The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	0	4083	5426201		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000805902.1|3000_4083_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 2
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	9493	11454	5426201		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|9493_10444_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|10440_11454_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 3
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	14632	15742	5426201		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|14632_15742_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 4
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	21038	21806	5426201		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939395.1|21038_21806_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.9	3.8e-26
>prophage 5
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	28681	29839	5426201		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|28681_29839_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 6
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	37254	38370	5426201		Bacillus_phage(100.0%)	1	NA	NA
WP_000484026.1|37254_38370_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 7
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	42659	52630	5426201		Bacillus_phage(60.0%)	6	NA	NA
WP_001298537.1|42659_43571_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001345723.1|44745_45930_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698883.1|46055_49199_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|49195_50398_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|50587_51277_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893578.1|51334_52630_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 8
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	59582	68563	5426201	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|59582_60710_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|60732_61065_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|61092_62940_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|62950_63922_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|64050_64398_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|64574_65459_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|65757_66297_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|66447_66897_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150468.1|66900_68004_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.6e-52
WP_001021161.1|68092_68563_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 9
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	92394	97441	5426201	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|92394_93018_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|93143_94418_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|94605_96960_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|97168_97441_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 10
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	100569	101265	5426201		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|100569_101265_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 11
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	104588	108135	5426201		Bacillus_phage(100.0%)	2	NA	NA
WP_001235609.1|104588_106361_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_106894318.1|106353_108135_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	3.1e-42
>prophage 12
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	116970	120120	5426201		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|116970_120120_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 13
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	127128	135690	5426201		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|127128_127680_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|127808_129740_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|129792_130122_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|130121_130727_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678208.1|130836_132711_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|132891_133536_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|133771_134734_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801832.1|134730_135690_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 14
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	143884	146844	5426201		Escherichia_phage(50.0%)	2	NA	NA
WP_001344274.1|143884_144226_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
WP_000078268.1|144339_146844_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
>prophage 15
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	151383	152061	5426201		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|151383_152061_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 16
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	155197	163014	5426201		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|155197_155884_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561899.1|155880_158295_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014660.1|158724_163014_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
>prophage 17
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	169391	171173	5426201		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|169391_171173_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 18
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	177364	178510	5426201		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|177364_178510_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 19
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	189930	262374	5426201	integrase,head,terminase,lysis,portal,tRNA,tail,capsid,protease,transposase	Enterobacteria_phage(58.33%)	82	200091:200137	248469:248515
WP_000912345.1|189930_191316_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|191351_191873_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|191980_192193_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|192194_193061_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|193541_194084_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|194303_194996_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000691050.1|197647_198655_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250424.1|198665_199181_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805432.1|199183_199816_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
200091:200137	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|200150_201314_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|201169_201541_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|201512_201791_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|201838_202057_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|202155_202437_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|202447_202639_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|202611_202794_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_033882822.1|202790_203471_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	5.1e-131
WP_000100845.1|203467_204253_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|204258_204555_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|204630_204837_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|205432_206122_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|206226_206457_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|206526_207066_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001551200.1|207152_208082_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_000788813.1|208078_208780_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_000145915.1|208776_209079_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070442.1|209146_209479_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_033882820.1|209526_209676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|209733_211260_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001445652.1|211724_212276_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|212285_213083_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|213199_213301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033882817.1|213297_213753_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	1.6e-59
WP_000224916.1|213752_213923_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_033882815.1|213915_214206_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_001099712.1|214202_214565_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|214561_214702_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204783.1|214787_215171_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	8.8e-56
WP_000737283.1|215360_216458_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000839596.1|217046_217262_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_097490544.1|217261_217759_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	4.6e-89
WP_001228695.1|217975_218158_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|218248_218542_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|218902_219097_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|219485_220031_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_021543238.1|220005_221931_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|221927_222134_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_032358757.1|222130_223732_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000123263.1|223712_225032_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_001297109.1|225041_225374_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063286.1|225429_226455_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	1.6e-192
WP_000158905.1|226496_226895_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000752994.1|226906_227260_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000985117.1|227271_227850_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	7.8e-80
WP_000683105.1|227846_228242_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|228249_228990_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|229005_229428_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459459.1|229409_229844_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000840258.1|229836_232398_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|232394_232724_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_033882807.1|232723_233422_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	6.8e-131
WP_000140740.1|233427_234171_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.6e-146
WP_000090902.1|234107_234740_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	87.1	1.3e-91
WP_033882805.1|234800_238199_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230378.1|238265_238865_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	4.4e-110
WP_072004439.1|238929_241845_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	98.3	1.0e-58
WP_033882800.1|241844_242420_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.2e-101
WP_000087133.1|242517_243108_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000836763.1|243426_243660_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	85.7	7.0e-32
WP_120795384.1|243728_243842_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|244207_244876_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|244932_245238_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226375.1|245421_246906_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|247092_248046_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177452.1|248558_249320_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
248469:248515	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|249502_250393_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|250393_253366_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|253352_255590_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420923.1|255858_256995_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_001299580.1|257098_257410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299578.1|257524_257734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894608.1|257772_262374_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	4.5e-21
>prophage 20
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	265780	267902	5426201		Hokovirus(50.0%)	2	NA	NA
WP_000253805.1|265780_267229_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770941.1|267218_267902_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
>prophage 21
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	271047	274191	5426201		Leptospira_phage(100.0%)	1	NA	NA
WP_000573940.1|271047_274191_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
>prophage 22
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	285620	291662	5426201		Tupanvirus(50.0%)	3	NA	NA
WP_000077703.1|285620_289502_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.2	8.4e-61
WP_000096744.1|289716_290850_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|290846_291662_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 23
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	306208	308031	5426201		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|306208_306838_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029824.1|306810_308031_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.7e-58
>prophage 24
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	311140	313255	5426201		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|311140_312706_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|312826_313255_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 25
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	328680	329328	5426201		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|328680_328890_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|328944_329328_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 26
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	334143	336583	5426201		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|334143_335355_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231415.1|335494_336583_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 27
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	343593	346176	5426201	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|343593_346176_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 28
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	353114	356647	5426201		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367852.1|353114_354785_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.5	5.2e-76
WP_001207503.1|354868_355804_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|355921_356647_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 29
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	364543	365623	5426201		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|364543_365623_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 30
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	369719	371384	5426201		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|369719_371384_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 31
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	376010	379824	5426201	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|376010_377957_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|378159_379824_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 32
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	383973	384738	5426201		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773296.1|383973_384738_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	5.8e-06
>prophage 33
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	391393	404114	5426201		Bacillus_phage(25.0%)	8	NA	NA
WP_000186103.1|391393_392071_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001306984.1|392067_394752_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_001297248.1|394744_395317_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087967.1|395325_397374_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_000741112.1|397396_399070_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|399069_399159_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|399471_399678_+	YbfA family protein	NA	NA	NA	NA	NA
WP_106894319.1|399920_404114_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	9.5e-26
>prophage 34
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	408577	411519	5426201		Hokovirus(50.0%)	2	NA	NA
WP_000628042.1|408577_409996_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.0	1.8e-61
WP_001032694.1|410037_411519_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 35
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	414897	415689	5426201		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|414897_415689_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 36
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	451727	455248	5426201		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|451727_452447_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|452443_453385_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|453498_453879_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|454195_455248_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 37
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	459604	466178	5426201		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|459604_460621_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096881.1|460881_462354_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147439.1|462421_463210_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|463338_463488_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_106894321.1|463654_464428_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604032.1|464427_465117_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|465119_466178_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 38
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	476533	477823	5426201		Klosneuvirus(100.0%)	1	NA	NA
WP_001307065.1|476533_477823_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 39
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	484304	485213	5426201		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|484304_485213_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 40
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	496524	511335	5426201		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996099.1|496524_498261_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_001296990.1|498253_499249_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|499251_499923_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|500151_501516_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|501747_502230_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001307069.1|502349_504500_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	5.7e-43
WP_000386551.1|504527_505490_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443508.1|505630_506716_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|506944_507205_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|507469_507736_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_106894322.1|507802_508486_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	9.0e-19
WP_000430039.1|508527_510810_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_001307070.1|511074_511335_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 41
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	514875	520100	5426201		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|514875_515598_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|515594_516254_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|516392_517139_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|517542_518046_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|518344_519232_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|519466_519532_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|519584_520100_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 42
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	525097	526690	5426201		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|525097_526690_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 43
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	530587	534718	5426201		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209359.1|530587_533020_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001307076.1|533025_533925_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001351540.1|534055_534718_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	1.6e-25
>prophage 44
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	537945	539817	5426201		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|537945_539817_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 45
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	551152	552355	5426201		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|551152_552355_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 46
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	560921	570072	5426201		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|560921_561179_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|561338_561626_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189152.1|561609_562332_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|562392_563295_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|563382_563859_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_106894324.1|564210_565323_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000995994.1|565417_566551_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_097490489.1|566560_567514_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|567510_568356_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_066008872.1|568415_568904_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149734.1|568944_570072_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
>prophage 47
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	573409	576147	5426201		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|573409_574138_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270735.1|574355_574871_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|574996_575320_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255146.1|575316_576147_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	29.4	1.3e-06
>prophage 48
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	579734	581453	5426201		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_106894326.1|579734_581453_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	1.5e-30
>prophage 49
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	590712	681376	5426201	integrase,head,terminase,holin,portal,tRNA,tail,capsid,protease,transposase	Cronobacter_phage(32.14%)	100	613820:613837	680876:680893
WP_000188193.1|590712_592659_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|592731_592956_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_032211289.1|593360_594599_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.0	1.2e-125
WP_032211288.1|595010_595220_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	3.7e-16
WP_157906231.1|595337_595586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894327.1|595589_595799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050437335.1|595895_596123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894609.1|596355_596592_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_106894328.1|596516_596702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894329.1|596705_596915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894330.1|596959_597163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894331.1|597220_597520_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_106894332.1|597516_599265_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	1.9e-89
WP_032211280.1|599613_600054_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_077698280.1|600139_600538_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	37.8	5.3e-11
WP_032211279.1|600506_600800_+	PerC family transcriptional regulator	NA	S4TT84	Salmonella_phage	44.8	2.4e-05
WP_106894333.1|601251_601638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894334.1|601725_602046_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106904516.1|602029_602224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050437333.1|603580_604279_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_106894335.1|604744_605638_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_032211274.1|605719_607207_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.1	3.7e-09
WP_106894336.1|607231_607651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894337.1|607650_608544_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_106894338.1|608601_609318_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_032211271.1|609337_610444_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_032211270.1|611520_611703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159032337.1|611711_612206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157906243.1|612899_613076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032211268.1|613482_613857_-	hypothetical protein	NA	NA	NA	NA	NA
613820:613837	attL	TATGAATATGCTGGCGGC	NA	NA	NA	NA
WP_106894339.1|614096_616538_+	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	26.3	6.3e-22
WP_106894340.1|616606_618076_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.8	1.9e-34
WP_106894341.1|618075_619836_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_032211263.1|621206_621518_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	78.4	7.4e-45
WP_159032338.1|621514_621946_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	60.1	3.8e-39
WP_032211261.1|622396_622747_+	toxin RelE	NA	NA	NA	NA	NA
WP_032211260.1|622748_623048_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_157906239.1|623166_623355_+	hypothetical protein	NA	A0A0P0ZCW9	Stx2-converting_phage	82.8	2.9e-20
WP_106894343.1|623697_624348_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	41.3	9.5e-18
WP_000624622.1|624347_624695_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_106894344.1|624714_626280_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.1	4.6e-167
WP_000520781.1|626568_626889_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|626919_629196_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|629880_630099_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|630383_631088_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|631129_632851_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001043618.1|632851_634618_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|634740_635706_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|636250_636745_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077012.1|636879_640947_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|641101_641713_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067740.1|641723_643067_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_000886683.1|643157_644450_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078909.1|644689_644830_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	91.3	8.5e-17
WP_062857801.1|645163_645304_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	87.0	7.2e-16
WP_086218251.1|645549_645771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033805534.1|645887_646028_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	97.8	7.7e-18
WP_033882991.1|646879_648553_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	51.8	1.3e-159
WP_000083772.1|648555_649098_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	50.8	3.1e-38
WP_033882987.1|649069_649795_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	34.0	3.5e-29
WP_000143163.1|649806_650403_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	64.4	3.7e-69
WP_097490488.1|650402_652463_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	57.7	1.5e-104
WP_000997685.1|652485_653034_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	65.0	2.9e-68
WP_000676861.1|653026_654211_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	60.7	4.6e-135
WP_001095857.1|654188_654539_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	61.5	3.8e-29
WP_000168169.1|654535_656722_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	36.6	1.2e-117
WP_157785881.1|656720_656948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208708.1|656911_657187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000811076.1|657286_657670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777030.1|657669_658008_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	79.2	8.3e-42
WP_000149053.1|658007_658760_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	51.1	1.6e-64
WP_001112746.1|658749_659055_-|holin	holin	holin	NA	NA	NA	NA
WP_000918213.1|659059_659521_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	50.7	1.3e-37
WP_000118787.1|659522_660668_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	58.2	3.6e-121
WP_000623203.1|660679_661390_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	45.6	6.0e-50
WP_001072482.1|661386_661860_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	37.9	5.3e-26
WP_001294847.1|661856_662330_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	58.2	3.3e-36
WP_000186680.1|662437_663136_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.7	2.5e-64
WP_001176672.1|663153_664182_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	53.5	7.8e-91
WP_001136170.1|664193_665243_-|capsid	phage capsid protein	capsid	R9TRS3	Vibrio_phage	47.4	8.7e-29
WP_077878963.1|665388_667215_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	53.8	3.8e-181
WP_000039248.1|667211_668264_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	60.5	2.3e-122
WP_001217942.1|668301_668565_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	55.4	6.7e-23
WP_000856556.1|668630_668957_-	MarR family transcriptional regulator	NA	K7P7K7	Enterobacteria_phage	42.4	2.3e-12
WP_000196667.1|669172_669577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894346.1|669573_672093_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	51.9	1.5e-207
WP_032209991.1|672089_672506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077698144.1|673121_673661_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000624197.1|673702_673915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096844616.1|673911_674163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096844615.1|674174_674453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000568660.1|674654_674897_-	DUF4754 family protein	NA	NA	NA	NA	NA
WP_032209998.1|674916_675255_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	66.3	1.9e-33
WP_044188229.1|675362_675557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097444531.1|675570_675966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028985710.1|675972_676497_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032210004.1|676600_676942_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	52.3	2.7e-16
WP_000023736.1|677011_678004_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	55.9	2.5e-102
WP_000850314.1|678303_680748_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.9e-221
WP_000213098.1|680758_681376_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
680876:680893	attR	TATGAATATGCTGGCGGC	NA	NA	NA	NA
>prophage 50
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	687686	690901	5426201		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|687686_688427_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292814.1|688618_690901_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.0e-162
>prophage 51
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	694999	696088	5426201		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057137.1|694999_696088_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
>prophage 52
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	701174	705715	5426201		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|701174_701459_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705710.1|701665_703930_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|703966_705715_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 53
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	720420	731553	5426201	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|720420_720969_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|720995_721643_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|721864_723055_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|723239_724328_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|724929_726330_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001367732.1|726498_727701_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193844.1|727966_730579_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090512.1|730785_731553_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 54
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	747474	749382	5426201		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|747474_749382_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 55
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	761981	764036	5426201		Bacillus_phage(100.0%)	1	NA	NA
WP_000420533.1|761981_764036_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 56
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	768269	768929	5426201	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|768269_768929_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 57
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	788194	800449	5426201		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|788194_788407_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071528578.1|788417_788606_+	cold-shock protein	NA	NA	NA	NA	NA
WP_021292990.1|788580_788811_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|788800_788974_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829654.1|789021_790095_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001307096.1|790166_792911_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264955.1|792993_794022_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|793994_794687_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001367825.1|794816_795989_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062101.1|795988_798535_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|798531_799131_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|799223_799529_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420617.1|799528_800449_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 58
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	804358	867994	5426201	integrase,terminase,holin,portal,capsid,tail,bacteriocin	Escherichia_phage(71.01%)	71	802623:802638	867248:867263
802623:802638	attL	TTCTTTATTACCGGCG	NA	NA	NA	NA
WP_001401545.1|804358_805669_-|integrase	site-specific integrase	integrase	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
WP_001208772.1|805721_806006_-	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_000497812.1|806051_806303_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000994793.1|806666_807047_-	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_001291843.1|807082_807295_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163448.1|807254_807881_-	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_000809302.1|807877_808309_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211520.1|808364_808994_-	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000203837.1|809243_809528_-	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_106894348.1|809883_810540_-	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	64.7	4.9e-62
WP_000951706.1|810536_810746_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_106894349.1|811108_811810_-	hypothetical protein	NA	K7P881	Enterobacteria_phage	87.6	3.2e-80
WP_106894350.1|811839_812034_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.3	3.5e-29
WP_106894351.1|812030_812909_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	96.2	1.7e-171
WP_077785000.1|812894_813260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894352.1|813832_814654_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	99.3	8.6e-149
WP_000077905.1|814717_815065_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_000344634.1|815140_815728_-	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
WP_000187063.1|815727_816417_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000459720.1|816413_817364_-	recombinase RecT	NA	A0A0H4IQ64	Shigella_phage	100.0	7.0e-179
WP_000995345.1|817380_817662_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_024177061.1|817682_817904_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.6	3.2e-34
WP_000917252.1|817975_818188_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_106894353.1|818258_819044_-	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	92.3	5.7e-134
WP_001064714.1|819661_820615_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|820611_822081_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|822175_822889_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|822984_823188_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_077792640.1|823358_823553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|823719_824097_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001694415.1|824090_825611_+	DEAD/DEAH box helicase	NA	A0A0H4IT01	Shigella_phage	100.0	4.9e-307
WP_001694414.1|825600_826572_+	toprim domain protein	NA	A0A0H4IPK0	Shigella_phage	100.0	1.9e-195
WP_000402092.1|826571_827021_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_106894354.1|827028_827592_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	99.5	4.4e-104
WP_106894355.1|827588_827783_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	85.9	5.3e-25
WP_089610919.1|827775_828156_+	antitermination protein	NA	A0A088CD47	Shigella_phage	92.9	2.3e-64
WP_106894610.1|828295_828889_+	hypothetical protein	NA	A0A088CBP8	Shigella_phage	81.2	5.5e-89
WP_106894356.1|829385_829817_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	95.8	1.4e-65
WP_032210869.1|829813_829972_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.2	3.3e-09
WP_106894357.1|830963_832880_+	DUF1737 domain-containing protein	NA	A0A0H4IQ82	Shigella_phage	66.1	1.8e-245
WP_106894358.1|833013_833208_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	80.0	8.2e-18
WP_089611620.1|833233_833506_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	86.7	3.7e-16
WP_000284506.1|833582_833798_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_033883643.1|833802_834336_+	lysozyme	NA	V5USG4	Shigella_phage	96.6	1.3e-100
WP_123009704.1|835160_835346_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	82.0	2.9e-20
WP_001086078.1|835703_836510_+	hypothetical protein	NA	A0A0P0ZG40	Escherichia_phage	96.3	6.9e-127
WP_106894359.1|836490_838197_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	96.1	0.0e+00
WP_106894360.1|838196_840341_+|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	95.2	0.0e+00
WP_089611271.1|840498_841503_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	88.4	8.8e-156
WP_106894361.1|841526_842741_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	97.8	3.3e-229
WP_001140445.1|842795_843185_+	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	100.0	3.8e-62
WP_001290743.1|843235_843697_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829202.1|843680_844244_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_000207922.1|844243_844894_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000117976.1|844890_847482_+|tail	tail fiber protein	tail	A0A0P0ZGL7	Escherichia_phage	100.0	6.1e-209
WP_000513231.1|847568_848081_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_024199968.1|848314_849940_+	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|849936_851205_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|851219_851498_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|851503_852121_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835361.1|852211_852946_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_000078907.1|853176_853317_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035557.1|853373_853775_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000509482.1|853869_854526_+	hypothetical protein	NA	A0A0P0ZGF6	Escherichia_phage	100.0	5.1e-104
WP_000455652.1|854528_854975_+	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000540391.1|854984_855236_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_032330628.1|855246_856512_+	hypothetical protein	NA	V5URW4	Shigella_phage	100.0	9.9e-205
WP_044781492.1|856581_864963_+	hypothetical protein	NA	A0A0H4IT29	Shigella_phage	100.0	0.0e+00
WP_001273658.1|865894_866068_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001307098.1|866150_867479_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.1e-233
867248:867263	attR	CGCCGGTAATAAAGAA	NA	NA	NA	NA
WP_001028095.1|867499_867994_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 59
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	882770	883694	5426201		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|882770_883694_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 60
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	890514	893076	5426201	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409849.1|890514_891873_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_106894362.1|891913_893076_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 61
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	898493	899327	5426201		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|898493_899327_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 62
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	903460	903994	5426201		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|903460_903994_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 63
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	913302	914223	5426201		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|913302_914223_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 64
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	918885	919131	5426201		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|918885_919131_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 65
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	934977	935919	5426201		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|934977_935919_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 66
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	948276	949458	5426201		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|948276_949011_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|949221_949458_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 67
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	952730	954373	5426201		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|952730_953372_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|953368_954373_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 68
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	966696	966954	5426201		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|966696_966954_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 69
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	974243	977966	5426201		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|974243_974945_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251350.1|974944_976189_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|976217_977129_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952727.1|977144_977966_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 70
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	981412	1071833	5426201	integrase,head,terminase,holin,capsid,tail,transposase	Escherichia_phage(37.31%)	108	979030:979044	994705:994719
979030:979044	attL	CTTGTTCTGGATGCC	NA	NA	NA	NA
WP_016232615.1|981412_982531_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.5e-82
WP_000003739.1|982499_982769_-	excisionase	NA	NA	NA	NA	NA
WP_106894364.1|982830_985323_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	3.3e-58
WP_069357045.1|985418_985607_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032210920.1|985603_985792_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_106894365.1|986490_986937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|987051_987270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096852370.1|987429_987585_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	3.4e-06
WP_042106859.1|987860_988163_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	42.2	4.9e-17
WP_001022416.1|988165_988525_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	94.1	7.2e-60
WP_096852371.1|988571_988964_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.3e-14
WP_042106866.1|989089_989362_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.4	4.2e-20
WP_042106855.1|989345_989867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894366.1|989847_990825_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.6	5.0e-55
WP_096852373.1|990831_991572_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	86.3	7.8e-117
WP_096852374.1|991601_992318_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.2	1.3e-71
WP_106894611.1|992350_992632_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	79.1	1.3e-32
WP_106894367.1|992628_992856_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	1.8e-11
WP_106894368.1|992848_993154_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	81.0	1.8e-48
WP_106894369.1|993290_993737_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	67.5	1.6e-37
WP_032313438.1|993737_993947_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	95.7	4.7e-35
WP_106894370.1|993943_994753_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	46.6	1.4e-50
994705:994719	attR	CTTGTTCTGGATGCC	NA	NA	NA	NA
WP_106894371.1|994872_995157_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	5.2e-21
WP_073568588.1|995156_995435_-	Killer protein	NA	A0A2L1IV28	Escherichia_phage	56.5	6.2e-27
WP_106894372.1|995585_995858_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	9.4e-12
WP_106894373.1|995859_996909_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.5	2.2e-112
WP_106894374.1|996921_997296_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	1.5e-36
WP_106894375.1|997292_998114_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	1.1e-79
WP_000917768.1|998341_998539_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_106894376.1|998689_999748_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.8	1.2e-190
WP_032210943.1|1000229_1000658_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_106894377.1|1001180_1003163_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	58.0	3.7e-214
WP_032211246.1|1003310_1003493_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	81.7	1.3e-20
WP_106894378.1|1003530_1003833_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000284510.1|1003910_1004126_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_106894379.1|1004130_1004889_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	91.5	3.8e-34
WP_106894380.1|1005395_1005929_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	90.4	3.7e-92
WP_159032339.1|1006121_1006259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159032340.1|1006230_1006413_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	84.4	4.5e-10
WP_106894381.1|1006420_1007188_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	55.6	5.1e-79
WP_122990151.1|1007425_1007611_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.1e-18
WP_032211250.1|1007696_1007921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042106362.1|1008266_1008593_+	TonB family protein	NA	H6WZK5	Escherichia_phage	96.3	2.0e-53
WP_000095744.1|1008724_1008925_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_106894382.1|1008966_1009332_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	3.9e-61
WP_106894383.1|1009621_1010185_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	97.3	1.4e-86
WP_106894384.1|1010181_1011843_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.7	0.0e+00
WP_106894385.1|1011906_1013844_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_016238136.1|1013888_1014110_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	1.7e-35
WP_000125998.1|1016636_1016963_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.2e-53
WP_016232490.1|1016972_1017323_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	97.4	8.6e-58
WP_032270882.1|1017319_1017766_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.0	4.9e-74
WP_000133388.1|1017762_1018107_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106894386.1|1018173_1018890_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000710962.1|1018904_1019279_+|tail	tail assembly chaperon	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001513217.1|1019374_1019584_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_106894387.1|1019631_1022874_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.2	0.0e+00
WP_016234509.1|1022866_1023208_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	1.6e-61
WP_106894388.1|1023207_1023906_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	3.8e-129
WP_073614481.1|1023916_1024660_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.5	3.0e-145
WP_159032353.1|1024605_1025238_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	87.1	7.2e-95
WP_106894390.1|1025484_1029015_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	83.8	0.0e+00
WP_159032341.1|1029199_1030759_+|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	90.6	5.8e-53
WP_032211007.1|1030773_1031442_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	80.8	9.5e-98
WP_106894391.1|1031920_1033429_+	hypothetical protein	NA	Q9LA53	Enterobacteria_phage	72.1	4.8e-97
WP_032211005.1|1033518_1033992_+	hypothetical protein	NA	Q9LA59	Enterobacterial_phage	94.2	2.4e-79
WP_021565261.1|1033996_1034170_+	hypothetical protein	NA	A0A2L1IV33	Escherichia_phage	67.2	6.4e-14
WP_001079074.1|1034975_1035506_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001349972.1|1035848_1036520_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000399589.1|1036797_1037778_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001240091.1|1038034_1038670_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740094.1|1038670_1039675_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920127.1|1039783_1040197_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001362894.1|1040329_1041001_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
WP_000826746.1|1041000_1042359_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_000218209.1|1042466_1043318_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824362.1|1043909_1044983_-	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	51.6	6.2e-99
WP_001313057.1|1045549_1045915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365545.1|1045954_1046650_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.1e-06
WP_001157238.1|1046716_1048135_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786004.1|1048115_1048586_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212226.1|1048574_1049495_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|1049667_1050585_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|1050663_1050846_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001389132.1|1051016_1052711_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491504.1|1052707_1053526_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|1053823_1054051_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071524607.1|1054159_1054402_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103987.1|1054445_1055069_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000942316.1|1055358_1056144_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187359.1|1056151_1056421_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|1056430_1057168_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001348482.1|1057167_1057533_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_097490590.1|1057535_1057949_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|1057945_1058950_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|1058954_1059419_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620113.1|1059523_1060651_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|1060647_1061091_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213318.1|1061109_1062483_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282706.1|1062482_1063169_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|1063161_1064157_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994447.1|1064149_1065808_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274295.1|1066022_1066337_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|1066670_1067003_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000734031.1|1067171_1067723_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_097490591.1|1067732_1068530_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106894392.1|1069913_1071122_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	3.3e-205
WP_000334567.1|1071161_1071833_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	4.8e-81
>prophage 71
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1083646	1084399	5426201		Bacillus_virus(100.0%)	1	NA	NA
WP_001272986.1|1083646_1084399_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	4.9e-26
>prophage 72
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1096388	1097903	5426201		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|1096388_1097903_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 73
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1107990	1113634	5426201		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001307261.1|1107990_1109652_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483220.1|1109697_1111299_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_000204335.1|1111317_1112178_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|1112180_1113230_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|1113244_1113634_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 74
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1118886	1120620	5426201	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|1118886_1120620_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 75
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1128514	1130565	5426201		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|1128514_1129258_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|1129298_1129694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639274.1|1129746_1130565_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 76
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1134583	1141647	5426201		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|1134583_1135105_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024917.1|1135106_1135709_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|1135779_1135845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580328.1|1135983_1136595_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|1136603_1137614_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|1137760_1138546_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|1138542_1139298_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|1139376_1140309_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1140324_1141647_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 77
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1145645	1147121	5426201		Cyanophage(100.0%)	1	NA	NA
WP_000301730.1|1145645_1147121_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	5.8e-79
>prophage 78
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1155177	1159647	5426201		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|1155177_1155840_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|1155863_1156520_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|1156621_1156852_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|1156990_1157365_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|1157368_1158241_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|1158253_1158595_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812724.1|1158990_1159647_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 79
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1167143	1169192	5426201		Moraxella_phage(100.0%)	1	NA	NA
WP_001055776.1|1167143_1169192_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	4.4e-85
>prophage 80
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1174523	1174733	5426201		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1174523_1174733_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 81
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1185791	1193892	5426201	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854972.1|1185791_1187153_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|1187226_1187406_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001300615.1|1187525_1187885_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|1188241_1188586_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|1188717_1190628_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220966.1|1190685_1191381_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|1191420_1192002_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|1192206_1193892_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 82
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1202796	1204444	5426201	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_000604932.1|1202796_1203228_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000826417.1|1203235_1204444_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	2.0e-207
>prophage 83
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1210394	1214971	5426201		Bacillus_phage(100.0%)	3	NA	NA
WP_001295489.1|1210394_1211885_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
WP_000616433.1|1212065_1213541_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|1213687_1214971_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 84
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1218289	1219144	5426201		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|1218289_1219144_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 85
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1231399	1232041	5426201		Tupanvirus(100.0%)	1	NA	NA
WP_001120527.1|1231399_1232041_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 86
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1236967	1238929	5426201		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235796.1|1236967_1238929_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	4.1e-40
>prophage 87
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1244526	1245180	5426201		Planktothrix_phage(100.0%)	1	NA	NA
WP_001299207.1|1244526_1245180_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	8.4e-14
>prophage 88
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1251944	1253165	5426201		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|1251944_1253165_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 89
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1260641	1261469	5426201		Bacillus_virus(100.0%)	1	NA	NA
WP_000175053.1|1260641_1261469_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 90
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1267871	1339460	5426201	plate,integrase,head,terminase,portal,tRNA,tail,capsid,transposase	Enterobacteria_phage(48.84%)	83	1289953:1289973	1327202:1327222
WP_004022510.1|1267871_1268852_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000077848.1|1269086_1271348_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
WP_001241561.1|1271530_1271794_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_000493141.1|1272082_1272439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010707.1|1272889_1274281_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_001295408.1|1274413_1275004_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106834.1|1275166_1275835_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|1275981_1276518_+	membrane protein	NA	NA	NA	NA	NA
WP_000267654.1|1276558_1277419_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146159.1|1277524_1277815_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251735.1|1277915_1278845_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000771396.1|1279131_1279890_+	YdiY family protein	NA	NA	NA	NA	NA
WP_001144192.1|1282617_1284546_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|1284549_1285092_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|1285188_1285386_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1285438_1285795_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1285917_1285962_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|1286245_1287229_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|1287243_1289631_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|1289635_1289935_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1289953:1289973	attL	GGCCGCTCTGCGGCCTTTTTT	NA	NA	NA	NA
WP_089610780.1|1290176_1290317_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	82.2	6.1e-15
WP_106894395.1|1290451_1290754_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_106894396.1|1290796_1291921_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	77.5	5.6e-159
WP_106894397.1|1292074_1293262_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	76.6	2.6e-170
WP_106894398.1|1293261_1293771_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	60.7	4.0e-56
WP_106894399.1|1293817_1294207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032158288.1|1294227_1294365_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	71.1	2.0e-10
WP_106894400.1|1294318_1297147_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	47.8	5.6e-107
WP_089611550.1|1297157_1297649_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.5	1.2e-57
WP_033804638.1|1297659_1298247_-	DUF4376 domain-containing protein	NA	A0A2L1IV45	Escherichia_phage	61.1	8.5e-58
WP_106894401.1|1298258_1299599_-	hypothetical protein	NA	Q858V4	Yersinia_virus	43.7	3.5e-59
WP_032325810.1|1299598_1300222_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	51.4	5.8e-49
WP_096852431.1|1300214_1301111_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	65.1	2.9e-97
WP_096852430.1|1301097_1301463_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.4	2.0e-33
WP_106894402.1|1302036_1302681_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.8	1.1e-47
WP_106894403.1|1302664_1303132_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	56.5	7.0e-47
WP_016237822.1|1303149_1303323_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	56.1	9.6e-10
WP_106894404.1|1303471_1305517_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	55.0	5.2e-203
WP_072145547.1|1305527_1305710_-	peptidase	NA	NA	NA	NA	NA
WP_106894405.1|1305645_1306071_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032158240.1|1306067_1306619_-	lysozyme	NA	A0A1S5Q8G1	Aeromonas_phage	40.1	5.0e-28
WP_106894406.1|1306596_1306893_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_106894407.1|1306883_1307084_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	69.7	8.4e-18
WP_000052292.1|1307083_1307578_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	62.6	8.4e-51
WP_096852462.1|1307682_1308480_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	53.4	4.4e-57
WP_106894408.1|1308520_1309621_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	60.7	2.5e-119
WP_106894409.1|1309638_1310475_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	57.2	4.4e-84
WP_096852460.1|1310630_1312364_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	71.7	1.5e-251
WP_042109434.1|1312369_1313413_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.2	7.8e-147
WP_000017881.1|1313478_1313982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894410.1|1314517_1314895_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_042109431.1|1314891_1315266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089611406.1|1315380_1315728_-	MarR family transcriptional regulator	NA	O48423	Enterobacteria_phage	43.1	8.4e-13
WP_089611408.1|1315724_1315919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089611410.1|1315938_1316340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894411.1|1316336_1318850_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	50.3	3.1e-205
WP_106894412.1|1318846_1319260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159032342.1|1319246_1320173_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	41.5	5.5e-11
WP_106894413.1|1320080_1320572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096852346.1|1320621_1320963_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	62.6	1.0e-26
WP_106894414.1|1321175_1321412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894415.1|1321447_1322416_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	45.5	1.3e-66
WP_106894416.1|1322649_1323231_-	3'-5' exoribonuclease	NA	H6WYK2	Enterobacter_phage	34.6	3.6e-24
WP_106894417.1|1323227_1323461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894418.1|1323664_1323904_-	DUF4754 family protein	NA	NA	NA	NA	NA
WP_106894419.1|1323922_1324135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894613.1|1324148_1324448_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	52.4	8.8e-19
WP_106894420.1|1324466_1324745_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_106894421.1|1324835_1325147_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	54.8	2.6e-21
WP_106894614.1|1325235_1326189_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.6	1.1e-78
WP_106894422.1|1326175_1326574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894615.1|1326809_1327091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956519.1|1327284_1328265_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1327202:1327222	attR	GGCCGCTCTGCGGCCTTTTTT	NA	NA	NA	NA
WP_001154187.1|1328327_1328879_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|1328878_1329628_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|1329705_1330170_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_106894423.1|1330416_1331130_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_033883989.1|1331192_1332629_+	YdiU family protein	NA	NA	NA	NA	NA
WP_097490460.1|1332632_1332824_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082204.1|1332955_1334002_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|1334158_1334992_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|1335324_1337703_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000553693.1|1337759_1339460_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.1e-32
>prophage 91
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1358052	1363136	5426201		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|1358052_1358421_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|1358429_1359917_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948872.1|1359926_1360673_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000908016.1|1360647_1361919_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144602.1|1361915_1363136_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	2.6e-93
>prophage 92
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1371426	1373693	5426201		Escherichia_phage(50.0%)	3	NA	NA
WP_001349911.1|1371426_1372095_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001070029.1|1372091_1372877_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587560.1|1372880_1373693_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 93
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1379196	1387988	5426201		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|1379196_1379838_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_033883972.1|1379877_1381026_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182363.1|1381316_1382528_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|1382640_1383573_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|1383569_1384595_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|1384893_1384983_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|1385148_1386318_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|1386463_1387045_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|1387172_1387988_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 94
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1396790	1398289	5426201		Indivirus(50.0%)	2	NA	NA
WP_000250668.1|1396790_1397687_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|1397767_1398289_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 95
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1405200	1406475	5426201	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_106894424.1|1405200_1406475_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 96
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1426260	1428072	5426201		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945924.1|1426260_1428072_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 97
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1437967	1439269	5426201		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|1437967_1439269_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 98
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1449369	1498494	5426201	integrase,terminase,holin,portal,capsid,protease,transposase	Shigella_phage(45.1%)	66	1453474:1453488	1482831:1482845
WP_001260855.1|1449369_1450191_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1450290_1450374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743959.1|1450466_1450802_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091835.1|1451198_1452452_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|1452558_1453452_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1453474:1453488	attL	CCGAAAAATGTGCTG	NA	NA	NA	NA
WP_033883959.1|1453586_1454807_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|1454931_1455627_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|1455579_1456872_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148705.1|1457030_1457645_-	Tat proofreading chaperone DmsD	NA	NA	NA	NA	NA
WP_000526492.1|1457687_1458542_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000254426.1|1458543_1459098_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
WP_001367379.1|1459135_1460299_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.5	1.1e-226
WP_124034985.1|1460154_1460601_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.1	4.2e-41
WP_033817303.1|1460560_1460812_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	97.6	1.4e-38
WP_062872336.1|1460860_1461541_-	YqaJ viral recombinase family protein	NA	H6WZG6	Escherichia_phage	94.7	1.4e-125
WP_033817301.1|1461537_1462323_-	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	98.1	1.3e-146
WP_033817300.1|1462328_1462625_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	82.7	1.8e-40
WP_033817299.1|1462602_1464657_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	83.8	1.9e-309
WP_062872335.1|1464764_1465151_-	hypothetical protein	NA	V5USC5	Shigella_phage	73.4	6.4e-46
WP_032211321.1|1465230_1465407_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	67.2	1.4e-16
WP_000560232.1|1465400_1465622_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	3.4e-36
WP_000189936.1|1466082_1466292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062872334.1|1466260_1466620_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	73.5	1.6e-38
WP_044809821.1|1466651_1467365_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	99.2	3.6e-127
WP_044809823.1|1467368_1467641_-	hypothetical protein	NA	A0A088CD31	Shigella_phage	98.9	5.7e-41
WP_000528776.1|1468089_1468866_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001074607.1|1468853_1469396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044809824.1|1469493_1470201_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.3	1.4e-131
WP_033811078.1|1470278_1470506_+	transcriptional regulator	NA	G9L677	Escherichia_phage	94.7	1.6e-33
WP_021499205.1|1470644_1470941_+	bacteriophage CII family protein	NA	A0A088CBI6	Shigella_phage	98.0	4.4e-47
WP_000438870.1|1470955_1471174_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_024175270.1|1471194_1472271_+	DNA-binding protein	NA	V5URT9	Shigella_phage	97.5	1.4e-204
WP_000790393.1|1472277_1473018_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	99.6	1.2e-138
WP_106894425.1|1473043_1473814_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	87.9	1.1e-116
WP_106894426.1|1473828_1474272_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	92.4	2.5e-62
WP_106894427.1|1474285_1474786_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	76.7	2.0e-23
WP_106894616.1|1475101_1475350_+	hypothetical protein	NA	A0A088CC19	Shigella_phage	89.5	1.3e-31
WP_033805719.1|1475404_1475725_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_106894428.1|1475717_1476089_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_106894429.1|1477004_1477667_+	hypothetical protein	NA	A0A088CD42	Shigella_phage	75.8	2.0e-87
WP_106894430.1|1477721_1478132_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	95.6	2.8e-68
WP_106894431.1|1478128_1478320_+	NinE family protein	NA	Q9MCP2	Enterobacteria_phage	89.5	1.5e-24
WP_106894432.1|1478343_1478634_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	97.9	1.9e-50
WP_106894433.1|1478630_1478993_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	92.5	2.1e-59
WP_106894434.1|1478989_1479184_+	protein ninH	NA	A0A088CC23	Shigella_phage	84.4	3.4e-24
WP_106894435.1|1479176_1479611_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	98.6	6.9e-81
WP_000691355.1|1480118_1481066_+	Shiga toxin Stx1c subunit A	NA	Q94M00	Enterobacteria_phage	100.0	1.9e-171
WP_042908184.1|1481084_1481345_+	Shiga toxin Stx1 subunit B	NA	Q94LZ9	Enterobacteria_phage	98.8	4.2e-41
WP_000874415.1|1482125_1484036_+	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	70.4	1.4e-263
1482831:1482845	attR	CCGAAAAATGTGCTG	NA	NA	NA	NA
WP_000576219.1|1484175_1484358_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	90.0	1.4e-22
WP_001171530.1|1484557_1484938_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.6e-65
WP_000612589.1|1484934_1485282_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_000998048.1|1485331_1486870_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_106894617.1|1486908_1487106_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	3.6e-13
WP_000284506.1|1487182_1487398_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_033883643.1|1487402_1487936_+	lysozyme	NA	V5USG4	Shigella_phage	96.6	1.3e-100
WP_123009704.1|1488760_1488946_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	82.0	2.9e-20
WP_001086078.1|1489303_1490110_+	hypothetical protein	NA	A0A0P0ZG40	Escherichia_phage	96.3	6.9e-127
WP_106894359.1|1490090_1491797_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	96.1	0.0e+00
WP_106894360.1|1491796_1493941_+|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	95.2	0.0e+00
WP_089611271.1|1494098_1495103_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	88.4	8.8e-156
WP_106894361.1|1495126_1496341_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	97.8	3.3e-229
WP_001140444.1|1496396_1496786_+	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_033800770.1|1496835_1497297_+	hypothetical protein	NA	V5URI4	Shigella_phage	100.0	1.6e-75
WP_000829201.1|1497280_1497844_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	99.5	9.2e-102
WP_001562654.1|1497843_1498494_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	99.5	1.7e-120
>prophage 99
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1502613	1509581	5426201		Escherichia_phage(55.56%)	9	NA	NA
WP_000756599.1|1502613_1502958_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	97.4	3.9e-55
WP_024166091.1|1503077_1503290_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	75.7	1.9e-20
WP_032286200.1|1503334_1503571_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	75.4	1.8e-19
WP_062872623.1|1504666_1505431_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	99.3	4.6e-72
WP_000020908.1|1505417_1505702_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	100.0	1.2e-46
WP_000763354.1|1505698_1505920_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	98.6	1.1e-34
WP_106894436.1|1505967_1506594_-	phage antirepressor Ant	NA	A0A0N6WET9	Escherichia_phage	88.5	3.8e-96
WP_000213043.1|1507033_1507147_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_001340362.1|1507157_1509581_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
>prophage 100
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1514462	1520453	5426201		uncultured_virus(20.0%)	6	NA	NA
WP_000598292.1|1514462_1514789_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1514994_1516209_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|1516220_1517240_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_000151244.1|1517297_1518665_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527797.1|1518753_1520214_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000214712.1|1520249_1520453_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 101
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1525819	1526710	5426201		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|1525819_1526710_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 102
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1534214	1536344	5426201		Pandoravirus(50.0%)	3	NA	NA
WP_000012618.1|1534214_1535654_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_000803659.1|1535710_1535929_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|1535960_1536344_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 103
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1544088	1545507	5426201		Bacillus_phage(100.0%)	1	NA	NA
WP_000558050.1|1544088_1545507_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 104
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1553388	1560009	5426201	transposase	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001194881.1|1553388_1554924_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000154340.1|1555172_1556126_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_024221658.1|1556213_1556855_-	recombinase family protein	NA	NA	NA	NA	NA
WP_024221657.1|1557021_1560009_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.1	3.5e-301
>prophage 105
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1571338	1572612	5426201	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085949152.1|1571338_1572612_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
>prophage 106
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1581598	1588534	5426201		Bacillus_phage(50.0%)	3	NA	NA
WP_000628543.1|1581598_1583284_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.1	1.3e-10
WP_000832442.1|1583321_1585694_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001307214.1|1585738_1588534_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
>prophage 107
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1593808	1597615	5426201		Bacillus_virus(50.0%)	2	NA	NA
WP_000426265.1|1593808_1595191_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001307211.1|1595215_1597615_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 108
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1601931	1603837	5426201		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193575.1|1601931_1602918_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.2e-16
WP_000072429.1|1602910_1603837_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
>prophage 109
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1607111	1608553	5426201		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|1607111_1608122_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|1608268_1608553_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 110
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1614565	1614856	5426201		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|1614565_1614856_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 111
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1621740	1623285	5426201		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|1621740_1623285_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 112
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1629088	1642500	5426201		uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_062876846.1|1629088_1633351_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
WP_071524591.1|1633431_1633674_-	DUF3969 family protein	NA	NA	NA	NA	NA
WP_000960006.1|1633891_1634344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001001073.1|1635790_1636000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894440.1|1636197_1640325_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.0e-21
WP_000103411.1|1640391_1642500_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.3e-26
>prophage 113
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1647409	1649512	5426201		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|1647409_1649512_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 114
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1653777	1654587	5426201		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|1653777_1654587_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 115
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1657968	1668120	5426201	transposase	Mycoplasma_phage(25.0%)	9	NA	NA
WP_000220396.1|1657968_1658982_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047456.1|1658999_1660145_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760615.1|1660389_1661796_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|1661874_1662291_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000494244.1|1662712_1662943_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001307191.1|1663034_1664996_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000429155.1|1665068_1665605_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001307190.1|1665657_1666872_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826402.1|1666911_1668120_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	7.8e-207
>prophage 116
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1679922	1680871	5426201		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|1679922_1680096_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|1680340_1680871_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 117
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1684810	1688713	5426201		Klosneuvirus(100.0%)	1	NA	NA
WP_000139567.1|1684810_1688713_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 118
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1719999	1720989	5426201		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|1719999_1720989_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 119
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1725949	1733219	5426201	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837924.1|1725949_1727083_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|1727223_1727658_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000081418.1|1727833_1728769_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123738.1|1728897_1730271_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|1730748_1731732_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|1731986_1733219_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 120
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1739545	1740061	5426201		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945013.1|1739545_1740061_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.8e-24
>prophage 121
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1758242	1759325	5426201		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|1758242_1759325_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 122
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1773329	1774595	5426201		Klosneuvirus(100.0%)	1	NA	NA
WP_000069228.1|1773329_1774595_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.6e-24
>prophage 123
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1787510	1793169	5426201		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|1787510_1788317_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000983281.1|1788384_1788738_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1789107_1789896_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001307157.1|1790039_1791167_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484982.1|1791234_1793169_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 124
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1800983	1801574	5426201		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1800983_1801574_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 125
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1806498	1881853	5426201	integrase,terminase,head,holin,tail,capsid,protease	Escherichia_phage(31.75%)	81	1823541:1823568	1882005:1882032
WP_001297122.1|1806498_1809096_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|1809475_1809727_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|1809762_1810812_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|1811031_1811790_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|1811786_1812377_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1812416_1813289_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|1813389_1814010_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1814006_1814888_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1815025_1815070_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194591.1|1815161_1816724_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1816723_1818319_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001297118.1|1818322_1819681_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|1819692_1820886_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|1820885_1821692_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1822072_1822252_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1822337_1822838_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1822883_1823390_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1823541:1823568	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_089610354.1|1823723_1823882_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	74.5	5.5e-12
WP_106894442.1|1824304_1828297_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	93.7	0.0e+00
WP_000864634.1|1828668_1829142_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	99.4	1.7e-88
WP_106894443.1|1829228_1830473_-	hypothetical protein	NA	Q9LA60	Enterobacterial_phage	53.7	1.4e-73
WP_033882658.1|1830878_1831550_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	99.1	1.1e-122
WP_033882659.1|1831591_1833319_-|tail	tail protein	tail	S5MDN9	Escherichia_phage	97.2	6.3e-226
WP_000078852.1|1833461_1833602_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_064236981.1|1833800_1837274_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	92.5	0.0e+00
WP_123009974.1|1837951_1838584_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.0	1.9e-100
WP_033882662.1|1838529_1839273_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	1.6e-149
WP_001371281.1|1839283_1839982_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	2.6e-130
WP_001379814.1|1840191_1841337_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.7	1.3e-139
WP_000343410.1|1841544_1841886_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.1	2.6e-51
WP_106894444.1|1841878_1845121_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.4	0.0e+00
WP_122993918.1|1845168_1845378_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	97.1	7.4e-33
WP_000710935.1|1845473_1845848_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	1.7e-64
WP_001275449.1|1845862_1846579_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	4.0e-126
WP_000133378.1|1846644_1846989_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	3.2e-57
WP_000573391.1|1846985_1847432_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007908.1|1847428_1847779_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000125999.1|1847788_1848115_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	2.7e-53
WP_001063099.1|1850803_1851025_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173022.1|1851069_1853007_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001380454.1|1853070_1854732_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
WP_033882668.1|1855580_1855946_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	2.3e-61
WP_000095744.1|1855987_1856188_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|1856319_1856646_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_042969687.1|1856754_1856982_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	78.4	1.4e-08
WP_001208682.1|1857217_1857424_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001092904.1|1858133_1858667_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.0	3.6e-100
WP_001041954.1|1859107_1859692_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	88.3	4.3e-54
WP_000284510.1|1859695_1859911_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290219.1|1859987_1860233_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	93.8	3.9e-17
WP_000143455.1|1860273_1860453_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.1e-24
WP_033882670.1|1860603_1862571_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	67.8	2.0e-252
WP_000231840.1|1863596_1864532_-	SAM-dependent DNA methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	42.5	3.0e-41
WP_033882671.1|1864907_1865966_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	93.2	3.9e-194
WP_000917743.1|1866116_1866314_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_134790173.1|1866333_1866531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525566.1|1866656_1867058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064919.1|1867251_1867941_-	antiterminator	NA	I6PDF8	Cronobacter_phage	47.2	3.5e-55
WP_001217429.1|1867933_1868296_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	7.3e-36
WP_001265191.1|1868308_1869358_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.5	8.2e-112
WP_000191873.1|1869359_1869632_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	54.7	5.0e-13
WP_000756598.1|1869754_1870099_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	97.4	1.8e-55
WP_000902691.1|1870220_1870433_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	72.9	6.9e-18
WP_000567227.1|1870666_1871020_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	62.5	5.1e-34
WP_097490626.1|1871016_1871385_-	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	62.1	1.4e-29
WP_033882673.1|1871386_1871731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001266017.1|1871717_1872023_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.9	1.7e-49
WP_074015058.1|1872019_1872301_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	71.4	2.8e-27
WP_033882676.1|1872333_1873050_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.7	1.1e-70
WP_074015057.1|1873083_1873626_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	9.5e-80
WP_033882677.1|1873537_1874548_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.5	3.7e-170
WP_000693933.1|1874634_1875072_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	54.4	1.0e-28
WP_000391952.1|1875055_1875337_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_033882679.1|1875438_1875858_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	66.3	1.8e-25
WP_000380309.1|1876123_1876276_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.1e-06
WP_077637644.1|1876431_1876689_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	1.4e-09
WP_000450223.1|1877482_1877671_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199470.1|1877667_1877856_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_033882681.1|1877951_1880423_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	5.3e-53
WP_000113186.1|1880487_1880736_+	excisionase	NA	NA	NA	NA	NA
WP_033882683.1|1880713_1881853_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.0	2.2e-102
1882005:1882032	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 126
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1889802	1891817	5426201		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|1889802_1890807_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|1890803_1891817_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 127
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1901230	1911419	5426201		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|1901230_1901848_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|1902452_1902866_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|1903009_1903918_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193437.1|1904119_1905133_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|1905224_1906130_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|1906242_1906701_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|1906750_1907593_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|1908496_1909174_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|1909173_1909884_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|1909880_1911419_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 128
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1922672	1922903	5426201		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|1922672_1922903_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 129
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1926004	1930012	5426201		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|1926004_1926859_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_106894445.1|1926894_1927704_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|1927707_1928100_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456571.1|1928096_1928930_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|1928929_1930012_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 130
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1933148	1935900	5426201		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|1933148_1934096_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033346.1|1934220_1935900_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.0e-23
>prophage 131
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1962661	1964349	5426201		Salmonella_phage(50.0%)	2	NA	NA
WP_000457616.1|1962661_1963930_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|1963929_1964349_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 132
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1972884	1975206	5426201		Escherichia_phage(100.0%)	1	NA	NA
WP_001307136.1|1972884_1975206_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
>prophage 133
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	1981073	2053295	5426201	integrase,terminase,head,holin,tRNA,tail,capsid	Escherichia_phage(31.15%)	82	2000193:2000209	2057545:2057561
WP_000332303.1|1981073_1981805_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|1982025_1982430_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|1982482_1982593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|1983125_1983449_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000444487.1|1983551_1984802_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248691.1|1984973_1985627_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476089.1|1985636_1986098_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|1986151_1987258_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1987293_1987935_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1987938_1989309_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|1989476_1990148_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_033557582.1|1990147_1991608_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|1991683_1992805_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359460.1|1992950_1994180_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|1994429_1995566_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799399.1|1995549_1996413_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_071780837.1|1996577_1996880_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_106894448.1|1997332_2001358_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	95.5	0.0e+00
2000193:2000209	attL	ACCGTATAATCACCATT	NA	NA	NA	NA
WP_001539080.1|2001631_2002102_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	100.0	5.9e-86
WP_106894449.1|2002190_2003360_-	hypothetical protein	NA	Q9LA60	Enterobacterial_phage	67.4	9.8e-98
WP_106894450.1|2004052_2004634_-	DUF4376 domain-containing protein	NA	Q9MCI9	Enterobacteria_phage	93.7	2.0e-99
WP_106894451.1|2004650_2006141_-|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	99.1	5.1e-59
WP_106894452.1|2006325_2009856_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	82.4	0.0e+00
WP_126502673.1|2010107_2010740_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	94.8	3.9e-101
WP_106894454.1|2010685_2011429_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	92.3	7.8e-141
WP_012601557.1|2011439_2012138_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000807940.1|2012137_2012479_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106894455.1|2012471_2015714_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.5	0.0e+00
WP_159032355.1|2015761_2015971_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	7.4e-33
WP_106894457.1|2016066_2016441_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	96.8	1.1e-63
WP_106894458.1|2016455_2017172_-|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	3.4e-125
WP_042103714.1|2017237_2017582_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	1.2e-56
WP_000573391.1|2017578_2018025_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2018021_2018372_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2018381_2018708_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_016238136.1|2021396_2021618_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	1.7e-35
WP_106894385.1|2021662_2023600_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_106894384.1|2023663_2025325_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.7	0.0e+00
WP_106894383.1|2025321_2025885_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	97.3	1.4e-86
WP_106894382.1|2026174_2026540_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	3.9e-61
WP_000095744.1|2026581_2026782_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_042106362.1|2026913_2027240_-	TonB family protein	NA	H6WZK5	Escherichia_phage	96.3	2.0e-53
WP_032211250.1|2027585_2027810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122990151.1|2027895_2028081_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.1e-18
WP_106894381.1|2028318_2029086_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	55.6	5.1e-79
WP_159032340.1|2029093_2029276_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	84.4	4.5e-10
WP_159032339.1|2029247_2029385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894380.1|2029577_2030111_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	90.4	3.7e-92
WP_106894379.1|2030617_2031376_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	91.5	3.8e-34
WP_000284510.1|2031380_2031596_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_106894378.1|2031673_2031976_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_032211246.1|2032013_2032196_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	81.7	1.3e-20
WP_106894377.1|2032343_2034326_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	58.0	3.7e-214
WP_032210943.1|2034848_2035277_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_106894376.1|2035757_2036816_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.8	1.2e-190
WP_000917768.1|2036966_2037164_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_106894375.1|2037391_2038213_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	1.1e-79
WP_106894374.1|2038209_2038584_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	1.5e-36
WP_106894373.1|2038596_2039646_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.5	2.2e-112
WP_106894372.1|2039647_2039920_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	9.4e-12
WP_073568588.1|2040070_2040349_+	Killer protein	NA	A0A2L1IV28	Escherichia_phage	56.5	6.2e-27
WP_106894371.1|2040348_2040633_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	5.2e-21
WP_106894370.1|2040752_2041562_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	46.6	1.4e-50
WP_032313438.1|2041558_2041768_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	95.7	4.7e-35
WP_106894369.1|2041768_2042215_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	67.5	1.6e-37
WP_106894368.1|2042351_2042657_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	81.0	1.8e-48
WP_106894367.1|2042649_2042877_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	1.8e-11
WP_106894618.1|2042873_2043155_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	1.7e-27
WP_106894459.1|2043187_2043904_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	5.0e-68
WP_106894460.1|2043933_2044674_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	86.4	1.9e-118
WP_106894619.1|2044680_2045643_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.5	4.2e-70
WP_073568595.1|2045665_2046091_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_106894461.1|2046074_2046398_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	43.5	1.4e-09
WP_106894462.1|2046522_2046999_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	44.1	1.3e-11
WP_000379557.1|2047310_2047466_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001171942.1|2047625_2047844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032210921.1|2047958_2048405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894463.1|2049103_2049292_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199478.1|2049288_2049477_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106894464.1|2049569_2052008_+	exonuclease	NA	V5UQJ3	Shigella_phage	45.2	9.1e-114
WP_000096346.1|2052066_2052270_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_032210917.1|2052269_2053295_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.0	3.4e-102
2057545:2057561	attR	AATGGTGATTATACGGT	NA	NA	NA	NA
>prophage 134
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2079730	2080897	5426201		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830169.1|2079730_2080897_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	1.9e-226
>prophage 135
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2088541	2089441	5426201		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2088541_2089441_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 136
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2096795	2100916	5426201		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_001493165.1|2096795_2097962_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	6.5e-110
WP_001493166.1|2098210_2099617_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	8.0e-38
WP_001493168.1|2100103_2100916_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	29.8	2.0e-09
>prophage 137
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2107899	2115414	5426201		Enterobacteria_phage(42.86%)	7	NA	NA
WP_024205925.1|2107899_2108433_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.9	4.4e-45
WP_001493175.1|2108437_2109316_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	6.6e-107
WP_001493176.1|2109373_2110273_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.3	1.1e-27
WP_001493177.1|2110272_2111358_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_001493178.1|2111730_2112624_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|2112866_2113862_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001493179.1|2114019_2115414_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.1e-18
>prophage 138
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2121224	2128018	5426201		Bacillus_phage(25.0%)	6	NA	NA
WP_001356294.1|2121224_2122595_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.7e-32
WP_000079263.1|2122787_2124224_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699761.1|2124226_2125450_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001307277.1|2125446_2125926_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043652.1|2125928_2126894_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.4e-86
WP_000048190.1|2126896_2128018_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 139
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2132261	2142652	5426201		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|2132261_2133101_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137111.1|2133193_2135356_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|2135358_2135802_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2135807_2136947_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001296218.1|2137605_2139189_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|2139462_2141316_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2141337_2141919_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2142010_2142652_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 140
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2147315	2148668	5426201		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469692.1|2147315_2148668_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 141
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2162109	2168990	5426201	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675148.1|2162109_2163513_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|2163509_2164232_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2164422_2164755_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2164963_2165260_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2165261_2165558_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2165660_2167022_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_097490435.1|2167352_2167676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2168090_2168990_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 142
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2178209	2181766	5426201		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|2178209_2179214_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|2179210_2180176_+	sugar kinase	NA	NA	NA	NA	NA
WP_033883602.1|2180149_2180896_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001307284.1|2180947_2181766_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
>prophage 143
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2192413	2194447	5426201	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|2192413_2194447_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 144
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2206958	2216400	5426201		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2206958_2208095_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001326004.1|2208091_2210092_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2210216_2210678_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2210718_2211189_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2211235_2211955_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2211951_2213637_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2213858_2214590_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2214649_2214757_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2214737_2215469_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|2215473_2216400_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 145
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2236442	2237963	5426201		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|2236442_2237963_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 146
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2241657	2242326	5426201		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|2241657_2242326_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 147
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2249512	2250370	5426201		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|2249512_2250370_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 148
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2264868	2269169	5426201		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848214.1|2264868_2266335_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
WP_000198822.1|2266452_2267439_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001296828.1|2267477_2268191_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|2268602_2269169_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 149
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2274923	2282572	5426201		Vibrio_phage(50.0%)	7	NA	NA
WP_000194938.1|2274923_2276513_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|2276516_2276861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213360.1|2277194_2278385_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|2278412_2279108_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578076.1|2279256_2281017_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|2281141_2281426_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|2281564_2282572_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 150
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2294271	2294889	5426201		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2294271_2294889_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 151
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2301155	2379980	5426201	integrase,terminase,portal,holin,tail,capsid,bacteriocin,protease,transposase	Escherichia_phage(39.66%)	68	2373635:2373651	2391947:2391963
WP_000849214.1|2301155_2301644_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758072.1|2301792_2303439_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422187.1|2303656_2305300_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884940.1|2305375_2306026_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710370.1|2306025_2307090_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406084.1|2307163_2308219_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865573.1|2308330_2309458_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.5	6.3e-118
WP_001249117.1|2310196_2312869_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_106894468.1|2313435_2317428_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	94.5	0.0e+00
WP_000864634.1|2317799_2318273_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	99.4	1.7e-88
WP_106894469.1|2319737_2328125_-	hypothetical protein	NA	A0A0P0ZCD0	Stx2-converting_phage	89.3	0.0e+00
WP_106894470.1|2328193_2329459_-	hypothetical protein	NA	A0A088CBK4	Shigella_phage	89.8	2.5e-208
WP_089611678.1|2329469_2329721_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	94.9	1.1e-11
WP_106894471.1|2329731_2330178_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	97.3	3.8e-74
WP_106894472.1|2330180_2330837_-	hypothetical protein	NA	G3CFP6	Escherichia_phage	98.2	5.0e-107
WP_106894620.1|2330930_2331284_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	100.0	2.0e-62
WP_106894473.1|2331417_2332644_-	hemagglutinin	NA	NA	NA	NA	NA
WP_000078907.1|2333001_2333142_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_106894475.1|2333372_2334107_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	91.4	1.7e-124
WP_106894476.1|2334197_2334812_-	hypothetical protein	NA	A0A088CBQ8	Shigella_phage	88.8	3.2e-108
WP_089611444.1|2334815_2335094_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	95.7	3.4e-49
WP_106894477.1|2335108_2336377_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	95.2	5.1e-209
WP_106894621.1|2336373_2337999_-	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	96.5	0.0e+00
WP_000513231.1|2338232_2338745_-	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_106894478.1|2338831_2341069_-|tail	phage tail protein	tail	A0A0H4IU95	Shigella_phage	99.7	6.7e-87
WP_001562654.1|2341065_2341716_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	99.5	1.7e-120
WP_000829201.1|2341715_2342279_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	99.5	9.2e-102
WP_033800770.1|2342262_2342724_-	hypothetical protein	NA	V5URI4	Shigella_phage	100.0	1.6e-75
WP_001140444.1|2342773_2343163_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_106894361.1|2343218_2344433_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	97.8	3.3e-229
WP_089611271.1|2344456_2345461_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	88.4	8.8e-156
WP_106894360.1|2345618_2347763_-|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	95.2	0.0e+00
WP_106894359.1|2347762_2349469_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	96.1	0.0e+00
WP_001086078.1|2349449_2350256_-	hypothetical protein	NA	A0A0P0ZG40	Escherichia_phage	96.3	6.9e-127
WP_123009704.1|2350613_2350799_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	82.0	2.9e-20
WP_033883643.1|2351623_2352157_-	lysozyme	NA	V5USG4	Shigella_phage	96.6	1.3e-100
WP_000284506.1|2352161_2352377_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290232.1|2352453_2352726_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	97.8	7.2e-20
WP_000576219.1|2352751_2352934_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	90.0	1.4e-22
WP_000874415.1|2353073_2354984_-	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	70.4	1.4e-263
WP_000722253.1|2355764_2356034_-	Shiga toxin Stx1c subunit B	NA	Q94LZ9	Enterobacteria_phage	100.0	2.7e-43
WP_000691355.1|2356044_2356992_-	Shiga toxin Stx1c subunit A	NA	Q94M00	Enterobacteria_phage	100.0	1.9e-171
WP_071587234.1|2357518_2358622_-	type II restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_001178557.1|2358672_2360634_-	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	36.7	6.3e-81
WP_159032344.1|2360714_2361155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813244.1|2361311_2361467_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.6e-16
WP_106894480.1|2361666_2362092_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	68.1	6.8e-49
WP_085949152.1|2362930_2364204_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000844634.1|2364369_2365338_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	81.4	1.0e-156
WP_000932104.1|2365339_2366998_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	77.7	4.9e-260
WP_001271873.1|2367031_2367400_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	68.9	1.2e-41
WP_000349381.1|2368275_2368935_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	49.1	4.7e-49
WP_106894481.1|2369020_2369398_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	56.6	6.1e-17
WP_000781554.1|2369399_2369591_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	96.8	1.5e-27
WP_000856688.1|2369587_2369788_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	80.3	2.4e-20
WP_000651133.1|2369962_2370325_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	70.0	1.5e-36
WP_000657001.1|2370732_2371293_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	46.2	3.3e-19
WP_106894482.1|2371279_2371864_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.6	2.1e-32
WP_000749823.1|2371887_2372754_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	72.6	4.8e-118
WP_032309120.1|2372746_2373109_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	78.9	5.6e-44
WP_000587146.1|2373125_2373350_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	67.1	9.5e-18
WP_106894483.1|2373346_2374249_+	hypothetical protein	NA	NA	NA	NA	NA
2373635:2373651	attL	CGCATTGCCGCCGCAGA	NA	NA	NA	NA
WP_000504369.1|2374241_2374484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001078339.1|2374504_2374651_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	72.9	1.5e-16
WP_000447742.1|2374658_2374913_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	84.5	4.6e-37
WP_000063634.1|2374946_2376236_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	73.2	1.9e-187
WP_001061917.1|2376280_2376931_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_000876014.1|2377130_2379980_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
2391947:2391963	attR	CGCATTGCCGCCGCAGA	NA	NA	NA	NA
>prophage 152
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2389680	2403735	5426201		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281242.1|2389680_2392308_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|2392454_2393177_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001495271.1|2393304_2397039_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	27.2	2.4e-20
WP_106894484.1|2397734_2400020_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.4	1.6e-282
WP_000332036.1|2400108_2401239_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|2401238_2401493_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301049.1|2401546_2402197_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779091.1|2402658_2403735_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 153
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2409628	2410531	5426201	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140589.1|2409628_2410531_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 154
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2413683	2418687	5426201		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|2413683_2414286_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001342601.1|2414593_2415733_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.9e-29
WP_000461661.1|2415736_2416705_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_000860263.1|2416704_2418687_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
>prophage 155
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2453103	2456331	5426201		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|2453103_2453703_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|2453761_2455594_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|2455680_2456331_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 156
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2466890	2468763	5426201		Sodalis_phage(50.0%)	2	NA	NA
WP_000156113.1|2466890_2467793_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|2467989_2468763_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 157
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2472974	2474492	5426201		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|2472974_2474492_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 158
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2480968	2482105	5426201		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699122.1|2480968_2482105_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 159
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2490669	2491755	5426201		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|2490669_2491755_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 160
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2509640	2510573	5426201		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|2509640_2510573_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 161
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2513613	2515047	5426201		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|2513613_2515047_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 162
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2527568	2529263	5426201		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001283499.1|2527568_2529263_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 163
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2532954	2533875	5426201		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|2532954_2533875_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 164
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2537693	2538428	5426201		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|2537693_2538428_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 165
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2563965	2579321	5426201		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443667.1|2563965_2565981_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	2.9e-150
WP_001297862.1|2566050_2567037_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|2567266_2568028_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|2568212_2569184_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|2569567_2569825_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|2569869_2571597_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|2571637_2572147_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|2572188_2573040_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|2573144_2573513_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|2573515_2574427_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|2574560_2575658_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|2575647_2576523_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|2576522_2577356_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290230.1|2577355_2578372_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517431.1|2578529_2579321_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 166
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2582799	2587737	5426201		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|2582799_2584104_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|2584161_2585061_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|2585156_2585732_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001300381.1|2585792_2586242_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2586228_2586654_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102886.1|2586867_2587737_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 167
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2606491	2607442	5426201		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2606491_2607442_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 168
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2622104	2634639	5426201	capsid,integrase	Enterobacteria_phage(33.33%)	16	2620800:2620825	2640046:2640071
2620800:2620825	attL	CGGATAAGGCGTTCACGCCACATCCG	NA	NA	NA	NA
WP_106894487.1|2622104_2622245_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	82.2	2.3e-14
WP_106894488.1|2622907_2624278_-|capsid	phage capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	33.2	2.1e-43
WP_106894489.1|2624270_2624984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159032345.1|2625164_2625344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159032346.1|2625406_2625667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894493.1|2626394_2627372_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	69.9	9.6e-131
WP_106894494.1|2627757_2629893_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.9	7.2e-155
WP_106894495.1|2629955_2630234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894496.1|2630312_2630555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894497.1|2630557_2630767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894498.1|2630780_2630966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894499.1|2630958_2631423_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_106894500.1|2631415_2631898_-	host cell division inhibitor Icd-like protein	NA	Q8W643	Enterobacteria_phage	45.8	2.9e-11
WP_106894623.1|2631973_2632147_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106894501.1|2632421_2633168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159032347.1|2633190_2634639_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	31.2	1.0e-43
2640046:2640071	attR	CGGATGTGGCGTGAACGCCTTATCCG	NA	NA	NA	NA
>prophage 169
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2639263	2639977	5426201		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2639263_2639977_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 170
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2658491	2718032	5426201	integrase,terminase,holin,tail,protease	Escherichia_phage(50.0%)	63	2673355:2673371	2713386:2713402
WP_000489667.1|2658491_2659955_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000166449.1|2659975_2660335_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000247065.1|2660472_2661219_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198328.1|2661268_2662558_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|2662643_2663270_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|2663594_2664632_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|2664631_2665270_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_097490399.1|2665440_2667507_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001121363.1|2667511_2669053_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_000772724.1|2669091_2671335_-	cyclic-guanylate-specific phosphodiesterase PdeF	NA	NA	NA	NA	NA
WP_001344399.1|2671704_2671878_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669403.1|2672191_2672707_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755173.1|2672722_2673262_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
2673355:2673371	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_097490401.1|2673467_2673956_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	67.1	9.9e-52
WP_097490402.1|2673952_2674582_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	93.3	1.7e-109
WP_033883716.1|2674571_2674880_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	85.1	7.6e-42
WP_097490403.1|2674866_2675271_-	hypothetical protein	NA	T1SA79	Salmonella_phage	93.0	1.6e-60
WP_033883719.1|2677645_2677903_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	95.3	2.0e-40
WP_096271704.1|2677924_2678653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097490405.1|2679050_2679761_+	BRO-like protein	NA	G9L6E2	Escherichia_phage	79.8	1.5e-101
WP_000671199.1|2680046_2680487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044860501.1|2680578_2681430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044860502.1|2681431_2684821_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.7	1.8e-184
WP_097490406.1|2684820_2687568_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.8	1.1e-118
WP_044860504.1|2687567_2688146_-	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	80.8	1.9e-57
WP_097490407.1|2688145_2688610_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.7	5.4e-84
WP_097490408.1|2688609_2691081_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_097490409.1|2691080_2691686_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	98.5	2.3e-111
WP_097490410.1|2691685_2692009_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	97.2	4.5e-53
WP_000012377.1|2692059_2692395_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_096888492.1|2692405_2692843_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	94.5	1.9e-70
WP_096888491.1|2692894_2693881_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.4	1.6e-186
WP_044860510.1|2693895_2694591_-	peptidase	NA	G9L6C4	Escherichia_phage	97.4	3.1e-91
WP_052662798.1|2694602_2694872_-	hypothetical protein	NA	A0A0S1S1I7	Klebsiella_phage	58.1	4.8e-16
WP_044860511.1|2694876_2695173_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	2.9e-46
WP_023908379.1|2695169_2696849_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.3	1.4e-302
WP_000335899.1|2696863_2697070_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_097490411.1|2697583_2697817_-	hypothetical protein	NA	G9L6C0	Escherichia_phage	100.0	4.6e-15
WP_097490412.1|2697868_2698216_+	hypothetical protein	NA	G9L6B9	Escherichia_phage	98.4	7.8e-27
WP_097490413.1|2698301_2699777_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.4	7.6e-297
WP_097490414.1|2699773_2700448_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.1	7.6e-119
WP_001124396.1|2700444_2700657_-	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_097490415.1|2700674_2701013_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	5.4e-57
WP_097490416.1|2701781_2702555_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	70.3	5.6e-49
WP_097490417.1|2702551_2703121_-	hypothetical protein	NA	G9L6B1	Escherichia_phage	60.4	1.3e-42
WP_001231263.1|2703182_2703530_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.3	3.1e-60
WP_097490418.1|2703647_2704433_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	98.9	3.9e-151
WP_000086414.1|2704429_2705245_-	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_097490419.1|2705260_2705461_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	3.5e-32
WP_021524931.1|2705611_2705842_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	98.7	2.9e-38
WP_000836290.1|2705996_2706581_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_097490430.1|2706928_2707927_+	hypothetical protein	NA	A0A1B0VN89	Pseudomonas_phage	49.2	2.9e-34
WP_097490420.1|2707934_2708234_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	2.9e-46
WP_097490421.1|2708230_2709052_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	97.8	1.7e-160
WP_097490422.1|2709048_2709930_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.3	9.8e-159
WP_000675390.1|2709979_2710228_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_077781712.1|2710385_2710637_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	96.4	5.8e-40
WP_097490423.1|2710629_2711280_+	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	98.1	8.1e-126
WP_097490424.1|2711276_2711936_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.0	2.8e-102
WP_097490425.1|2711938_2713195_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	2.2e-236
WP_000138282.1|2713387_2714965_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2713386:2713402	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|2715033_2716500_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937933.1|2716661_2718032_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 171
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2726861	2727293	5426201		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2726861_2727293_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 172
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2737178	2743635	5426201		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133582.1|2737178_2738462_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|2738639_2738840_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|2738851_2739187_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196597.1|2739188_2741039_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	7.2e-103
WP_000384411.1|2741055_2741571_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2741666_2741990_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2742006_2742393_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2742420_2743635_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 173
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2758771	2760283	5426201		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493473.1|2758771_2760283_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 174
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2766041	2777350	5426201		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|2766041_2767295_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883124.1|2767623_2768814_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2768858_2769197_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|2769257_2770592_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215888.1|2770581_2771295_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_106894504.1|2771459_2772887_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_097490428.1|2773462_2777350_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	7.7e-131
>prophage 175
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2781468	2781729	5426201		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|2781468_2781729_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 176
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2785187	2788930	5426201		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|2785187_2785868_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2786140_2787115_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|2787130_2788930_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 177
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2794701	2800960	5426201	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|2794701_2796036_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|2796244_2797126_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2797228_2797816_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2797871_2798255_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2798559_2799249_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2799296_2800334_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2800540_2800960_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 178
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2806253	2807552	5426201		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|2806253_2807552_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 179
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2813330	2815904	5426201		Enterobacteria_phage(100.0%)	1	NA	NA
WP_106894505.1|2813330_2815904_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 180
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2821810	2822881	5426201		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|2821810_2822881_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 181
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2836627	2844391	5426201	transposase,integrase	Escherichia_phage(66.67%)	6	2834415:2834428	2841528:2841541
2834415:2834428	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|2836627_2837110_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|2837852_2839082_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2839120_2839537_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214996.1|2839608_2841357_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000577254.1|2841358_2843077_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
2841528:2841541	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_085948468.1|2843228_2844391_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 182
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2849649	2853774	5426201		Klosneuvirus(50.0%)	4	NA	NA
WP_001087606.1|2849649_2850930_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001325764.1|2851240_2852641_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|2852661_2853324_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|2853324_2853774_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 183
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2857709	2862967	5426201		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|2857709_2857955_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080944.1|2857951_2858362_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_000246536.1|2858334_2860479_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	5.4e-195
WP_106894506.1|2860507_2861410_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	72.9	1.0e-126
WP_000985494.1|2861764_2862967_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 184
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2876015	2881575	5426201	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2876015_2876201_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|2876435_2879066_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|2879193_2879694_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2879936_2880998_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|2881077_2881575_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 185
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2887041	2888007	5426201		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|2887041_2888007_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 186
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2895482	2896496	5426201		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001355855.1|2895482_2896496_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	2.3e-26
>prophage 187
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2915564	2922704	5426201		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2915564_2918126_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|2918231_2918888_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|2918938_2919706_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2919901_2920810_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2920806_2922069_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2922065_2922704_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 188
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2927917	2931633	5426201		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|2927917_2928910_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272580.1|2928972_2930112_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2930251_2930878_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2930871_2931633_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 189
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2934745	2936778	5426201		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|2934745_2935351_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090383.1|2935350_2936778_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	3.7e-30
>prophage 190
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2960813	2961599	5426201		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|2960813_2961599_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 191
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2965950	2970870	5426201		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|2965950_2966622_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|2966760_2966901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268452.1|2966914_2967787_+	YgcG family protein	NA	NA	NA	NA	NA
WP_106894507.1|2967846_2969145_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.1	5.2e-132
WP_000210878.1|2969232_2970870_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 192
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2974902	2979017	5426201		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046790.1|2974902_2976204_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|2976260_2979017_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 193
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2986551	2987400	5426201		Vibrio_phage(100.0%)	1	NA	NA
WP_000100409.1|2986551_2987400_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	6.1e-41
>prophage 194
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	2992258	2993014	5426201		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|2992258_2993014_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 195
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3004540	3013665	5426201	tRNA	environmental_halophage(25.0%)	7	NA	NA
WP_001307370.1|3004540_3005746_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	2.3e-73
WP_000184253.1|3005745_3006189_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117734.1|3006239_3007046_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	3.8e-16
WP_000678646.1|3007284_3008382_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|3008960_3010214_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237948.1|3010445_3011777_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775946.1|3011838_3013665_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
>prophage 196
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3017198	3020087	5426201		Klosneuvirus(100.0%)	1	NA	NA
WP_001138163.1|3017198_3020087_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
>prophage 197
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3025564	3032337	5426201		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|3025564_3026359_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|3026365_3027241_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_106894509.1|3027391_3029638_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3029650_3030181_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|3030865_3031555_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3031623_3032337_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 198
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3041968	3044456	5426201		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|3041968_3043387_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|3043694_3044456_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 199
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3067220	3067976	5426201		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|3067220_3067976_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 200
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3092255	3107641	5426201	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|3092255_3093656_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|3093673_3094990_+	guanine deaminase	NA	NA	NA	NA	NA
WP_047090112.1|3095025_3096387_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.7	5.2e-159
WP_000838428.1|3096422_3096911_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001345944.1|3096910_3098830_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|3099265_3100714_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|3100715_3100841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3100837_3100909_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192803.1|3100963_3101512_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|3101554_3103072_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3103081_3104180_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813223.1|3104270_3106004_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
WP_000715208.1|3106009_3106720_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3106744_3107641_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 201
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3111565	3116938	5426201		Pandoravirus(50.0%)	3	NA	NA
WP_001307385.1|3111565_3112999_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
WP_000951964.1|3113055_3113799_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195024.1|3114064_3116938_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.9	8.2e-263
>prophage 202
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3125466	3126699	5426201		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3125466_3126699_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 203
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3144750	3145428	5426201		Bacillus_virus(100.0%)	1	NA	NA
WP_000956872.1|3144750_3145428_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	4.9e-09
>prophage 204
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3166429	3167584	5426201		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3166429_3167584_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 205
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3195992	3207602	5426201	transposase	Enterobacteria_phage(33.33%)	11	NA	NA
WP_106894514.1|3195992_3197483_-	AAA family ATPase	NA	A0A1Q1N957	Escherichia_phage	31.0	1.0e-46
WP_085949152.1|3197818_3199091_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000021267.1|3199566_3200196_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.2	3.3e-52
WP_001096212.1|3200377_3202165_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033883002.1|3202352_3203573_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.6	2.2e-63
WP_000936711.1|3203698_3204529_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_001237806.1|3204690_3204879_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000545469.1|3204897_3205470_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001165712.1|3205526_3206003_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	45.9	6.1e-30
WP_000935977.1|3206065_3206272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700770.1|3206399_3207602_-	hypothetical protein	NA	Q9MCI8	Enterobacteria_phage	62.5	1.0e-41
>prophage 206
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3213943	3216091	5426201		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000835435.1|3213943_3216091_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	7.7e-24
>prophage 207
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3224790	3226839	5426201		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000792540.1|3224790_3226839_-	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	8.5e-12
>prophage 208
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3230021	3233840	5426201	transposase	Enterobacteria_phage(100.0%)	5	NA	NA
WP_000416155.1|3230021_3231053_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.2	1.8e-18
WP_000916813.1|3231323_3231767_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705929.1|3231782_3232070_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345351.1|3232082_3233339_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000436078.1|3233555_3233840_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	60.7	1.9e-23
>prophage 209
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3259224	3261394	5426201		Yersinia_phage(33.33%)	4	NA	NA
WP_033884686.1|3259224_3260043_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.4e-45
WP_000214386.1|3260132_3260618_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	9.9e-12
WP_001186727.1|3260633_3261110_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692358.1|3261172_3261394_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 210
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3295898	3297071	5426201		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|3295898_3297071_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 211
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3320563	3321448	5426201		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3320563_3321448_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 212
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3327524	3338347	5426201		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|3327524_3328352_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|3328551_3329478_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|3329528_3329786_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|3329828_3332048_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|3332158_3333571_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|3333645_3334383_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3334615_3336874_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183494.1|3337419_3337902_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|3337954_3338347_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 213
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3342174	3353136	5426201		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|3342174_3344067_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3344095_3344677_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3344676_3345504_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3345528_3345951_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3345951_3346581_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|3346785_3348267_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_033883229.1|3348414_3349086_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	43.8	1.1e-32
WP_000442859.1|3349091_3350252_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188370.1|3350289_3351105_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3351220_3351994_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3352051_3352222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3352482_3353136_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 214
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3362650	3364084	5426201		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3362650_3364084_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 215
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3369221	3370460	5426201	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|3369221_3370460_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 216
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3376842	3393026	5426201	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|3376842_3377856_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|3378093_3378309_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3378419_3380165_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|3380359_3382201_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|3382278_3382785_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065895.1|3383038_3383803_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|3384079_3384703_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094682.1|3384856_3386377_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_159032348.1|3386683_3388174_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450589.1|3388215_3388548_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212470.1|3388766_3389750_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_106894518.1|3389933_3393026_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
>prophage 217
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3405447	3406413	5426201		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|3405447_3406413_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 218
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3430201	3432496	5426201		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3430201_3432496_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 219
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3440483	3441629	5426201		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|3440483_3441629_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 220
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3464638	3472430	5426201		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|3464638_3465499_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249149.1|3465561_3467598_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|3467555_3467951_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|3467970_3468561_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646043.1|3468570_3469146_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147579.1|3469259_3470300_-	permease	NA	NA	NA	NA	NA
WP_001351326.1|3470372_3471008_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|3471135_3471654_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449451.1|3471633_3472077_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189315.1|3472127_3472430_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 221
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3478257	3480147	5426201		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001297428.1|3478257_3480147_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 222
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3485628	3492267	5426201		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|3485628_3488301_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|3488325_3489813_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|3489840_3490293_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_033883207.1|3490923_3492267_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 223
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3495469	3498342	5426201	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|3495469_3496318_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|3496407_3498342_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 224
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3504970	3506448	5426201		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|3504970_3505942_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|3506169_3506448_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 225
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3510516	3525311	5426201		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|3510516_3511326_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|3511535_3512513_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|3512526_3513513_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|3513533_3514100_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|3514096_3514672_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|3514640_3515198_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3515204_3515930_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|3515977_3517411_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|3517433_3517721_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|3517838_3518330_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3518375_3519230_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3519226_3519499_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620387.1|3519712_3520345_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|3520341_3521070_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001307414.1|3521066_3521720_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|3521949_3524286_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001176896.1|3524381_3525311_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 226
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3532060	3536808	5426201		Salmonella_phage(50.0%)	5	NA	NA
WP_000445145.1|3532060_3533188_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	1.4e-72
WP_000979882.1|3533247_3533712_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209017.1|3533708_3534584_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|3534580_3535270_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|3535317_3536808_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 227
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3540512	3541010	5426201	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3540512_3541010_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 228
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3544976	3547501	5426201	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|3544976_3546344_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497724.1|3546433_3547501_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 229
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3563996	3565040	5426201		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3563996_3565040_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 230
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3575605	3576490	5426201		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258919.1|3575605_3576490_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	4.9e-25
>prophage 231
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3582994	3587148	5426201		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|3582994_3584020_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019674.1|3584087_3585269_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001307418.1|3585278_3586382_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078332.1|3586389_3587148_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
>prophage 232
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3597483	3598955	5426201	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|3597483_3597993_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004432.1|3598007_3598955_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 233
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3618832	3624406	5426201		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|3618832_3620017_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|3620087_3622202_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|3622298_3622769_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|3622865_3623240_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903387.1|3623365_3623653_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|3623660_3624020_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|3624019_3624406_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 234
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3629976	3639517	5426201		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|3629976_3631890_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057405.1|3631889_3632912_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|3632905_3633124_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|3633177_3634047_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|3634101_3634506_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|3634807_3635440_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|3635490_3637581_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963785.1|3637647_3638868_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|3638953_3639517_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 235
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3663745	3664582	5426201		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3663745_3664582_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 236
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3681557	3685324	5426201		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|3681557_3683180_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253696.1|3683255_3684608_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|3684604_3685324_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 237
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3691887	3692766	5426201		Sodalis_phage(100.0%)	1	NA	NA
WP_000039059.1|3691887_3692766_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	2.7e-68
>prophage 238
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3698735	3701129	5426201		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_033883189.1|3698735_3701129_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 239
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3705508	3706735	5426201		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105436.1|3705508_3706735_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.5	1.3e-132
>prophage 240
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3715964	3718412	5426201		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3715964_3718412_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 241
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3728742	3730839	5426201		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000410810.1|3728742_3730839_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	6.1e-42
>prophage 242
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3741849	3743660	5426201		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073590.1|3741849_3742593_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_000907801.1|3742589_3743660_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 243
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3747201	3748684	5426201		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|3747201_3747915_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|3747916_3748684_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 244
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3754417	3757236	5426201		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|3754417_3755272_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|3755516_3756575_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|3756567_3757236_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 245
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3760239	3764371	5426201		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|3760239_3760866_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106522.1|3760939_3763138_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	2.9e-119
WP_000130621.1|3763239_3763485_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|3763705_3764371_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 246
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3772264	3778161	5426201		Bacillus_virus(33.33%)	6	NA	NA
WP_000173666.1|3772264_3773071_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190062.1|3773076_3773478_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|3773597_3773957_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001259388.1|3773953_3774229_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	3.2e-15
WP_001314210.1|3774301_3775426_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000149125.1|3775425_3778161_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	9.2e-22
>prophage 247
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3791574	3793617	5426201		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|3791574_3793617_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 248
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3796962	3799097	5426201		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|3796962_3797316_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_001347664.1|3797369_3798659_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	2.1e-173
WP_000065786.1|3798671_3799097_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
>prophage 249
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3803988	3804636	5426201		Bacillus_virus(100.0%)	1	NA	NA
WP_001307446.1|3803988_3804636_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 250
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3851612	3853597	5426201		Bacillus_virus(50.0%)	2	NA	NA
WP_000107024.1|3851612_3852617_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|3852613_3853597_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 251
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3859340	3872487	5426201	integrase	Stx2-converting_phage(14.29%)	18	3858038:3858059	3872690:3872711
3858038:3858059	attL	ATTTGGTCGGTGATAGAGGATT	NA	NA	NA	NA
WP_106894523.1|3859340_3859733_-	antitermination protein	NA	A0A0P0ZCW9	Stx2-converting_phage	88.1	4.9e-62
WP_106894524.1|3861316_3861610_-	PerC family transcriptional regulator	NA	S4TT84	Salmonella_phage	44.8	4.1e-05
WP_106894525.1|3861578_3862046_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	42.4	8.1e-11
WP_106894526.1|3862063_3862504_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_106894527.1|3862522_3862897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042106880.1|3863319_3865458_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	42.8	1.2e-130
WP_106894528.1|3865454_3865754_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_106894330.1|3865811_3866015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894529.1|3866059_3866269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894530.1|3866272_3866458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894531.1|3866450_3866915_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_159032356.1|3866907_3867558_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_106888914.1|3867964_3868144_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	56.9	2.6e-10
WP_159032349.1|3868204_3868381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894624.1|3869199_3869952_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	50.0	4.0e-20
WP_106894533.1|3870141_3870348_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_106894534.1|3870922_3871153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894535.1|3871245_3872487_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.3	1.2e-98
3872690:3872711	attR	ATTTGGTCGGTGATAGAGGATT	NA	NA	NA	NA
>prophage 252
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3889817	3890030	5426201		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3889817_3890030_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 253
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3894254	3895250	5426201		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|3894254_3895250_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 254
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3900568	3902110	5426201		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|3900568_3902110_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 255
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3926297	3936988	5426201	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_000582483.1|3926297_3928142_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
WP_000206275.1|3928138_3929530_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|3929627_3930236_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000015232.1|3930464_3934700_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
WP_001271686.1|3934671_3935055_+	protein YhhH	NA	NA	NA	NA	NA
WP_001346013.1|3936154_3936988_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 256
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3959118	3969847	5426201		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|3959118_3959370_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|3959511_3959943_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001299251.1|3960187_3961732_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|3961741_3963025_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483860.1|3963028_3963988_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982082.1|3963974_3965009_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|3965247_3966273_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213830.1|3966282_3967479_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.7	3.8e-36
WP_001307464.1|3967753_3968626_-	protein YibB	NA	NA	NA	NA	NA
WP_000587763.1|3968914_3969847_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 257
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3981778	3986341	5426201		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|3981778_3982258_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|3982296_3983106_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|3983203_3983371_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3983391_3983628_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001298959.1|3983844_3984513_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050115.1|3984684_3985905_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	3.8e-44
WP_001298007.1|3985885_3986341_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 258
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	3989684	4054724	5426201	transposase,integrase,tRNA	Stx2-converting_phage(18.18%)	58	4018802:4018817	4058569:4058584
WP_106894625.1|3989684_3990947_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	77.4	1.0e-188
WP_106894626.1|3991012_3991594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126307.1|3991990_3992206_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_106894536.1|3992273_3993074_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	39.2	7.6e-25
WP_159032350.1|3993404_3993581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106888914.1|3993641_3993821_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	56.9	2.6e-10
WP_159032357.1|3994227_3994878_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_106894538.1|3994870_3995335_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_106894539.1|3995327_3995513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894529.1|3995516_3995726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032211283.1|3995770_3995962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894540.1|3996019_3996319_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_106894541.1|3996315_3998454_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	42.8	1.2e-130
WP_106894542.1|3998878_3999238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894543.1|3999256_3999697_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_106894544.1|3999714_4000182_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	41.2	6.2e-11
WP_106894545.1|4000150_4000444_+	PerC family transcriptional regulator	NA	S4TT84	Salmonella_phage	46.3	6.4e-06
WP_106894546.1|4000887_4001274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894547.1|4001361_4001664_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106894548.1|4001665_4001959_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_159032351.1|4002107_4002293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894549.1|4002873_4003308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894550.1|4004036_4004429_+	antitermination protein	NA	A0A0P0ZCW9	Stx2-converting_phage	86.5	2.7e-60
WP_000379435.1|4005686_4006061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001367933.1|4006578_4007403_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	4.1e-90
WP_000924289.1|4007694_4008312_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001370957.1|4008308_4009991_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	4.3e-22
WP_001295237.1|4010248_4010872_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4010926_4011202_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|4011220_4013329_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_001070177.1|4013335_4014025_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678429.1|4014030_4016112_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000747337.1|4016096_4016963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468836.1|4016965_4018171_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|4018450_4019842_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
4018802:4018817	attL	CTGAAAACCGGTGGTG	NA	NA	NA	NA
WP_001307467.1|4019962_4021672_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702903.1|4021724_4024043_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834439.1|4024052_4025435_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218908.1|4026121_4027306_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_094250091.1|4027639_4028847_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	3.9e-97
WP_097585878.1|4028924_4029197_-	flagellar biosynthesis protein FlgM	NA	NA	NA	NA	NA
WP_000264907.1|4029230_4029422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001370958.1|4029431_4029797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789656.1|4029807_4029999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949152.1|4034315_4035589_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_106894551.1|4035619_4035715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000634452.1|4036627_4037365_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033884780.1|4038196_4040284_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	3.4e-08
WP_000593013.1|4040629_4042474_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.3	8.1e-14
WP_000416161.1|4043842_4044874_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	3.0e-18
WP_000916806.1|4045144_4045588_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705929.1|4045603_4045891_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345351.1|4045903_4047160_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_097341304.1|4048377_4049533_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.0e-66
WP_077239192.1|4050907_4051129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171530.1|4052411_4052792_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.6e-65
WP_000612589.1|4052788_4053136_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_000998048.1|4053185_4054724_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
4058569:4058584	attR	CACCACCGGTTTTCAG	NA	NA	NA	NA
>prophage 259
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4074351	4074618	5426201		Burkholderia_phage(100.0%)	1	NA	NA
WP_000033410.1|4074351_4074618_-	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	39.0	6.9e-07
>prophage 260
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4081296	4083984	5426201		Cronobacter_phage(100.0%)	1	NA	NA
WP_097490585.1|4081296_4083984_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.5	2.2e-92
>prophage 261
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4107504	4109914	5426201		Yersinia_phage(33.33%)	5	NA	NA
WP_001241714.1|4107504_4108326_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.8	1.5e-44
WP_001367430.1|4108325_4108526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000855069.1|4108659_4109133_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	1.9e-12
WP_033884753.1|4109147_4109624_+	RadC family protein	NA	NA	NA	NA	NA
WP_064506879.1|4109692_4109914_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	2.5e-10
>prophage 262
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4118706	4120041	5426201		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|4118706_4120041_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 263
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4127346	4136508	5426201		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168480.1|4127346_4129035_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001315912.1|4129140_4129239_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|4129803_4129893_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|4130311_4131496_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148039.1|4131503_4132001_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4131997_4132360_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4132349_4132697_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|4132806_4133256_+	membrane protein	NA	NA	NA	NA	NA
WP_000828483.1|4133302_4134796_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_001087147.1|4134792_4136508_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 264
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4142860	4143814	5426201		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243428.1|4142860_4143289_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4143400_4143814_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 265
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4148241	4149390	5426201		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|4148241_4149390_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 266
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4154096	4161465	5426201		Bacillus_virus(33.33%)	8	NA	NA
WP_021576590.1|4154096_4156511_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4156539_4157613_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4157612_4158713_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4158717_4160121_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|4160417_4160498_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|4160727_4160868_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4160884_4161244_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4161207_4161465_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 267
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4171664	4173002	5426201		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|4171664_4173002_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 268
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4183374	4187215	5426201		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|4183374_4184148_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|4184238_4185129_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4185128_4186088_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4186174_4187215_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 269
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4192746	4196108	5426201		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|4192746_4194576_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|4194737_4196108_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 270
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4208060	4209053	5426201		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845103.1|4208060_4209053_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	1.7e-50
>prophage 271
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4212221	4218074	5426201		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|4212221_4214090_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|4214256_4214676_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387753.1|4214683_4216189_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000211858.1|4216193_4217159_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|4217183_4218074_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 272
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4231465	4233112	5426201		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012621.1|4231465_4233112_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	7.4e-67
>prophage 273
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4241585	4246997	5426201		Bacillus_phage(33.33%)	4	NA	NA
WP_001238890.1|4241585_4243607_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001299253.1|4243653_4245138_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|4245271_4246537_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|4246667_4246997_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 274
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4251039	4257183	5426201		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|4251039_4252170_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006621.1|4252166_4253429_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226604.1|4253428_4254496_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000676056.1|4254514_4255396_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|4255373_4256048_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|4256052_4257183_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 275
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4273528	4276347	5426201		Salmonella_phage(100.0%)	2	NA	NA
WP_000678267.1|4273528_4274842_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.2e-07
WP_001352855.1|4274838_4276347_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
>prophage 276
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4279353	4283212	5426201		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|4279353_4280250_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|4280249_4280966_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|4281049_4283212_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 277
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4290696	4292526	5426201		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|4290696_4292526_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 278
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4304939	4308226	5426201		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|4304939_4306580_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|4306658_4306928_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4306931_4307447_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4307449_4308226_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 279
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4317016	4317631	5426201		Streptococcus_phage(100.0%)	1	NA	NA
WP_001301303.1|4317016_4317631_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 280
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4331321	4334108	5426201		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|4331321_4334108_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 281
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4338186	4340657	5426201		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|4338186_4339596_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|4339607_4340657_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 282
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4347828	4352559	5426201		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|4347828_4348617_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_000160872.1|4348656_4349553_-	sugar kinase	NA	NA	NA	NA	NA
WP_001299483.1|4349725_4350604_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000094544.1|4350628_4351516_+	aldolase	NA	NA	NA	NA	NA
WP_000357967.1|4351548_4352559_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 283
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4365292	4368343	5426201		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|4365292_4368343_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 284
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4383106	4387966	5426201		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|4383106_4383727_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_059330889.1|4384024_4384969_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270270.1|4385117_4385792_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4385897_4387271_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4387267_4387966_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 285
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4399539	4404043	5426201		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|4399539_4400385_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4400810_4401056_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4401140_4401626_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001307494.1|4401718_4402645_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4402711_4404043_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 286
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4409680	4413865	5426201		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106894555.1|4409680_4413865_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	4.7e-25
>prophage 287
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4426733	4433980	5426201		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424838.1|4426733_4427396_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174095.1|4427407_4429909_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|4430217_4431297_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|4431311_4431632_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184883.1|4431682_4433980_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 288
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4446164	4447379	5426201		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|4446164_4447379_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 289
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4454129	4455974	5426201		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|4454129_4455974_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 290
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4464314	4467367	5426201		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|4464314_4465265_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|4466182_4467367_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 291
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4471483	4479812	5426201		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|4471483_4475512_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|4475588_4479812_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 292
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4489028	4490792	5426201		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|4489028_4489700_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940105.1|4489742_4490333_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|4490519_4490792_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 293
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4496166	4497756	5426201		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|4496166_4497756_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 294
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4513129	4516813	5426201		Dickeya_phage(100.0%)	1	NA	NA
WP_000096010.1|4513129_4516813_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 295
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4522463	4523255	5426201		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130534.1|4522463_4523255_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.5	1.4e-47
>prophage 296
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4539062	4540178	5426201		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4539062_4540178_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 297
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4549393	4550002	5426201		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4549393_4550002_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 298
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4556631	4559179	5426201		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|4556631_4558047_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|4558099_4559179_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 299
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4563386	4566999	5426201		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|4563386_4566209_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|4566462_4566999_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 300
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4570816	4572166	5426201		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|4570816_4572166_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 301
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4577751	4579710	5426201		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|4577751_4579710_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 302
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4588993	4591141	5426201		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|4588993_4591141_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 303
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4596386	4598372	5426201		Tetraselmis_virus(100.0%)	1	NA	NA
WP_097490444.1|4596386_4598372_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	3.5e-148
>prophage 304
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4602357	4603907	5426201		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611404.1|4602357_4603038_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001039799.1|4603148_4603907_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 305
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4609473	4610262	5426201		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|4609473_4610262_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 306
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4615101	4616604	5426201		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|4615101_4616604_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 307
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4637799	4641011	5426201	tRNA	Catovirus(50.0%)	2	NA	NA
WP_097490445.1|4637799_4639317_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
WP_000856841.1|4639553_4641011_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	8.9e-48
>prophage 308
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4649763	4706421	5426201	transposase	Escherichia_phage(22.22%)	62	NA	NA
WP_042104007.1|4649763_4651152_+	replicative DNA helicase	NA	O80281	Escherichia_phage	49.7	8.9e-114
WP_106894560.1|4651141_4652767_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_089610804.1|4652756_4653488_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_000069531.1|4653484_4654063_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_042104015.1|4654059_4654308_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	45.3	2.7e-05
WP_042104017.1|4654317_4654575_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	81.2	1.3e-31
WP_062867735.1|4654561_4655296_+	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	78.4	3.9e-100
WP_089610802.1|4655809_4656283_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	67.5	1.5e-36
WP_089610800.1|4656279_4656495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089610798.1|4656491_4656719_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	60.3	2.6e-15
WP_106894561.1|4656981_4658268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894562.1|4658264_4658876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106894563.1|4658961_4659681_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_106894564.1|4659706_4661719_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.6	9.4e-40
WP_001682053.1|4662452_4662917_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_106894565.1|4663010_4663214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042103774.1|4663226_4663784_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	60.9	5.4e-54
WP_106894566.1|4663830_4664754_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	38.3	6.7e-41
WP_106894567.1|4664827_4665196_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032308781.1|4665351_4665930_+	PilL protein	NA	NA	NA	NA	NA
WP_106894568.1|4665926_4666694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001681757.1|4666698_4667421_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_106894569.1|4667399_4668062_+	transglycosylase	NA	NA	NA	NA	NA
WP_106894570.1|4668082_4668589_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_106894571.1|4668588_4669188_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_062867500.1|4669201_4669990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042103612.1|4669982_4672100_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000796666.1|4672080_4672842_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_106894572.1|4673225_4673759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042102032.1|4673904_4674246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032308789.1|4674245_4674488_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_074434592.1|4674518_4674896_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_062867587.1|4674914_4675280_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_000086084.1|4675276_4675924_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_042102283.1|4675920_4676829_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_062867586.1|4676818_4678297_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_042106379.1|4678314_4678728_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_106894573.1|4678727_4681544_+	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_042102113.1|4681540_4681927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894574.1|4682317_4684408_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	1.2e-08
WP_106894575.1|4684634_4685033_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_062867583.1|4685029_4686004_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_089611254.1|4686015_4687437_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001044690.1|4687429_4687795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089611252.1|4687798_4689301_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_089611250.1|4689372_4689621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062867579.1|4689758_4689986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062867578.1|4690237_4691410_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_042101989.1|4691426_4692581_-	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	37.0	5.6e-29
WP_159032352.1|4692582_4692723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125909.1|4692769_4693093_-	CcdB family protein	NA	NA	NA	NA	NA
WP_077775912.1|4693092_4693341_-	post-segregation antitoxin CcdA	NA	NA	NA	NA	NA
WP_085949152.1|4693555_4694828_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_106894576.1|4695580_4696603_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.5	4.3e-198
WP_001562682.1|4696832_4697507_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	33.8	2.4e-11
WP_001562683.1|4697506_4697854_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	3.1e-44
WP_064562878.1|4697873_4699430_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.7	6.8e-163
WP_106894578.1|4700243_4701275_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_062867577.1|4701654_4703544_+	SAM-dependent DNA methyltransferase	NA	P95687	Staphylococcus_phage	30.1	4.8e-62
WP_122990834.1|4704070_4704517_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_062867575.1|4704564_4705296_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_062867574.1|4706280_4706421_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	64.4	2.0e-10
>prophage 309
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4710105	4722559	5426201		Salmonella_phage(16.67%)	14	NA	NA
WP_106894580.1|4710105_4710837_-	hypothetical protein	NA	S4TQ39	Salmonella_phage	41.5	6.5e-23
WP_001672448.1|4711380_4711782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042106686.1|4711947_4712328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894581.1|4712428_4712908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894582.1|4713060_4713444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894629.1|4713536_4714520_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	38.7	8.4e-50
WP_089611146.1|4714635_4714995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062867571.1|4715077_4715416_+	hypothetical protein	NA	A0A1W6JKX4	Lactococcus_phage	40.0	2.3e-07
WP_042103339.1|4715492_4715927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852732.1|4716034_4717012_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_106894583.1|4717093_4720009_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	86.8	0.0e+00
WP_106894584.1|4720011_4721973_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	56.6	1.6e-193
WP_106894585.1|4722015_4722222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116834860.1|4722295_4722559_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	95.9	6.3e-21
>prophage 310
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4729457	4734591	5426201	tail,integrase	Ralstonia_phage(66.67%)	6	4722006:4722019	4731828:4731841
4722006:4722019	attL	CGCGGAGTTTTTAT	NA	NA	NA	NA
WP_106894590.1|4729457_4730627_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	38.4	5.1e-38
WP_106894591.1|4731378_4731618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089577059.1|4731622_4732000_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	43.4	6.7e-24
4731828:4731841	attR	ATAAAAACTCCGCG	NA	NA	NA	NA
WP_106894592.1|4732281_4733445_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_106894593.1|4733441_4734092_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_042103932.1|4734108_4734591_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	35.0	7.3e-07
>prophage 311
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4746001	4747510	5426201		Vibrio_phage(100.0%)	1	NA	NA
WP_106894596.1|4746001_4747510_+	ATP-dependent helicase	NA	A0A2I7R5Z1	Vibrio_phage	29.7	4.9e-41
>prophage 312
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4758476	4760460	5426201		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|4758476_4758770_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4758813_4760460_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 313
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4764971	4765505	5426201		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|4764971_4765505_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 314
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4770425	4771403	5426201		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|4770425_4771403_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 315
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4778831	4830925	5426201	transposase,tRNA,protease	Diachasmimorpha_longicaudata_entomopoxvirus(11.11%)	57	NA	NA
WP_001295188.1|4778831_4779377_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|4780119_4780173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|4780155_4781295_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_106894598.1|4781293_4782841_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|4782812_4783274_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990312.1|4783292_4784630_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122487.1|4784639_4786487_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|4786479_4787430_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4787515_4787824_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|4787899_4789180_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|4789265_4790525_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4790527_4791532_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4791613_4791811_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4791914_4793213_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|4793417_4793843_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|4793881_4796323_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|4796502_4797234_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|4797360_4797762_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4797780_4798479_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|4798529_4799189_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|4799206_4799605_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101644.1|4799614_4800253_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943976.1|4800255_4801419_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_001339483.1|4801502_4803128_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4803244_4803520_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|4803668_4803998_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|4804179_4804929_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4804925_4805681_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|4805788_4806853_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_033882999.1|4807207_4808605_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|4808620_4808926_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|4808935_4809400_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|4809413_4810064_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|4810073_4810928_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|4810927_4811614_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000996728.1|4811710_4812262_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|4812336_4812612_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4812938_4813334_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4813340_4813655_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4813659_4813887_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4813928_4814378_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|4814448_4815243_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|4815865_4816297_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001367946.1|4816304_4817513_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|4817647_4818286_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|4818504_4819125_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|4819433_4820846_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_106894599.1|4820890_4821553_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001351395.1|4821660_4822626_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560552.1|4822734_4823595_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|4823683_4824064_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|4824192_4826136_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|4826325_4827066_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|4827055_4827613_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4827937_4828144_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|4828205_4829549_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000399648.1|4829944_4830925_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 316
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4838227	4844715	5426201		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|4838227_4838758_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265912.1|4839067_4840024_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205794.1|4840163_4841666_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001367906.1|4841679_4842702_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596016.1|4842688_4843684_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4843716_4844715_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 317
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4849031	4851792	5426201		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106228.1|4849031_4849496_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	56.4	2.5e-52
WP_000187778.1|4849653_4851792_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 318
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4855430	4862806	5426201	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_001181324.1|4855430_4856378_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4856562_4856616_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|4856756_4859453_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000399648.1|4859680_4860661_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|4860937_4861324_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4861396_4861858_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4861870_4862806_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 319
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4871107	4876051	5426201	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_000416396.1|4871107_4873963_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_001188289.1|4873962_4874445_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4874539_4876051_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
>prophage 320
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4880249	4881269	5426201		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001300770.1|4880249_4881269_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
>prophage 321
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4886240	4895302	5426201	transposase	Staphylococcus_phage(25.0%)	7	NA	NA
WP_000202818.1|4886240_4887797_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.2e-105
WP_085948467.1|4888338_4889500_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
WP_000249525.1|4889813_4891868_+	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	31.0	1.4e-27
WP_000842792.1|4891864_4893175_+	McrC family protein	NA	NA	NA	NA	NA
WP_000168579.1|4893237_4894110_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001367923.1|4894191_4894314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001584146.1|4894321_4895302_-|transposase	transposase	transposase	H6WZJ9	Escherichia_phage	56.0	2.1e-101
>prophage 322
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4898662	4900339	5426201		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|4898662_4899265_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|4899742_4900339_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 323
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4910605	4912066	5426201		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|4910605_4912066_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 324
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4918633	4919188	5426201		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|4918633_4919188_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 325
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4926689	4927634	5426201	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181166.1|4926689_4927634_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.1	2.7e-61
>prophage 326
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4947701	4953066	5426201		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919571.1|4947701_4949366_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_106894601.1|4949414_4950776_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|4950990_4951905_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106033.1|4952043_4953066_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 327
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4956292	4957572	5426201		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|4956292_4957030_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|4957032_4957572_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 328
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	4965794	5063443	5426201	integrase,terminase,holin,portal,tRNA,tail,protease,transposase	Enterobacteria_phage(42.19%)	105	4964996:4965010	4995678:4995692
4964996:4965010	attL	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_001218288.1|4965794_4967018_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.3	4.0e-235
WP_000040219.1|4967303_4968023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949152.1|4968122_4969396_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_042969445.1|4969835_4970456_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	90.8	1.8e-111
WP_001242715.1|4970455_4970818_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
WP_000008185.1|4970808_4971345_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	1.4e-99
WP_062876867.1|4971472_4972297_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	3.3e-148
WP_000135680.1|4972362_4972725_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_077818781.1|4973393_4973915_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.4	1.4e-101
WP_000649477.1|4974157_4974358_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|4974401_4974953_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_021568981.1|4974949_4975786_+	hypothetical protein	NA	A0A291AWU3	Escherichia_phage	99.3	3.8e-152
WP_001446924.1|4975790_4976015_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.6	7.0e-37
WP_021568982.1|4976011_4976830_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.4	4.3e-124
WP_072194238.1|4976826_4977321_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.9	1.8e-85
WP_001377816.1|4977320_4977974_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_000210170.1|4977970_4978297_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_044068991.1|4978293_4978683_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	4.6e-68
WP_044721931.1|4978702_4979512_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	3.1e-151
WP_015674832.1|4979519_4980509_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	3.3e-195
WP_021568985.1|4980522_4981275_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.2	2.1e-133
WP_122985741.1|4981546_4981636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|4981690_4981903_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|4982203_4982419_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|4983171_4983387_+|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189904.1|4983391_4983943_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.6	4.2e-35
WP_001306174.1|4983890_4984151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|4984264_4984798_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071778.1|4984794_4985292_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|4985655_4985868_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|4985878_4986067_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|4986214_4986370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|4986542_4986716_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|4987011_4987218_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000349509.1|4987770_4988262_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934113.1|4988261_4990364_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_001072975.1|4990360_4990573_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_097490481.1|4990572_4992081_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	4.5e-289
WP_001136588.1|4992025_4994053_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097042.1|4994139_4994463_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	3.2e-51
WP_001283153.1|4994455_4994731_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677102.1|4994742_4995321_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001079400.1|4995317_4995719_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	1.1e-72
4995678:4995692	attR	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_021568986.1|4995729_4996473_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.4	1.5e-131
WP_021568987.1|4996533_4996920_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.9	5.7e-63
WP_001161009.1|4996928_4997258_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_097490482.1|4997229_5000295_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.3	0.0e+00
WP_000447248.1|5000294_5000624_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_047090220.1|5000633_5001332_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.0e-134
WP_042969284.1|5001337_5002081_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.5e-149
WP_000741589.1|5001978_5002626_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_047090221.1|5002686_5006184_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.0	0.0e+00
WP_062876866.1|5006254_5006854_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	6.3e-109
WP_074405227.1|5006918_5009834_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	98.3	2.9e-58
WP_000885614.1|5009833_5010409_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.5e-102
WP_000086522.1|5010506_5011097_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|5011413_5011647_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_001372053.1|5011715_5011829_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|5012255_5012504_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202564.1|5012723_5014310_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|5014702_5015308_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5015434_5015596_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_000531527.1|5015717_5016791_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563068.1|5016787_5017570_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088405.1|5017682_5018546_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_029488714.1|5018517_5020068_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|5020325_5021105_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477811.1|5021231_5022554_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_000816471.1|5022605_5023829_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|5023908_5024628_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000105865.1|5025083_5026100_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|5026127_5026772_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|5026877_5027846_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|5027894_5029277_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|5029297_5030530_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|5030836_5032504_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409466.1|5032714_5034652_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|5034741_5035068_+	trp operon repressor	NA	NA	NA	NA	NA
WP_000399648.1|5035181_5036162_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000738723.1|5036421_5036718_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781063.1|5036931_5038218_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241660.1|5038218_5039151_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001264697.1|5039152_5041615_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|5041695_5041761_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223177.1|5041974_5042661_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|5043060_5043201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|5043296_5044013_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920306.1|5044072_5045425_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|5045482_5046907_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188659.1|5046906_5047596_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|5047608_5048082_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|5048292_5049162_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|5049158_5049806_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001297279.1|5049857_5050379_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000399648.1|5050648_5051629_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000906214.1|5051820_5052597_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_001112585.1|5052666_5054097_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_033882910.1|5054375_5055329_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.4	1.7e-10
WP_097490589.1|5055443_5056031_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_001102383.1|5056779_5057493_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|5057518_5057923_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|5058299_5060216_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|5060304_5061435_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|5061538_5061748_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_033882907.1|5062276_5063443_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.3e-89
>prophage 329
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5070484	5073301	5426201	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|5070484_5073301_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 330
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5077707	5078856	5426201		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|5077707_5078856_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 331
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5084326	5089987	5426201		Hepacivirus(50.0%)	4	NA	NA
WP_001297614.1|5084326_5085880_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
WP_000349938.1|5085953_5087171_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|5087299_5088442_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787111.1|5088472_5089987_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 332
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5097881	5099281	5426201		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|5097881_5098361_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257186.1|5098438_5099281_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 333
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5107025	5112448	5426201		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|5107025_5109932_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035654.1|5110096_5112448_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 334
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5118768	5119467	5426201		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|5118768_5119467_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 335
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5132169	5133894	5426201		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425658.1|5132169_5133894_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 336
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5159867	5160911	5426201		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|5159867_5160911_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 337
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5165156	5165708	5426201		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|5165156_5165708_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 338
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5174335	5175760	5426201		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|5174335_5175760_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 339
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5183409	5189877	5426201		Mamastrovirus(33.33%)	5	NA	NA
WP_001189608.1|5183409_5184960_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001307572.1|5185006_5187397_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|5187602_5188139_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|5188179_5188842_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|5188950_5189877_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 340
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5193139	5194042	5426201		Sodalis_phage(100.0%)	1	NA	NA
WP_000339946.1|5193139_5194042_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 341
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5203948	5210754	5426201	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|5203948_5205367_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937432.1|5205405_5206332_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|5206368_5206824_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|5207001_5207706_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|5207720_5208251_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000096806.1|5208324_5210754_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	1.1e-39
>prophage 342
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5215998	5216796	5426201		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|5215998_5216796_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 343
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5222707	5223052	5426201		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|5222707_5223052_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 344
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5226981	5228406	5426201	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|5226981_5228406_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 345
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5240290	5304858	5426201	transposase,plate,tRNA,protease	Flavobacterium_phage(12.5%)	52	NA	NA
WP_001295562.1|5240290_5241049_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|5241061_5241919_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295561.1|5241930_5243283_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_097490467.1|5243312_5245745_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|5245866_5246352_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|5246355_5247381_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|5247485_5247941_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|5247944_5248733_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139659.1|5248732_5249881_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|5249877_5250474_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|5250510_5253993_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|5254005_5254965_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|5255063_5257205_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|5257261_5257651_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176573.1|5257715_5259014_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|5259062_5259323_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|5259309_5259510_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185293.1|5259675_5260221_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|5260217_5260640_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|5260653_5261364_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_106894604.1|5261613_5262594_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001346133.1|5262796_5263621_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260716.1|5263673_5265392_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|5265502_5266210_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|5266206_5266611_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|5266728_5267544_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|5267583_5268237_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|5268229_5269261_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|5269448_5270024_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997048.1|5275782_5276586_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_106894605.1|5277221_5278253_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001230983.1|5278891_5279692_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|5279769_5280540_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644683.1|5280587_5281946_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|5282017_5282773_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|5282806_5283529_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|5283525_5283993_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|5284057_5284789_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086143.1|5285324_5286110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|5286246_5286726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|5286735_5287650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|5287693_5288176_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087588.1|5288199_5289552_-	membrane protein	NA	NA	NA	NA	NA
WP_122994549.1|5289562_5292997_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240530.1|5293105_5294518_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|5294522_5295266_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000343298.1|5298035_5298797_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246437.1|5298801_5300133_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|5300135_5300660_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113721.1|5300656_5301937_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|5301961_5303044_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|5303007_5304858_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 346
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5308991	5315441	5426201		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103361.1|5308991_5311133_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_106894606.1|5311208_5315441_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.0	6.8e-24
>prophage 347
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5328977	5332896	5426201		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|5328977_5329556_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|5329761_5330529_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|5330499_5331240_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615982.1|5331395_5331674_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|5331676_5331937_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543899.1|5332122_5332896_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 348
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5337947	5339114	5426201		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001316884.1|5337947_5339114_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.1e-31
>prophage 349
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5343791	5351373	5426201		Streptococcus_phage(50.0%)	6	NA	NA
WP_000749863.1|5343791_5344847_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|5345134_5346238_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|5346249_5347503_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001111349.1|5347819_5348230_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121335.1|5348208_5349165_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|5349174_5351373_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 350
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5371565	5372891	5426201		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046295.1|5371565_5372891_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 351
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5378467	5388943	5426201	holin	Catovirus(33.33%)	5	NA	NA
WP_001159105.1|5378467_5380138_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089077.1|5380151_5381624_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295527.1|5381637_5382225_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|5382353_5384387_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001341217.1|5384959_5388943_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	2.5e-124
>prophage 352
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5400936	5407377	5426201	transposase	Bacillus_virus(33.33%)	5	NA	NA
WP_000447344.1|5400936_5402421_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.8	8.0e-12
WP_000818900.1|5402413_5403385_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750340.1|5403381_5404338_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692742.1|5404424_5405474_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
WP_085949152.1|5406103_5407377_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
>prophage 353
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5415189	5417076	5426201		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010296.1|5415189_5417076_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.8e-53
>prophage 354
NZ_CP027323	Escherichia coli strain 2013C-3033 chromosome, complete genome	5426201	5421264	5422164	5426201		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952485.1|5421264_5422164_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 1
NZ_CP027324	Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence	127667	0	42127	127667	lysis,transposase,integrase	Sodalis_phage(17.65%)	49	7223:7237	22255:22269
WP_024221658.1|1163_1805_+	recombinase family protein	NA	NA	NA	NA	NA
WP_089611745.1|2650_3016_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_106894632.1|3477_3609_-|lysis	colicin 10 lysis protein	lysis	NA	NA	NA	NA
WP_089611770.1|3633_3924_+	Cki family colicin immunity protein	NA	NA	NA	NA	NA
WP_089611719.1|4190_4490_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089611717.1|4489_4837_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_106894634.1|5249_6116_-	DMT family transporter	NA	NA	NA	NA	NA
WP_106894635.1|6337_7546_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
7223:7237	attL	GGTGAAGACCAGGTG	NA	NA	NA	NA
WP_000019163.1|7526_7799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949152.1|8059_9333_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_089611583.1|9598_10093_+	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	84.8	1.8e-77
WP_062893098.1|10622_11210_+	colanic acid biosynthesis acetyltransferase	NA	NA	NA	NA	NA
WP_106894637.1|12680_13271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019842588.1|13267_13528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465043.1|14096_14510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164198.1|14511_15291_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_001144036.1|15470_16115_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030199.1|16201_16510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688514.1|16923_17904_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_001278818.1|17896_18313_+	recombinase	NA	NA	NA	NA	NA
WP_106894639.1|18314_19589_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.7	4.4e-144
WP_000109071.1|19588_20026_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|20022_20271_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_159032362.1|20688_21591_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032219114.1|21975_22659_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	6.7e-30
22255:22269	attR	CACCTGGTCTTCACC	NA	NA	NA	NA
WP_001104885.1|22659_22881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040072501.1|22894_23329_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_106894641.1|23373_24144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001436678.1|24681_24984_+	antirestriction protein	NA	NA	NA	NA	NA
WP_106894642.1|25030_25453_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027494.1|25449_25641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894644.1|25918_27586_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	5.6e-163
WP_001276120.1|28752_29280_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_089611819.1|29337_29571_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_106894645.1|29629_31588_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.5	1.2e-23
WP_097501877.1|31642_32077_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276264.1|32073_32793_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_106894646.1|32789_33386_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	53.9	3.4e-14
WP_014065718.1|33851_34352_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_159032358.1|34645_34846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089611668.1|35083_35518_+	post-segregation killing protein PndC	NA	NA	NA	NA	NA
WP_000804663.1|35610_35877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894647.1|35941_36856_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	1.2e-66
WP_001532090.1|36916_37123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062877219.1|38452_38773_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	44.1	5.9e-13
WP_106894650.1|38854_39769_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.5	4.7e-55
WP_062877217.1|40864_41344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062877216.1|41423_41819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062877215.1|41872_42127_-	hypothetical protein	NA	A0A248SLB9	Klebsiella_phage	47.5	2.7e-05
>prophage 2
NZ_CP027324	Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence	127667	55323	57201	127667	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_085948812.1|55323_56531_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.0e-97
WP_106894660.1|56715_57201_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	32.1	3.9e-16
>prophage 3
NZ_CP027324	Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence	127667	78355	82387	127667		Pseudomonas_phage(100.0%)	1	NA	NA
WP_106894675.1|78355_82387_-	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	29.8	4.5e-17
>prophage 4
NZ_CP027324	Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence	127667	88735	92751	127667	integrase,tail	Pseudomonas_phage(33.33%)	5	80002:80017	99472:99487
80002:80017	attL	CCGGTGGTGATGGTGG	NA	NA	NA	NA
WP_106894681.1|88735_89905_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	42.2	3.7e-44
WP_106894682.1|89959_90358_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	43.4	9.3e-24
WP_106894683.1|90363_91605_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_106894684.1|91601_92252_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_033806797.1|92268_92751_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	35.0	3.3e-07
99472:99487	attR	CCGGTGGTGATGGTGG	NA	NA	NA	NA
>prophage 5
NZ_CP027324	Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence	127667	112985	121491	127667	transposase	uncultured_Caudovirales_phage(25.0%)	9	NA	NA
WP_106894699.1|112985_113276_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	54.2	2.8e-22
WP_106894700.1|113379_113973_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_106894701.1|114072_114690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106894702.1|114714_115008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089611701.1|115191_116347_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	6.1e-68
WP_106894703.1|116683_117550_+	radical SAM protein	NA	NA	NA	NA	NA
WP_106894704.1|117546_118275_+	deoxynucleoside kinase	NA	NA	NA	NA	NA
WP_106894705.1|118256_118694_+	nucleoside triphosphatase NudI	NA	A0A248SJN0	Salicola_phage	25.5	8.1e-05
WP_044804912.1|119766_121491_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.6	1.6e-19
