87
WP_032206608.1|4368768_4369890_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	2.0e-132
>prophage 264
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4374133	4384786	5135675		uncultured_marine_virus(20.0%)	8	NA	NA
WP_032206613.1|4374133_4374973_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_032206615.1|4375150_4377313_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|4377315_4377759_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|4377764_4378904_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001339006.1|4379562_4381146_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_032206617.1|4381596_4383450_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|4383471_4384053_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_032206618.1|4384144_4384786_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	4.2e-34
>prophage 265
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4389449	4390802	5135675		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469735.1|4389449_4390802_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	4.6e-06
>prophage 266
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4404651	4411535	5135675	tRNA	Bacillus_phage(50.0%)	7	NA	NA
WP_032206624.1|4404651_4406055_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	1.5e-31
WP_000137873.1|4406051_4406774_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_001307279.1|4407515_4407812_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|4407813_4408110_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032206625.1|4408212_4409574_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.2e-216
WP_001318299.1|4409904_4410222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807346.1|4410635_4411535_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
>prophage 267
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4415430	4416704	5135675	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085972493.1|4415430_4416704_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 268
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4422086	4425643	5135675		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|4422086_4423091_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_032206397.1|4423087_4424053_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|4424026_4424773_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351455.1|4424824_4425643_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
>prophage 269
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4436288	4438322	5135675	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|4436288_4438322_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 270
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4449955	4463339	5135675	tail,transposase	Enterobacteria_phage(63.64%)	12	NA	NA
WP_001292764.1|4449955_4451092_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
WP_106888220.1|4452611_4453767_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.3e-67
WP_032207041.1|4454480_4454942_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	9.2e-76
WP_032207043.1|4454981_4455452_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_000598641.1|4455498_4456218_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4456214_4457900_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_032207044.1|4458414_4458663_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	82.9	3.4e-32
WP_001121225.1|4459257_4459908_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491544.1|4460132_4461008_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.9	9.7e-159
WP_047087983.1|4461147_4461417_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	95.5	1.6e-43
WP_106918807.1|4461941_4463098_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_153244796.1|4463195_4463339_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
>prophage 271
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4467036	4473440	5135675		Enterobacteria_phage(28.57%)	9	NA	NA
WP_001028854.1|4467036_4467702_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_032208532.1|4467698_4468310_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	3.7e-96
WP_032208534.1|4468302_4468473_-	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	1.6e-25
WP_001254257.1|4468469_4468652_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_064756364.1|4468648_4469146_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	5.4e-90
WP_029208472.1|4470928_4471630_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_001216963.1|4471689_4471797_+	protein YohO	NA	NA	NA	NA	NA
WP_032206266.1|4471777_4472509_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_032206267.1|4472513_4473440_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	6.3e-23
>prophage 272
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4493774	4495295	5135675		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|4493774_4495295_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 273
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4498989	4499658	5135675		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|4498989_4499658_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 274
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4511072	4511930	5135675		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|4511072_4511930_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 275
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4526357	4530658	5135675		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_032206295.1|4526357_4527824_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	1.7e-43
WP_032206296.1|4527941_4528928_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000594599.1|4528966_4529680_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|4530091_4530658_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 276
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4536412	4544060	5135675		Vibrio_phage(50.0%)	7	NA	NA
WP_032206299.1|4536412_4538002_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.2	5.5e-19
WP_000202798.1|4538005_4538350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032206300.1|4538682_4539873_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|4539900_4540596_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|4540744_4542505_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|4542629_4542914_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|4543052_4544060_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 277
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4557083	4557701	5135675		Bacillus_virus(100.0%)	1	NA	NA
WP_032205896.1|4557083_4557701_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
>prophage 278
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4566468	4572246	5135675		Bacillus_phage(33.33%)	5	NA	NA
WP_000422188.1|4566468_4568112_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884916.1|4568187_4568838_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_032205847.1|4568837_4569902_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	51.5	1.4e-18
WP_032205848.1|4569975_4571031_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865577.1|4571142_4572246_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	1.4e-117
>prophage 279
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4576409	4579259	5135675		Hokovirus(100.0%)	1	NA	NA
WP_032205852.1|4576409_4579259_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 280
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4588957	4591585	5135675		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|4588957_4591585_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 281
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4597000	4602979	5135675		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075177.1|4597000_4599286_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|4599351_4600482_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|4600481_4600736_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_032205856.1|4600789_4601440_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779091.1|4601902_4602979_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 282
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4608872	4613188	5135675	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_000140587.1|4608872_4609775_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.2	1.1e-69
WP_000992988.1|4609815_4610619_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_032205862.1|4610636_4611926_-	MFS transporter	NA	NA	NA	NA	NA
WP_000174592.1|4611982_4613188_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 283
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4616791	4621794	5135675		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|4616791_4617394_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_032205898.1|4617700_4618840_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	3.2e-29
WP_000461657.1|4618843_4619812_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_032205864.1|4619811_4621794_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	4.1e-19
>prophage 284
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4656215	4659443	5135675		Salmonella_phage(50.0%)	3	NA	NA
WP_000813862.1|4656215_4656815_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_032205873.1|4656873_4658706_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|4658792_4659443_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 285
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4670002	4671863	5135675		Sodalis_phage(50.0%)	2	NA	NA
WP_032205876.1|4670002_4670893_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.6	9.8e-66
WP_032205878.1|4671089_4671863_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.8e-08
>prophage 286
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4676074	4677592	5135675		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4676074_4677592_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 287
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4684068	4685205	5135675		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|4684068_4685205_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 288
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4693761	4694847	5135675		Pandoravirus(100.0%)	1	NA	NA
WP_032205886.1|4693761_4694847_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.1	2.0e-89
>prophage 289
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4712930	4713863	5135675		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001455129.1|4712930_4713863_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	4.6e-167
>prophage 290
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4717254	4718688	5135675		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|4717254_4718688_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 291
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4725328	4732905	5135675		Hokovirus(50.0%)	4	NA	NA
WP_071887505.1|4725328_4728922_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_032205892.1|4728977_4730123_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_032205893.1|4730196_4731141_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283490.1|4731210_4732905_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 292
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4736596	4739420	5135675		Morganella_phage(50.0%)	4	NA	NA
WP_000484406.1|4736596_4737517_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	1.3e-76
WP_010723117.1|4737872_4737944_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_032205894.1|4738008_4739247_-	alanine transaminase	NA	NA	NA	NA	NA
WP_106377255.1|4739165_4739420_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.5e-06
>prophage 293
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4742648	4743383	5135675		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4742648_4743383_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 294
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4764908	4776602	5135675		Streptococcus_phage(40.0%)	11	NA	NA
WP_000443665.1|4764908_4766924_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_032206142.1|4766994_4767981_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254837.1|4768210_4768972_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|4769156_4770128_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_032206144.1|4770511_4770769_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|4770813_4772541_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_032206146.1|4772581_4773091_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_023063126.1|4773132_4773984_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719925.1|4774088_4774457_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001295461.1|4774459_4775371_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_000021036.1|4775504_4776602_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 295
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4783745	4788683	5135675		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001567798.1|4783745_4785050_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_032206156.1|4785107_4786007_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.5e-26
WP_000838944.1|4786102_4786678_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001399260.1|4786738_4787188_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|4787174_4787600_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|4787813_4788683_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 296
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4807435	4808386	5135675		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4807435_4808386_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 297
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4826413	4827127	5135675		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4826413_4827127_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 298
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4848367	4852368	5135675		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|4848367_4849657_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|4849742_4850369_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_032206186.1|4850692_4851730_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001028614.1|4851729_4852368_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 299
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4858802	4866425	5135675		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|4858802_4858976_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|4860615_4861131_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_032206350.1|4861146_4861686_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	93.3	9.2e-43
WP_000138282.1|4861780_4863358_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_032206389.1|4863426_4864893_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	6.8e-88
WP_032206352.1|4865054_4866425_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.6e-41
>prophage 300
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4875254	4875686	5135675		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|4875254_4875686_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 301
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4885571	4892028	5135675		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133582.1|4885571_4886855_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|4887032_4887233_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|4887244_4887580_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_032206361.1|4887581_4889432_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|4889448_4889964_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|4890059_4890383_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|4890399_4890786_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|4890813_4892028_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 302
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4914589	4925897	5135675		Bacillus_phage(50.0%)	7	NA	NA
WP_032206370.1|4914589_4915843_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.5	3.9e-100
WP_000883122.1|4916170_4917361_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|4917405_4917744_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|4917804_4919139_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_032206372.1|4919128_4919842_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|4920006_4921434_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_032206373.1|4922009_4925897_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
>prophage 303
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4930016	4930277	5135675		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032206375.1|4930016_4930277_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 304
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4933736	4937478	5135675		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|4933736_4934417_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|4934688_4935663_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|4935678_4937478_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 305
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4943269	4949528	5135675	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|4943269_4944604_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001445929.1|4944812_4945694_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|4945796_4946384_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|4946439_4946823_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_032206386.1|4947127_4947817_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	5.5e-56
WP_000997403.1|4947864_4948902_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4949108_4949528_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 306
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4954821	4956120	5135675		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|4954821_4956120_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 307
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4961893	4964467	5135675		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4961893_4964467_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 308
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4970374	4971445	5135675		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_032207549.1|4970374_4971445_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
>prophage 309
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	4985079	4985562	5135675		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|4985079_4985562_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 310
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5000709	5004834	5135675		Klosneuvirus(50.0%)	4	NA	NA
WP_001364906.1|5000709_5001990_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	7.1e-33
WP_001295173.1|5002300_5003701_+	GABA permease	NA	NA	NA	NA	NA
WP_000156817.1|5003721_5004384_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522428.1|5004384_5004834_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
>prophage 311
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5008769	5014065	5135675		Oenococcus_phage(20.0%)	5	NA	NA
WP_032207560.1|5008769_5009015_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.1e-06
WP_000080944.1|5009011_5009422_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_000246502.1|5009394_5011539_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.3	6.4e-196
WP_000777969.1|5011548_5012508_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|5012862_5014065_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 312
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5027116	5032676	5135675	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|5027116_5027302_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047202.1|5027536_5030167_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_024235815.1|5030294_5030795_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|5031037_5032099_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|5032178_5032676_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 313
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5038142	5039108	5135675		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|5038142_5039108_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 314
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5046583	5047597	5135675		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300105.1|5046583_5047597_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 315
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5065782	5072921	5135675		Escherichia_phage(75.0%)	4	NA	NA
WP_001272898.1|5065782_5068344_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_032207596.1|5068449_5069106_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	1.9e-50
WP_032207597.1|5069156_5069924_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001278994.1|5072282_5072921_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 316
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5078136	5081852	5135675		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|5078136_5079129_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_032207602.1|5079191_5080331_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|5080470_5081097_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|5081090_5081852_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 317
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5084964	5086997	5135675		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|5084964_5085570_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|5085569_5086997_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 318
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5110561	5111347	5135675		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_032207620.1|5110561_5111347_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.4e-20
>prophage 319
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5114921	5119840	5135675		Vibrio_phage(33.33%)	3	NA	NA
WP_032207621.1|5114921_5115593_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	1.7e-14
WP_000036723.1|5116816_5118115_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|5118202_5119840_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 320
NZ_CP027325	Escherichia coli strain 2013C-4830 chromosome, complete genome	5135675	5123872	5127987	5135675		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046800.1|5123872_5125174_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_000186450.1|5125230_5127987_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 1
NZ_CP027326	Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence	74671	0	5531	74671	transposase	Acinetobacter_phage(66.67%)	3	NA	NA
WP_106888148.1|1687_2901_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_106918815.1|3204_4360_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.0e-67
WP_106918816.1|4437_5531_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.8e-51
>prophage 2
NZ_CP027326	Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence	74671	8992	11113	74671		Bacillus_phage(100.0%)	1	NA	NA
WP_074433587.1|8992_11113_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.2e-45
>prophage 3
NZ_CP027326	Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence	74671	31950	37704	74671	transposase,integrase	Acinetobacter_phage(25.0%)	4	28649:28663	46259:46273
28649:28663	attL	TCAACATCCAGGCGG	NA	NA	NA	NA
WP_096913369.1|31950_33112_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_032208234.1|34399_35140_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_032208235.1|35382_36360_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.5	3.6e-101
WP_001270421.1|37416_37704_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	5.8e-20
46259:46273	attR	CCGCCTGGATGTTGA	NA	NA	NA	NA
>prophage 4
NZ_CP027326	Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence	74671	44529	51199	74671	transposase	Escherichia_phage(33.33%)	6	NA	NA
WP_032208244.1|44529_45489_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
WP_000086163.1|47046_47730_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001443814.1|47729_47948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|47959_48394_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_032208248.1|48438_49209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106888148.1|49986_51199_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
>prophage 5
NZ_CP027326	Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence	74671	59781	63161	74671		Xanthomonas_phage(33.33%)	5	NA	NA
WP_000205763.1|59781_60528_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	7.6e-11
WP_047088282.1|60586_61447_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	1.8e-11
WP_000840464.1|61549_62110_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|62242_62455_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047619094.1|62699_63161_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.4	6.1e-19
>prophage 6
NZ_CP027326	Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence	74671	69213	70782	74671	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_106918817.1|69213_70369_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_077744811.1|70275_70782_+	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	52.9	3.3e-26
