The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	0	13078	5364442		Bacillus_phage(100.0%)	12	NA	NA
WP_000750398.1|987_1215_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_000044401.1|1565_2483_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_000203905.1|2501_2897_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_001045518.1|2889_3990_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_000642344.1|4033_4765_-	L-fucose operon activator	NA	NA	NA	NA	NA
WP_000920840.1|4822_5245_-	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_000808376.1|5246_6665_-	L-fuculokinase	NA	NA	NA	NA	NA
WP_000724153.1|6773_8549_-	L-fucose isomerase	NA	NA	NA	NA	NA
WP_000528603.1|8581_9898_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000440782.1|10444_11092_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000013588.1|11119_12268_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001344755.1|12322_13078_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 2
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	17936	18785	5364442		Vibrio_phage(100.0%)	1	NA	NA
WP_000100393.1|17936_18785_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 3
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	26319	29076	5364442		Hokovirus(100.0%)	1	NA	NA
WP_000186445.1|26319_29076_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 4
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	34465	39385	5364442		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|34465_36103_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|36190_37489_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268451.1|37548_38421_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288224.1|38434_38575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199970.1|38713_39385_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 5
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	43857	44643	5364442		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021329.1|43857_44643_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	5.0e-21
>prophage 6
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	68373	70406	5364442		Hokovirus(50.0%)	2	NA	NA
WP_001090398.1|68373_69801_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|69800_70406_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 7
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	73518	77234	5364442		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|73518_74280_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|74273_74900_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272595.1|75039_76179_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|76241_77234_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 8
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	82442	89582	5364442		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|82442_83081_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590389.1|83077_84340_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847985.1|84336_85245_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|85440_86208_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141347.1|86258_86915_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001272924.1|87020_89582_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 9
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	109049	110063	5364442		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001341827.1|109049_110063_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	3.9e-26
>prophage 10
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	117636	118602	5364442		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|117636_118602_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 11
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	124068	129628	5364442	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|124068_124566_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|124645_125707_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140519.1|125949_126450_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|126577_129208_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|129442_129628_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 12
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	142444	147740	5364442		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|142444_143647_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777939.1|144001_144961_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000246506.1|144970_147115_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	9.3e-195
WP_000080947.1|147087_147498_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223219.1|147494_147740_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	4.1e-06
>prophage 13
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	151675	155800	5364442		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|151675_152125_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156820.1|152125_152788_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001344737.1|152808_154209_-	GABA permease	NA	NA	NA	NA	NA
WP_001087606.1|154519_155800_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 14
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	161110	249027	5364442	protease,portal,transposase,tRNA,tail,terminase	Enterobacteria_phage(72.41%)	90	NA	NA
WP_001426837.1|161110_162829_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
WP_000214990.1|162830_164579_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|164651_165068_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_085948178.1|166132_167345_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001289947.1|167697_168297_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
WP_001214463.1|168293_168461_-	DUF2737 family protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
WP_001111331.1|168471_168765_-	DUF2856 family protein	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
WP_000532424.1|168778_169291_-	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
WP_000335772.1|169291_169915_-	hypothetical protein	NA	Q8VNQ0	Enterobacteria_phage	99.5	6.8e-122
WP_001177653.1|170790_171069_+	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000166207.1|171103_171250_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000065668.1|171242_172142_+	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_000131492.1|172131_173568_+	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_001036037.1|173567_173837_+	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_001000130.1|173906_174185_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|174317_174533_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|174543_174780_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|174736_175183_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|175179_175707_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|175703_175886_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211413.1|176160_176865_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001108006.1|177662_178268_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000144764.1|178264_178459_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_000691354.1|179391_180339_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|180348_180618_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_012816791.1|181621_181807_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|182281_182758_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|182754_184878_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|184874_185087_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974564.1|185086_186589_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_106895285.1|186592_188557_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|188644_188971_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|188963_189245_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|189247_189871_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682711.1|189883_190030_+	hypothetical protein	NA	Q687G0	Enterobacteria_phage	100.0	3.5e-21
WP_085948178.1|190032_191246_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001444799.1|191300_191591_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.0	2.1e-49
WP_000235090.1|191598_192351_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|192364_192787_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|192813_193122_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918243.1|193165_195811_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|195807_196137_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001152113.1|196136_196835_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_001369128.1|196840_197584_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_122996286.1|197529_198162_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514851.1|198408_201885_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_001230455.1|201952_202552_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279058.1|202616_203939_+|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
WP_001023452.1|203940_204210_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_001217540.1|204577_204826_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_000162574.1|205674_206157_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|206288_206765_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|206754_207045_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|207106_207448_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|207596_209258_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|209343_210222_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|210344_210938_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|210992_212279_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|212299_213091_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460032.1|213257_214619_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|214867_215116_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|215134_215683_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264774.1|215713_216481_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|216522_216870_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589821.1|216946_217429_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|217444_218671_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|218660_219179_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|219328_219694_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|219903_220974_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225214.1|220984_222106_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|222148_223309_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|223407_223455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|223558_223900_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|224170_224908_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|225042_226023_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|226019_226751_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|226880_229454_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|235306_236605_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|236601_236925_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|236970_238326_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083007.1|238439_241100_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001341635.1|241131_241830_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|241898_242318_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|242524_243562_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|243609_244299_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|244602_244986_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|245041_245629_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|245732_246614_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|246823_248158_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298974.1|248289_249027_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	253928	257671	5364442		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|253928_255728_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|255743_256718_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|256990_257671_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 16
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	261129	261390	5364442		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|261129_261390_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 17
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	265509	276817	5364442		Bacillus_phage(50.0%)	7	NA	NA
WP_000970124.1|265509_269397_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.3	9.1e-132
WP_001297612.1|269972_271400_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215888.1|271564_272278_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|272267_273602_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|273662_274001_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|274045_275236_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|275563_276817_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 18
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	282575	284087	5364442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493456.1|282575_284087_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	9.6e-13
>prophage 19
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	299380	305837	5364442		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|299380_300595_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|300622_301009_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|301025_301349_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|301444_301960_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|301976_303827_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|303828_304164_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|304175_304376_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133582.1|304553_305837_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 20
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	315722	316154	5364442		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|315722_316154_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 21
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	324983	331280	5364442		Escherichia_phage(60.0%)	6	NA	NA
WP_000937893.1|324983_326354_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.4	1.2e-41
WP_001299507.1|326515_327982_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|328050_329628_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755172.1|329722_330262_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
WP_000669403.1|330277_330793_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_001344399.1|331106_331280_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 22
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	337714	341716	5364442		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|337714_338353_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001341612.1|338352_339390_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|339714_340341_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|340426_341716_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 23
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	362979	363693	5364442		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|362979_363693_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 24
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	381740	382691	5364442		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|381740_382691_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 25
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	401245	406184	5364442		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|401245_402115_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406004.1|402328_402754_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001325675.1|402740_403190_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_001426072.1|403269_403827_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001345170.1|403922_404822_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	7.7e-26
WP_001345171.1|404879_406184_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 26
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	409662	425032	5364442		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517439.1|409662_410454_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	8.9e-18
WP_000290223.1|410624_411641_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458406.1|411640_412474_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852685.1|412473_413349_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021041.1|413338_414436_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001297645.1|414569_415481_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719943.1|415483_415852_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|415956_416808_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|416849_417359_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|417399_419127_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|419171_419429_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|419812_420784_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254843.1|420968_421730_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|421959_422946_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|423016_425032_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 27
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	455257	456178	5364442		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|455257_456178_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 28
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	459869	467446	5364442		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|459869_461564_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|461633_462578_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|462651_463797_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001443604.1|463852_467446_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 29
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	474099	475533	5364442		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|474099_475533_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 30
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	478572	479505	5364442		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|478572_479505_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 31
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	497380	498466	5364442		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|497380_498466_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 32
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	507021	508158	5364442		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|507021_508158_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 33
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	514634	516152	5364442		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|514634_516152_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 34
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	520363	522224	5364442		Planktothrix_phage(50.0%)	2	NA	NA
WP_001293612.1|520363_521137_+	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	38.1	2.4e-23
WP_000156114.1|521333_522224_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	4.0e-67
>prophage 35
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	532783	536011	5364442		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|532783_533434_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|533520_535353_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|535411_536011_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 36
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	574326	577348	5364442		Cronobacter_phage(33.33%)	3	NA	NA
WP_000461661.1|574326_575295_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001345211.1|575298_576438_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	6.5e-30
WP_001297077.1|576745_577348_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 37
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	580500	642069	5364442	holin,protease,integrase,lysis,transposase	Enterobacteria_phage(20.0%)	47	597750:597785	629635:629670
WP_106895287.1|580500_581403_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.6e-68
WP_001000358.1|581596_582787_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209922.1|582783_584043_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|584032_585661_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|585933_587292_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|587296_588373_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|588835_589486_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000179250.1|589539_589794_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|589793_590924_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|591012_593298_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_001345213.1|593993_597728_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.6e-19
597750:597785	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000990754.1|597855_598578_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|598724_601352_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000012296.1|601500_603189_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001215757.1|603185_603812_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|603806_604877_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|604854_605073_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|605178_605523_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001254228.1|605678_605861_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001345214.1|606364_607192_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_042352449.1|607230_608163_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001108084.1|608710_609277_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|609251_609854_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|609850_610516_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|610512_611136_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_000499454.1|612228_612387_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|612467_612866_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|613008_613224_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075144.1|613223_613721_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000092247.1|613717_614155_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000881316.1|614304_614829_+	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
WP_085948178.1|614868_616082_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072145680.1|616119_616758_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.4e-34
WP_001025665.1|617451_618774_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_122993426.1|619575_623970_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001104541.1|623970_625620_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225855.1|625624_626401_+	YfaP family protein	NA	NA	NA	NA	NA
WP_000876014.1|626675_629525_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001061917.1|629724_630375_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
629635:629670	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001249151.1|630391_633064_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865576.1|633802_634894_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|635005_636061_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786386.1|636134_637199_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|637198_637849_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422230.1|637924_639568_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758043.1|639785_641432_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|641580_642069_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 38
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	648336	648954	5364442		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|648336_648954_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 39
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	658675	677817	5364442	capsid,integrase,terminase	Vibrio_phage(33.33%)	22	658383:658408	667674:667699
658383:658408	attL	CCGTATAACTAAACGTATAACTAAAA	NA	NA	NA	NA
WP_001369202.1|658675_659599_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001229488.1|659761_660250_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001018604.1|660377_660539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|660542_660737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080641.1|660867_661113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833625.1|661314_662715_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_000770163.1|662711_663011_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001205000.1|663016_663250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|663242_663476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023981888.1|663448_663688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345228.1|663903_665712_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	41.1	2.9e-08
WP_000387403.1|665666_665873_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000101907.1|666369_667611_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000256200.1|667980_669741_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
667674:667699	attR	CCGTATAACTAAACGTATAACTAAAA	NA	NA	NA	NA
WP_001135667.1|669760_669988_-	YejL family protein	NA	NA	NA	NA	NA
WP_000050788.1|670169_671177_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.0	7.7e-83
WP_000494183.1|671315_671600_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578079.1|671724_673485_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|673633_674329_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213360.1|674356_675547_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|675879_676224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194877.1|676227_677817_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
>prophage 40
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	683571	687872	5364442		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|683571_684138_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296828.1|684549_685263_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|685301_686288_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000848220.1|686405_687872_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.2	1.9e-42
>prophage 41
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	702353	703211	5364442		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|702353_703211_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 42
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	707280	711066	5364442		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|707280_709272_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425428.1|709303_710140_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|710397_711066_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 43
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	714760	716281	5364442		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255042.1|714760_716281_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 44
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	736614	746053	5364442		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569311.1|736614_737541_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	1.3e-23
WP_000783120.1|737545_738277_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|738257_738365_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|738424_739156_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|739377_741063_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|741059_741779_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|741825_742296_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_001345236.1|742335_742797_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	7.1e-76
WP_001292774.1|744916_746053_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 45
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	758619	760653	5364442	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|758619_760653_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 46
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	771301	774858	5364442		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001345241.1|771301_772120_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	5.0e-24
WP_000434038.1|772171_772918_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|772891_773857_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|773853_774858_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 47
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	784080	790954	5364442	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000807362.1|784080_784980_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|785394_785712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476011.1|786041_787403_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001220181.1|787505_787802_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|787803_788100_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|788308_788641_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|788831_789554_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675146.1|789550_790954_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 48
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	804379	805732	5364442		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469743.1|804379_805732_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	1.9e-07
>prophage 49
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	810457	821319	5364442		Catovirus(20.0%)	8	NA	NA
WP_001345247.1|810457_811099_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|811190_811772_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001252378.1|811793_813647_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001345248.1|813920_815504_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000482917.1|817307_817757_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137212.1|817753_819916_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	31.2	4.9e-18
WP_000206145.1|819988_820831_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_000888711.1|820833_821319_+	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	7.1e-10
>prophage 50
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	826992	844904	5364442	transposase	Bacillus_phage(20.0%)	15	NA	NA
WP_085948267.1|826992_828265_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.7e-175
WP_000609087.1|828371_829265_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	4.3e-45
WP_000923030.1|829730_830924_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001044796.1|830974_832093_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	65.7	5.6e-135
WP_000471008.1|832182_832632_+	GDP-sugar hydrolase WbdI	NA	NA	NA	NA	NA
WP_000076061.1|832665_834117_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	1.2e-52
WP_001033923.1|834122_835493_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	25.8	1.6e-27
WP_000866332.1|835529_836453_+	NAD-dependent epimerase/dehydratase family protein	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	40.4	1.4e-62
WP_000634187.1|836449_837616_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES46	Bathycoccus_sp._RCC1105_virus	34.3	7.9e-47
WP_000244618.1|837654_838920_+	O111 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001300154.1|838909_839962_+	O111 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_000365650.1|839939_840833_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.3	4.2e-08
WP_000707062.1|840829_841954_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000043516.1|842132_843539_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.0	2.6e-36
WP_000704787.1|843737_844904_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.7e-113
>prophage 51
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	853545	854445	5364442		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|853545_854445_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 52
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	862090	863257	5364442		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001369224.1|862090_863257_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	7.2e-226
>prophage 53
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	867595	869760	5364442		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692345.1|867595_867817_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186773.1|867885_868362_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860076.1|868377_868857_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001234505.1|868938_869760_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.0e-45
>prophage 54
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	887526	946782	5364442	head,holin,integrase,portal,transposase,tail,terminase,capsid	Escherichia_phage(36.21%)	73	887485:887544	918845:920154
887485:887544	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_085948178.1|887526_888740_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_071526359.1|888892_890092_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_157847362.1|890202_890475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157847361.1|890452_890836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089719.1|890846_891119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246637.1|891122_892118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042272.1|892820_893072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345280.1|893141_894416_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
WP_001300307.1|894771_895569_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000048405.1|895804_898192_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	63.8	5.9e-81
WP_001090200.1|898284_898476_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|898472_898661_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|899231_899441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394546.1|899441_900080_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|900091_900244_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362152.1|900509_900929_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391948.1|901028_901310_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|901293_901719_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262366.1|901790_902861_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|902867_903614_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_000450617.1|903635_904352_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000603384.1|904384_904666_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|904662_904890_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|904882_905194_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|905321_905540_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|905541_906099_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|906332_906545_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|906664_907009_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|907130_907403_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|907404_908454_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|908466_908826_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640033.1|908834_909389_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_000917764.1|909612_909810_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000301789.1|909944_910658_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000080194.1|911143_912757_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000624722.1|912787_913138_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|913134_913560_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000466957.1|913647_914079_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_153244796.1|914428_914572_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_000023159.1|914557_916495_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000143458.1|916632_916812_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|916852_917125_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284516.1|917201_917417_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_085948178.1|917648_918861_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000638258.1|918845_919250_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	8.2e-52
WP_001092858.1|919292_919826_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_012817896.1|920343_920529_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
918845:920154	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAATGGGAGTGTAACCGGCCATCCTTTGTTGTATCCGGTGATGCTGGGAAAATAACCATCTCAGAAAATGGAAAAGTAACACCGCCATCGCACCAGCATAGTGAGGTGCTCATTGAATTTGCCATTGATTACCTGAAGAACAATAAAAAGCAGGGGCTGATGAAGTGCATTGGTCGTTGCATGGGATATCTGCAGATAGCTGCTGAGATTGAAGCGCTGGCCAGTGGTGCGGACAAGGATGCAGTTGTGCGGGAGGCTCTTCTTCGTGAGTTTGACAACCCGCCCTTTAAAAAAGTGCCGGCTTACTGGTTTCATCCAGGACTGACTTATCTTAAAGGACGTATATAAGCTGGCTCGTTATCTGTTGCCGATAAATCCTGATAAATATCCATGAACACCAAAATCAAATACGGCCTGTCGGCTGCCGTTCTGGCGCTGATTGCCGCTGGTGCGCCTGCGCCTGACATTCTCGACCAGTTTCTGGATGAAAAGGAAGGTAACCACACCACGGCATACCGTGATGGTGCGGGTATCTGGACCATCTGCCGAGGTGCCATCATGGTGGATGGTAAGCCTGTGATTCCTGGCATGAAGCTGTCGAAGGAAAAATGCGACCAGGTTAACGCCATTGAACGTGATAAGGCGCTGGCATGGGTGGAGAAAAACATCAGAGTGCCACTGACCGAACCCCAGAAAGCGGGGATTGCGTCATTCTGTCCGTACAACATTGGCCCCGGTAAGTGTTTCCCGTCGACGTTTTACAGACGGATTAATGCTGGTGACCGCAGGGGAGCATGCGAGGCGATTCGCTGGTGGATTAAGGACGGTGGCAGAGACTGCCGTATTCGCTCAAACAACTGCTACGGTCAGGTCTCACGGCGTGACCAGGAGAGCGCGCTGGCGTGCTGGGGAATTGACAGATAAGCAGAATATTTTGCTGAAAAATGCGGTTTGCTCACACGGGCGGATAACACGAAATCCTGCGAACTGGCAAAAACTAAGTGAATAAAAGTAAAACCCCGTTTGTTGGCCGCAAGTGGGGTTTTGTGTTTCCTGACTCCGGAAAAGTCAAAGGAGAAAGTGTGTTTGATTTTAGCAAACTGATTCGGGAGATTCGAATGATGGCTGAAAAATTATCCACCTGGAAGTTCATCCTTATCTGGCTGGTGTTTGTGATTATGGCTTCCGGTTATTTCATTGGTCAGATACGCTGGTGGTGAAATGAACCGCGTACTGTGCGTGGTCATCATTG	NA	NA	NA	NA
WP_001302717.1|921055_921370_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444498.1|921451_921676_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001426432.1|922102_922609_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
WP_001426431.1|922580_924509_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_000259002.1|924492_924699_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001369121.1|924695_926288_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_001253979.1|926277_927783_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000256823.1|927819_928167_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|928224_929253_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|929304_929688_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|929680_930034_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|930049_930583_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|930579_930975_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235098.1|930982_931735_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|931748_932171_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|932197_932611_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081781.1|932591_935204_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|935200_935530_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001344666.1|936237_936981_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122996286.1|936926_937559_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514851.1|937805_941282_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_001230455.1|941349_941949_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279057.1|942013_943327_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001023476.1|943328_943598_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_122993429.1|944003_945017_+	peptidase M85	NA	NA	NA	NA	NA
WP_001079074.1|946251_946782_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 55
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	950326	962798	5364442		Bacillus_phage(33.33%)	12	NA	NA
WP_001339045.1|950326_950998_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826738.1|950997_952356_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218214.1|952463_953315_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824375.1|953905_955069_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_001313057.1|955636_956002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365565.1|956041_956737_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001157238.1|956803_958222_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786004.1|958202_958673_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001210913.1|958661_959582_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|959754_960672_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009309.1|960750_960933_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001377491.1|961103_962798_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 56
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	980004	1033857	5364442	head,plate,holin,integrase,transposase,tail,terminase,capsid	Enterobacteria_phage(72.73%)	71	999685:999744	1033964:1034087
WP_000826461.1|980004_981213_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.9e-209
WP_000334609.1|981252_981924_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_000790498.1|982030_982264_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118907.1|982260_983466_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001344676.1|983652_984066_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245704.1|984099_985587_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001015023.1|985664_986030_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000287769.1|986029_986440_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146095.1|986454_987867_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000079816.1|988121_989600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087467.1|989764_990484_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_158707524.1|990529_990808_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001441162.1|990833_991082_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001369124.1|991169_991970_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128215.1|992074_993061_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|993075_993744_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272994.1|993740_994493_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	6.0e-32
WP_001154271.1|994722_995445_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|995511_995736_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_000590347.1|995722_995899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611339.1|996194_996851_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283425.1|996847_998680_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|998736_999285_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
999685:999744	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_071529678.1|1000279_1000561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|1000750_1000891_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488108.1|1001081_1001342_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|1001384_1002494_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005427.1|1002651_1003836_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.7	9.9e-223
WP_000290450.1|1003835_1004348_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000393173.1|1004402_1004768_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.1e-55
WP_000333494.1|1004776_1004932_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000979954.1|1007737_1008226_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000905059.1|1008252_1008852_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.4	1.9e-97
WP_032147172.1|1009088_1009793_+	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	95.3	3.0e-126
WP_001164115.1|1009796_1010324_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	2.5e-93
WP_000972183.1|1010352_1010886_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
WP_047335224.1|1010888_1012874_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	94.1	2.2e-174
WP_032273482.1|1012876_1013407_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	3.3e-93
WP_001111942.1|1013399_1014296_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000213447.1|1014299_1014650_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271894.1|1014646_1015228_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000356341.1|1015224_1015860_-|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_000920593.1|1015852_1016320_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000780569.1|1016457_1016865_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000072327.1|1016861_1017254_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1017250_1017574_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1017576_1017777_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|1017776_1018271_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632344.1|1018373_1019174_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055089.1|1019219_1020272_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_001262673.1|1020295_1021132_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613787.1|1021286_1023038_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_158707525.1|1023466_1023616_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.9e-06
WP_085948178.1|1023581_1024795_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_106895289.1|1024800_1027569_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.9	0.0e+00
WP_000564228.1|1027565_1027955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985482.1|1027951_1028569_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000108349.1|1028580_1028880_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	5.3e-40
WP_000153711.1|1028876_1029143_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000985144.1|1029139_1029343_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_000991915.1|1029366_1029783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|1029875_1029989_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514274.1|1029985_1030228_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000159462.1|1030239_1030518_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000739029.1|1030528_1030879_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|1030900_1031104_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|1031175_1031313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|1031402_1031807_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|1031822_1032473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865386.1|1032502_1032850_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|1032855_1033857_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
1033964:1034087	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 57
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1040763	1042278	5364442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|1040763_1042278_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 58
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1052365	1058012	5364442		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001342228.1|1052365_1054027_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483235.1|1054072_1055677_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_000204335.1|1055695_1056556_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|1056558_1057608_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|1057622_1058012_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 59
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1063264	1064998	5364442	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025336.1|1063264_1064998_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
>prophage 60
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1071614	1073665	5364442		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|1071614_1072358_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|1072398_1072794_-	membrane protein	NA	NA	NA	NA	NA
WP_000639271.1|1072846_1073665_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
>prophage 61
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1077683	1084747	5364442		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|1077683_1078205_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024917.1|1078206_1078809_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|1078879_1078945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580328.1|1079083_1079695_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|1079703_1080714_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|1080860_1081646_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|1081642_1082398_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001344710.1|1082476_1083409_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1083424_1084747_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 62
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1092210	1093338	5364442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000741721.1|1092210_1093338_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 63
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1106916	1108392	5364442		Cyanophage(100.0%)	1	NA	NA
WP_000301731.1|1106916_1108392_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	9.9e-79
>prophage 64
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1116448	1120918	5364442		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|1116448_1117111_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|1117134_1117791_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|1117892_1118123_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|1118261_1118636_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879274.1|1118639_1119512_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|1119524_1119866_+	YebY family protein	NA	NA	NA	NA	NA
WP_032272255.1|1120261_1120918_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	1.4e-56
>prophage 65
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1128414	1130463	5364442		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|1128414_1130463_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 66
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1135793	1136003	5364442		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1135793_1136003_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 67
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1141643	1143200	5364442		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|1141643_1143200_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 68
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1147062	1155169	5364442	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854972.1|1147062_1148424_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|1148497_1148677_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|1148796_1149156_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|1149518_1149863_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|1149994_1151905_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220987.1|1151962_1152658_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|1152697_1153279_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001344701.1|1153483_1155169_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.4e-35
>prophage 69
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1163542	1167210	5364442	transposase	Escherichia_phage(66.67%)	3	NA	NA
WP_001349736.1|1163542_1164505_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	1.8e-41
WP_000826412.1|1164512_1165721_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
WP_085948178.1|1165996_1167210_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 70
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1172985	1177562	5364442		Bacillus_phage(100.0%)	3	NA	NA
WP_001369308.1|1172985_1174476_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
WP_000616411.1|1174656_1176132_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|1176278_1177562_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 71
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1180880	1181735	5364442		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|1180880_1181735_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 72
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1184978	1185620	5364442		Tupanvirus(100.0%)	1	NA	NA
WP_001120531.1|1184978_1185620_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 73
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1190546	1192508	5364442		Streptococcus_phage(100.0%)	1	NA	NA
WP_106895290.1|1190546_1192508_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	7.0e-40
>prophage 74
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1198108	1198762	5364442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000882826.1|1198108_1198762_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	9.9e-15
>prophage 75
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1205526	1206747	5364442		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|1205526_1206747_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 76
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1214223	1215051	5364442		Bacillus_virus(100.0%)	1	NA	NA
WP_000175041.1|1214223_1215051_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 77
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1221390	1223652	5364442		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|1221390_1223652_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 78
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1234949	1284746	5364442	head,plate,holin,portal,transposase,tRNA,tail,terminase,capsid	Enterobacteria_phage(77.5%)	56	NA	NA
WP_001144192.1|1234949_1236878_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|1236881_1237424_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|1237520_1237718_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1237770_1238127_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1238249_1238294_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018594.1|1238577_1239561_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672378.1|1239575_1241963_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229263.1|1241967_1242267_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.4e-11
WP_000078923.1|1242573_1242714_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_000488103.1|1242904_1243165_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001035742.1|1243408_1244911_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000132811.1|1245136_1246246_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_021511921.1|1246403_1247588_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.7	1.7e-222
WP_000290450.1|1247587_1248100_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000651581.1|1248155_1248530_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000333503.1|1248538_1248694_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853433.1|1248680_1251488_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000979957.1|1251500_1251989_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000954196.1|1252145_1252718_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144026.1|1252761_1253340_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000108519.1|1253339_1255472_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_032273482.1|1255474_1256005_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	3.3e-93
WP_001111942.1|1255997_1256894_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000213447.1|1256897_1257248_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271894.1|1257244_1257826_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000356341.1|1257822_1258458_-|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_000920593.1|1258450_1258918_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000780569.1|1259055_1259463_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000072327.1|1259459_1259852_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1259848_1260172_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1260174_1260375_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|1260374_1260869_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632344.1|1260971_1261772_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055087.1|1261817_1262870_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.3e-194
WP_001262673.1|1262893_1263730_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613748.1|1263884_1265636_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_000087824.1|1265635_1266682_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000236489.1|1266696_1267221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390707.1|1267783_1268053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211267.1|1268417_1268729_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000686506.1|1268733_1269693_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000165075.1|1271265_1272147_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
WP_000514277.1|1272211_1272454_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159459.1|1272465_1272744_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_100206497.1|1272754_1273033_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
WP_000416308.1|1273743_1274139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956529.1|1274328_1275309_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|1275371_1275923_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029479.1|1275922_1276672_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001209780.1|1276749_1277214_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001326034.1|1277459_1278173_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175600.1|1278235_1279672_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|1279675_1279867_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|1279998_1281045_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|1281201_1282035_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|1282367_1284746_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
>prophage 79
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1305093	1310177	5364442		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|1305093_1305462_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_001297388.1|1305470_1306958_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948855.1|1306967_1307714_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_000908012.1|1307688_1308960_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144575.1|1308956_1310177_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 80
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1318467	1320735	5364442		Escherichia_phage(50.0%)	3	NA	NA
WP_023982239.1|1318467_1319136_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.5	1.3e-22
WP_032272231.1|1319132_1319888_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587564.1|1319922_1320735_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 81
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1326239	1335043	5364442		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|1326239_1326881_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|1326920_1328069_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182363.1|1328359_1329571_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|1329683_1330616_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|1330612_1331638_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|1331936_1332026_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|1332191_1333361_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|1333506_1334088_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101183.1|1334215_1335043_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 82
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1343846	1345345	5364442		Indivirus(50.0%)	2	NA	NA
WP_000250661.1|1343846_1344743_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
WP_001296937.1|1344823_1345345_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 83
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1352256	1353531	5364442	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|1352256_1353531_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 84
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1373405	1375217	5364442		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945880.1|1373405_1375217_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 85
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1385112	1386414	5364442		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|1385112_1386414_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 86
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1396514	1461676	5364442	head,holin,protease,integrase,lysis,transposase,tail,terminase,capsid	Stx2-converting_phage(35.29%)	72	1401269:1401285	1440518:1440534
WP_001260840.1|1396514_1397336_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1397435_1397519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|1397611_1397947_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|1398343_1399597_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|1399703_1400597_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1400731_1401952_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
1401269:1401285	attL	GAGGCGCTGGAGCAGCA	NA	NA	NA	NA
WP_000919226.1|1402076_1402772_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071526378.1|1402724_1404017_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1404175_1404790_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|1404832_1405687_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1405688_1406306_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|1406316_1408740_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000041554.1|1408800_1411227_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001307224.1|1411425_1411731_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|1411838_1412549_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|1412551_1413112_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|1413146_1413488_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1413622_1413949_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1414154_1415369_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|1415380_1416400_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|1416457_1416568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876990.1|1416587_1417868_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001296941.1|1417902_1418139_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048302.1|1418226_1420698_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001083273.1|1420791_1420983_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|1420979_1421168_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|1421583_1421871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001344637.1|1421839_1422205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|1422216_1422369_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|1422561_1422969_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|1423046_1423274_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705364.1|1423257_1423779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054483.1|1423759_1424725_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_085948952.1|1425063_1426276_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	4.2e-168
WP_085948953.1|1426242_1426323_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.2e-06
WP_001064906.1|1426407_1427097_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
WP_085948178.1|1427363_1428577_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001344632.1|1428836_1428968_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000143036.1|1429415_1431266_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411811.1|1431711_1431918_+|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000731236.1|1431922_1432267_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|1432317_1432851_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_012578895.1|1433368_1433554_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736096.1|1433639_1433864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|1434232_1434460_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279803.1|1434501_1434867_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000958415.1|1435156_1435720_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_106895292.1|1435716_1437378_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000173011.1|1437441_1439379_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063025.1|1439423_1439645_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125988.1|1442009_1442336_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
1440518:1440534	attR	GAGGCGCTGGAGCAGCA	NA	NA	NA	NA
WP_001007905.1|1442345_1442696_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1442692_1443139_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1443135_1443480_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275472.1|1443546_1444263_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|1444268_1444643_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|1444738_1444948_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212932.1|1444999_1448242_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|1448234_1448576_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_106895293.1|1448575_1449274_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	6.4e-129
WP_000194763.1|1449284_1450028_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|1449973_1450606_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000649829.1|1450796_1451324_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515042.1|1451457_1454955_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_001230550.1|1455025_1455625_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268965.1|1455689_1457003_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
WP_001023992.1|1457004_1457274_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|1457386_1457962_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|1458034_1458664_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1458745_1459387_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1459967_1460402_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837930.1|1460542_1461676_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
>prophage 87
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1466636	1467626	5364442		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|1466636_1467626_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 88
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1498899	1502802	5364442		Klosneuvirus(100.0%)	1	NA	NA
WP_000139621.1|1498899_1502802_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 89
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1506604	1507553	5364442		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|1506604_1507135_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|1507379_1507553_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 90
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1519354	1529522	5364442	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_000826406.1|1519354_1520563_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_071532666.1|1520602_1521811_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|1521863_1522400_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001307191.1|1522472_1524434_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000494244.1|1524525_1524756_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|1524977_1525154_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|1525199_1525616_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760637.1|1525694_1527101_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047456.1|1527345_1528491_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|1528508_1529522_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 91
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1532903	1533713	5364442		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|1532903_1533713_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 92
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1537978	1540081	5364442		Salmonella_phage(100.0%)	1	NA	NA
WP_000689391.1|1537978_1540081_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 93
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1544987	1551372	5364442		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103248.1|1544987_1547096_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-27
WP_000014717.1|1547163_1551372_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
>prophage 94
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1557778	1559323	5364442		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|1557778_1559323_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 95
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1566208	1566499	5364442		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001345360.1|1566208_1566499_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	64.0	2.3e-24
>prophage 96
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1572511	1573953	5364442		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|1572511_1572796_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|1572942_1573953_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 97
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1577227	1579133	5364442		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285539.1|1577227_1578154_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_000193551.1|1578146_1579133_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
>prophage 98
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1583449	1587256	5364442		Klosneuvirus(50.0%)	2	NA	NA
WP_001425964.1|1583449_1585849_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426272.1|1585873_1587256_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 99
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1592535	1599471	5364442		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001345363.1|1592535_1595331_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.3e-18
WP_000832502.1|1595375_1597748_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628552.1|1597785_1599471_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 100
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1620162	1621375	5364442	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947772.1|1620162_1621375_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 101
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1634730	1636149	5364442		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|1634730_1636149_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 102
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1643894	1646024	5364442		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|1643894_1644278_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|1644309_1644528_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012625.1|1644584_1646024_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	3.1e-29
>prophage 103
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1653528	1654419	5364442		Bacillus_phage(100.0%)	1	NA	NA
WP_000592835.1|1653528_1654419_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 104
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1659785	1685577	5364442	integrase,tail,transposase	Escherichia_phage(42.86%)	33	1666243:1666256	1686500:1686513
WP_000214712.1|1659785_1659989_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527750.1|1660024_1661485_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000347482.1|1661573_1662857_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_096245710.1|1662916_1663231_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_001121225.1|1663826_1664477_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491542.1|1664701_1665577_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001023452.1|1665717_1665987_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_064764776.1|1665988_1666111_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	86.1	4.3e-09
WP_085948178.1|1666076_1667290_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
1666243:1666256	attL	ATTACCTCCGCTTT	NA	NA	NA	NA
WP_000023139.1|1667341_1669111_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
WP_001059384.1|1670635_1671325_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|1671321_1671687_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|1671687_1672743_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_032178572.1|1672744_1673023_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001217394.1|1673092_1673350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1673570_1673783_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|1674061_1674820_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|1675518_1675683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450683.1|1675679_1676414_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_157825328.1|1676447_1676990_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|1676901_1677942_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|1677913_1678465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1678751_1679159_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|1679423_1679723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171894.1|1679795_1680014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1680036_1680444_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|1680421_1680655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|1680648_1680816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1681215_1681404_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|1681400_1681589_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048484.1|1681684_1684156_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000113189.1|1684220_1684469_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1684446_1685577_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
1686500:1686513	attR	ATTACCTCCGCTTT	NA	NA	NA	NA
>prophage 105
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1692915	1702709	5364442	tRNA,transposase	Escherichia_phage(40.0%)	8	NA	NA
WP_001303944.1|1692915_1693563_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|1693699_1693846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|1694273_1694552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1695578_1696791_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001157407.1|1697323_1698259_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|1698387_1699761_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|1700238_1701222_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|1701476_1702709_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 106
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1709035	1709551	5364442		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945026.1|1709035_1709551_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	7.0e-24
>prophage 107
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1727731	1728814	5364442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000068004.1|1727731_1728814_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	8.1e-22
>prophage 108
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1742817	1744083	5364442		Klosneuvirus(100.0%)	1	NA	NA
WP_000069227.1|1742817_1744083_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.7e-24
>prophage 109
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1756998	1833531	5364442	holin,protease,portal,transposase,tail,terminase	Enterobacteria_phage(40.74%)	84	NA	NA
WP_000573407.1|1756998_1757805_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968850.1|1757872_1758226_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1758593_1759382_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000437858.1|1759526_1760654_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484982.1|1760721_1762656_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_000221855.1|1762733_1762838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1763093_1764306_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153244795.1|1764272_1764419_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	80.0	4.9e-07
WP_001288368.1|1766337_1766511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088625.1|1766600_1767350_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000498253.1|1767618_1767837_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001295580.1|1767962_1768289_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176278.1|1768288_1769026_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|1769217_1770387_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876286.1|1770393_1770702_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256539.1|1770850_1771615_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|1771784_1772375_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099519.1|1772438_1775114_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|1775277_1775373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297116.1|1775486_1775654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295577.1|1775656_1775785_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|1776115_1777090_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001297122.1|1777299_1779897_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|1780276_1780528_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|1780563_1781613_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|1781832_1782591_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|1782587_1783178_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1783217_1784090_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|1784190_1784811_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1784807_1785689_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1785826_1785871_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|1785962_1787525_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1787524_1789120_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|1789123_1790482_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|1790493_1791687_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|1791686_1792493_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1792873_1793053_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1793138_1793639_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1793684_1794191_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000692020.1|1795227_1795818_-	protein kinase	NA	NA	NA	NA	NA
WP_001023476.1|1796953_1797223_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000279057.1|1797224_1798538_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001230457.1|1798602_1799202_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	3.0e-111
WP_106895295.1|1799269_1802746_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
WP_122996286.1|1802982_1803615_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001344666.1|1803560_1804304_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_000847298.1|1805011_1805341_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918237.1|1805337_1807983_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000532073.1|1808026_1808335_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|1808361_1808784_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|1808797_1809550_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|1809557_1809956_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|1809968_1810592_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|1810594_1810876_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|1810868_1811195_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|1811282_1813307_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|1813251_1814754_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102413.1|1814753_1814966_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|1814962_1817086_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|1817082_1817559_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012578895.1|1818033_1818219_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992150.1|1818737_1819271_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_001015158.1|1819307_1819865_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_001072901.1|1819868_1820084_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290214.1|1820161_1820407_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_000143458.1|1820447_1820627_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142980.1|1820764_1822711_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000483498.1|1823305_1824364_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000917735.1|1824514_1824712_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|1824938_1825760_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904137.1|1825756_1826131_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001344904.1|1826143_1827193_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_001447497.1|1827194_1827473_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001260976.1|1827608_1827866_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_000220602.1|1827871_1828171_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_000610381.1|1828376_1828730_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000137950.1|1828726_1829098_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000403788.1|1829193_1829550_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_001209477.1|1829527_1829989_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_001444682.1|1829985_1830282_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_072127369.1|1830278_1830560_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_000075578.1|1830592_1831129_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_085948178.1|1831192_1832406_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000268365.1|1832982_1833531_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
>prophage 110
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1838422	1840437	5364442		Planktothrix_phage(100.0%)	2	NA	NA
WP_000994905.1|1838422_1839427_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	35.6	8.0e-24
WP_000110945.1|1839423_1840437_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 111
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1849847	1860036	5364442		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|1849847_1850465_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287380.1|1851069_1851483_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|1851626_1852535_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193437.1|1852736_1853750_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|1853841_1854747_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|1854859_1855318_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|1855367_1856210_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|1857113_1857791_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571701.1|1857790_1858501_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|1858497_1860036_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 112
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1866020	1872832	5364442	transposase	Escherichia_phage(50.0%)	6	NA	NA
WP_001344908.1|1866020_1868459_+	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	Q6XM27	Feldmannia_irregularis_virus	23.0	1.4e-05
WP_000086212.1|1868459_1869854_-	inverse autotransporter invasin YchO	NA	NA	NA	NA	NA
WP_001169669.1|1870038_1870392_+	DsrE/F sulfur relay family protein YchN	NA	NA	NA	NA	NA
WP_157909695.1|1870608_1870755_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.1e-06
WP_085948178.1|1870720_1871934_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001146442.1|1872601_1872832_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 113
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1875933	1879941	5364442		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|1875933_1876788_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257045.1|1876823_1877633_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|1877636_1878029_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|1878025_1878859_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|1878858_1879941_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 114
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1883077	1885829	5364442		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|1883077_1884025_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|1884149_1885829_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 115
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1913856	1914276	5364442		Morganella_phage(100.0%)	1	NA	NA
WP_000897379.1|1913856_1914276_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	5.9e-37
>prophage 116
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	1930982	2000757	5364442	head,holin,integrase,transposase,tRNA,tail,terminase,capsid	Stx2-converting_phage(37.74%)	77	1944351:1944365	2000859:2000873
WP_000332303.1|1930982_1931714_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|1931934_1932339_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|1932391_1932502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000871285.1|1933034_1933358_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	1.8e-41
WP_000444487.1|1933460_1934711_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248691.1|1934882_1935536_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|1935545_1936007_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|1936060_1937167_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1937202_1937844_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1937847_1939218_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|1939385_1940057_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|1940056_1941517_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|1941592_1942714_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359442.1|1942859_1944089_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|1944338_1945475_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
1944351:1944365	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799400.1|1945458_1946322_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938117.1|1946685_1948047_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_001303921.1|1948107_1948383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|1948462_1948588_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_000145590.1|1948610_1949189_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001369471.1|1949357_1952759_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
WP_001301673.1|1953349_1955698_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|1955717_1955807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023356.1|1955913_1956183_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_000268887.1|1956184_1957507_-|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
WP_001230459.1|1957571_1958171_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_106895296.1|1958237_1961717_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.5	0.0e+00
WP_122996286.1|1961963_1962596_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000967279.1|1962541_1963279_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_001154345.1|1964326_1964500_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|1964607_1964928_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001447444.1|1964944_1965643_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_000807928.1|1965642_1965984_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_000212932.1|1965976_1969219_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_001453698.1|1969270_1969480_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030042.1|1969575_1969950_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001275472.1|1969955_1970672_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|1970738_1971083_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|1971079_1971526_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1971522_1971873_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|1971882_1972209_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063099.1|1974897_1975119_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172984.1|1975163_1977101_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001369319.1|1977164_1978826_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000958415.1|1978822_1979386_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_000279788.1|1979676_1980042_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000095736.1|1980083_1980311_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|1980735_1980921_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1981148_1981295_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1981294_1981864_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992167.1|1982134_1982668_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_000731236.1|1982718_1983063_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411802.1|1983067_1983274_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000874287.1|1983721_1985572_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000935544.1|1986368_1987427_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_000917750.1|1987577_1987775_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|1988016_1988547_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000140024.1|1988555_1988921_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_001369253.1|1988921_1989977_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_012817871.1|1989978_1990251_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_072058819.1|1990418_1990559_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
WP_085948178.1|1990596_1991809_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_023981635.1|1991849_1992266_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.6e-63
WP_000095671.1|1992306_1993269_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693943.1|1993291_1993717_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444689.1|1993713_1994016_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_001169687.1|1994113_1994485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|1994505_1994697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1994698_1994977_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001447517.1|1995272_1995662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1995702_1995921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993436.1|1995924_1996065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1996404_1996593_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1996589_1996781_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106895297.1|1996873_1999339_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
WP_000003742.1|1999400_1999670_+	excisionase	NA	NA	NA	NA	NA
WP_000074981.1|1999638_2000757_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
2000859:2000873	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 117
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2004203	2007926	5364442		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|2004203_2005025_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|2005040_2005952_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251348.1|2005980_2007225_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|2007224_2007926_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 118
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2015215	2015473	5364442		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|2015215_2015473_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 119
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2027796	2029439	5364442		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267931.1|2027796_2028801_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|2028797_2029439_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 120
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2032711	2033893	5364442		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|2032711_2032948_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008538.1|2033158_2033893_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.2e-15
>prophage 121
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2046250	2047192	5364442		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001345393.1|2046250_2047192_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 122
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2063037	2063283	5364442		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|2063037_2063283_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 123
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2067944	2068865	5364442		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|2067944_2068865_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 124
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2078173	2078707	5364442		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|2078173_2078707_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 125
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2082841	2083675	5364442		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|2082841_2083675_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 126
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2089692	2162649	5364442	protease,integrase,transposase	Escherichia_phage(19.05%)	65	2086947:2086961	2160175:2160189
2086947:2086961	attL	CCCCCCTCACCGCCA	NA	NA	NA	NA
WP_001220314.1|2089692_2089914_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001345397.1|2089976_2090453_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214398.1|2090468_2090954_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001234682.1|2091044_2091863_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
WP_000149392.1|2092202_2092523_-	phospholipase	NA	NA	NA	NA	NA
WP_085948274.1|2092589_2093802_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	1.4e-168
WP_000502842.1|2093866_2094505_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_001304205.1|2096222_2098391_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001345400.1|2099144_2100191_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001287881.1|2100865_2101057_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|2101109_2101343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|2101438_2102062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|2102150_2102660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|2103117_2103576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|2104929_2106054_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|2106783_2106981_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|2107046_2107262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303898.1|2107545_2107818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001377350.1|2107906_2108080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|2108131_2108326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|2109106_2109442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|2110075_2110294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|2111746_2113837_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|2114350_2114737_-	protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|2115161_2115737_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|2115805_2116384_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|2116432_2117473_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|2117495_2117951_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|2117973_2119131_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|2119130_2119712_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|2120033_2121092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|2121101_2122244_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|2122236_2123010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|2123011_2124091_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|2124090_2125047_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|2125057_2126266_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|2126283_2126751_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|2127011_2127341_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957251.1|2127327_2127669_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|2128611_2130225_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|2130255_2130606_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|2130602_2131028_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_001135715.1|2134909_2135050_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|2135351_2135615_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021388.1|2136826_2137444_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142973.1|2137455_2138130_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|2138130_2138595_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|2138604_2140308_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|2140300_2140621_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|2140629_2140932_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_042352357.1|2141022_2141721_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|2142101_2142377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591991.1|2142601_2144221_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|2144313_2144673_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_085948178.1|2145529_2146743_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000998045.1|2146950_2148489_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
WP_000233452.1|2149245_2151606_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|2151760_2152324_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335710.1|2153144_2154578_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|2154796_2154994_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|2155220_2155517_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|2156628_2158446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|2158632_2159835_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_001297190.1|2160458_2160914_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
2160175:2160189	attR	CCCCCCTCACCGCCA	NA	NA	NA	NA
WP_001307105.1|2161725_2162649_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 127
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2177549	2307307	5364442	bacteriocin,holin,protease,portal,integrase,lysis,transposase,tail,terminase,capsid	Escherichia_phage(72.64%)	151	2215082:2215108	2287930:2287956
WP_001028095.1|2177549_2178044_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|2178064_2179393_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|2179475_2179649_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_106895298.1|2180579_2188961_-	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	99.7	0.0e+00
WP_000012450.1|2189030_2190296_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|2190306_2190558_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|2190567_2191014_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509481.1|2191016_2191673_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|2191766_2192168_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|2192224_2192365_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835359.1|2192597_2193332_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	99.6	2.2e-135
WP_001301884.1|2193422_2194040_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|2194045_2194324_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|2194338_2195607_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146328.1|2195603_2197229_-	hypothetical protein	NA	A0A2R2Z356	Escherichia_phage	100.0	0.0e+00
WP_001303606.1|2197523_2197712_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|2197851_2198121_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|2198122_2200060_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207923.1|2200056_2200707_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|2200706_2201270_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|2201253_2201715_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140445.1|2201765_2202155_-	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	100.0	3.8e-62
WP_000214467.1|2202209_2203424_-|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_000345015.1|2203447_2204455_-	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
WP_106895299.1|2204612_2206757_-|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	99.9	0.0e+00
WP_000143988.1|2206756_2208463_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|2208443_2209250_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|2209305_2209509_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|2209658_2209952_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|2209983_2210448_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|2210455_2210605_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|2210604_2211174_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|2211448_2211982_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001072899.1|2211986_2212202_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2212279_2212525_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2212565_2212745_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874432.1|2212881_2214819_-	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
2215082:2215108	attL	TGCATGGTGCCGGGTGCCTCCCGGTGA	NA	NA	NA	NA
WP_000738068.1|2215304_2215574_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|2215585_2216545_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|2216927_2217080_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|2217328_2217763_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|2217755_2217950_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_106895300.1|2218315_2219529_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	3.8e-169
WP_000402092.1|2219830_2220280_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001260358.1|2220279_2221251_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000913116.1|2221240_2222761_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001271433.1|2222754_2223132_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|2223298_2223493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|2223663_2223867_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|2223962_2224676_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|2224770_2226240_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|2226236_2227190_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_106777930.1|2227807_2228593_+	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	100.0	1.6e-144
WP_001369605.1|2228848_2229523_+	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_000934197.1|2229817_2230099_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|2230119_2230401_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|2230417_2231368_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187063.1|2231364_2232054_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344637.1|2232053_2232641_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_001071603.1|2232715_2233063_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|2233126_2233948_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159715.1|2234024_2234420_+	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000206047.1|2234570_2235296_+	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_000034212.1|2235292_2235700_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|2235701_2235893_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206786.1|2235895_2236792_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_000203837.1|2237147_2237432_+	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_000211520.1|2237681_2238311_+	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000809302.1|2238366_2238798_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|2238794_2239421_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_001291843.1|2239380_2239593_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994795.1|2239628_2240018_+	DUF1627 domain-containing protein	NA	A0A0H4J3B1	Shigella_phage	100.0	2.1e-52
WP_000497812.1|2240381_2240633_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001208772.1|2240678_2240963_+	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_001401545.1|2241015_2242326_+|integrase	site-specific integrase	integrase	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
WP_000607018.1|2242322_2242901_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|2242921_2243149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044313.1|2243186_2244428_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000097607.1|2244719_2245979_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420629.1|2246238_2247159_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|2247158_2247464_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209869.1|2247556_2248156_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062101.1|2248152_2250699_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|2250698_2251871_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|2252000_2252693_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|2252665_2253694_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001444559.1|2253776_2256521_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818472.1|2256592_2257666_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|2257713_2257887_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|2257876_2258107_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|2258081_2258270_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|2258280_2258493_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|2258778_2258991_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|2259432_2259738_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|2259844_2260489_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038062.1|2260485_2261232_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742348.1|2261231_2263328_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|2263373_2264513_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|2264500_2264947_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|2264966_2267147_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|2267261_2268560_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|2268639_2268732_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460803.1|2268744_2269881_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263563.1|2269892_2271437_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|2271570_2272428_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063972.1|2272424_2272823_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|2272819_2273407_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|2273403_2274111_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|2274129_2275923_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2275919_2277038_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001443410.1|2277655_2278039_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_012817858.1|2278484_2279378_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_085948178.1|2279464_2280677_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303940.1|2280727_2280952_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001303878.1|2281033_2281348_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|2281874_2282060_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675929.1|2282281_2282395_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_001003118.1|2282615_2283149_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_085948178.1|2283378_2284592_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001360224.1|2284657_2284894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|2285149_2285356_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874357.1|2285803_2287654_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000261909.1|2288421_2289135_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2287930:2287956	attR	TGCATGGTGCCGGGTGCCTCCCGGTGA	NA	NA	NA	NA
WP_000917737.1|2289272_2289470_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|2289756_2290575_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|2290726_2291098_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|2291087_2291459_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|2291471_2292521_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_032280206.1|2292540_2292801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|2292968_2293181_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001278454.1|2293369_2293474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032272356.1|2293589_2294459_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	4.0e-120
WP_000224233.1|2294469_2294733_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|2294734_2294899_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|2294984_2295197_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|2295247_2295604_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209481.1|2295581_2296043_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266135.1|2296039_2296336_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001151153.1|2296332_2296755_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001262389.1|2296795_2297866_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693949.1|2297937_2298363_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|2298359_2298575_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103686.1|2298624_2299341_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000379580.1|2299613_2299766_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000394557.1|2299777_2300152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2300683_2300872_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2300868_2301060_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106895301.1|2301152_2302577_+	exonuclease	NA	NA	NA	NA	NA
WP_085948178.1|2302628_2303841_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000273151.1|2305004_2305247_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375138.1|2306647_2307307_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
>prophage 128
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2311540	2313595	5364442		Bacillus_phage(100.0%)	1	NA	NA
WP_001297106.1|2311540_2313595_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 129
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2326194	2328102	5364442		Tupanvirus(100.0%)	1	NA	NA
WP_000053122.1|2326194_2328102_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 130
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2344024	2355157	5364442	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090514.1|2344024_2344792_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
WP_000193859.1|2344998_2347611_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001297200.1|2347876_2349079_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|2349247_2350648_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|2351249_2352338_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|2352522_2353713_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|2353934_2354582_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|2354608_2355157_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 131
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2369862	2374403	5364442		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|2369862_2371611_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_106895302.1|2371647_2373912_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2374118_2374403_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 132
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2379489	2380578	5364442		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|2379489_2380578_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 133
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2384676	2387891	5364442		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|2384676_2386959_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|2387150_2387891_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 134
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2394199	2417996	5364442	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|2394199_2394817_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|2394827_2397272_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|2397510_2398803_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|2398893_2400237_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|2400247_2400859_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077080.1|2401013_2405120_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2405254_2405749_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2406292_2407258_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043619.1|2407380_2409147_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|2409147_2410869_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|2410910_2411615_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2411899_2412118_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|2412802_2415079_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2415109_2415430_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2415752_2415977_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|2416049_2417996_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 135
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2427293	2429012	5364442		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815379.1|2427293_2429012_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	1.2e-30
>prophage 136
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2432599	2435337	5364442		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255145.1|2432599_2433430_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001160723.1|2433426_2433750_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|2433875_2434391_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|2434608_2435337_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 137
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2438675	2447825	5364442		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149732.1|2438675_2439803_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|2439843_2440332_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|2440391_2441237_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|2441233_2442187_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996018.1|2442196_2443330_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126054.1|2443424_2444537_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001345433.1|2444887_2445364_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|2445451_2446354_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|2446414_2447137_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|2447120_2447408_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|2447567_2447825_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 138
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2456391	2457594	5364442		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|2456391_2457594_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 139
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2468938	2470810	5364442		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|2468938_2470810_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 140
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2474025	2482363	5364442		Synechococcus_phage(33.33%)	6	NA	NA
WP_000424890.1|2474025_2474688_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_001295295.1|2474818_2475718_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209359.1|2475723_2478156_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114244.1|2478301_2479117_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168797.1|2479268_2480534_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|2480770_2482363_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 141
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2487360	2492585	5364442		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|2487360_2487876_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|2487928_2487994_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|2488228_2489116_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|2489414_2489918_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|2490321_2491068_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159066.1|2491206_2491866_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|2491862_2492585_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 142
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2496125	2510938	5364442		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|2496125_2496386_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430043.1|2496649_2498932_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|2498973_2499651_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|2499724_2499991_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|2500255_2500516_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443534.1|2500745_2501831_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|2501971_2502934_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001345442.1|2502961_2505112_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	2.8e-42
WP_001145128.1|2505231_2505714_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000007090.1|2505946_2507311_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.6	9.5e-52
WP_001296991.1|2507539_2508211_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|2508213_2509209_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|2509201_2510938_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
>prophage 143
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2521535	2522444	5364442		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|2521535_2522444_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 144
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2528925	2530215	5364442		Klosneuvirus(100.0%)	1	NA	NA
WP_001307065.1|2528925_2530215_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 145
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2534014	2568083	5364442	head,holin,integrase,transposase,tail,capsid	Enterobacteria_phage(55.26%)	43	2541684:2541700	2573475:2573491
WP_021351651.1|2534014_2534386_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_001369236.1|2534509_2535340_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
WP_000950982.1|2535563_2536445_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|2536550_2536820_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000268900.1|2536821_2538135_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001230465.1|2538199_2538799_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
WP_000514984.1|2538866_2542343_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
2541684:2541700	attL	CAGCCCCACAATGGCCG	NA	NA	NA	NA
WP_072147834.1|2542583_2543213_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2543158_2543902_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_000847298.1|2544609_2544939_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082365.1|2544935_2547515_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.4	0.0e+00
WP_000533403.1|2547495_2547909_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479083.1|2547935_2548367_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_001143011.1|2548380_2549133_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
WP_000683071.1|2549140_2549536_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|2549532_2550108_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|2550122_2550476_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|2550468_2550843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|2550894_2551923_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256792.1|2551980_2552328_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_106895303.1|2552364_2553870_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000145948.1|2555796_2556087_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_000818841.1|2556159_2556366_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
WP_000344554.1|2556383_2556746_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
WP_000814614.1|2556717_2557128_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
WP_001254255.1|2557124_2557301_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000386661.1|2557303_2557663_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_000950962.1|2557662_2557839_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001286917.1|2557831_2558044_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000002251.1|2558036_2558327_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001008192.1|2558323_2558686_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000994516.1|2558682_2558871_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|2559082_2560042_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032178163.1|2560381_2560504_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|2560518_2561208_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|2561392_2562136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|2562221_2562380_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023272.1|2562678_2564529_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411800.1|2564976_2565183_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000075117.1|2565182_2565380_+	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.2e-19
WP_085948178.1|2565385_2566598_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000638251.1|2566582_2566993_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.2	1.1e-64
WP_000263438.1|2567006_2568083_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
2573475:2573491	attR	CAGCCCCACAATGGCCG	NA	NA	NA	NA
>prophage 146
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2577885	2584458	5364442		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891685.1|2577885_2578944_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|2578946_2579636_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113002.1|2579635_2580409_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|2580574_2580724_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|2580852_2581641_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|2581708_2583181_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265438.1|2583441_2584458_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 147
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2588813	2589866	5364442		Klebsiella_phage(100.0%)	1	NA	NA
WP_001109199.1|2588813_2589866_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.0e-81
>prophage 148
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2627734	2628526	5364442		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114037.1|2627734_2628526_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.0	3.7e-08
>prophage 149
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2631904	2634846	5364442		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032682.1|2631904_2633386_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.4	1.1e-45
WP_000207146.1|2633427_2634846_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	5.2e-61
>prophage 150
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2638929	2647714	5364442		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000015219.1|2638929_2643111_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	7.2e-26
WP_000424924.1|2643361_2643568_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|2643880_2643970_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000730091.1|2643969_2645643_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087956.1|2645665_2647714_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	1.6e-26
>prophage 151
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2650969	2651647	5364442		Bacillus_phage(100.0%)	1	NA	NA
WP_000186103.1|2650969_2651647_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 152
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2658302	2659067	5364442		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|2658302_2659067_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 153
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2663217	2667031	5364442	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|2663217_2664882_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|2665084_2667031_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 154
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2671657	2673322	5364442		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000337071.1|2671657_2673322_+	asparagine synthase B	NA	E5EQ62	Micromonas_sp._RCC1109_virus	38.5	1.0e-84
>prophage 155
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2677418	2678498	5364442		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490847.1|2677418_2678498_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 156
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2686394	2689927	5364442		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|2686394_2687120_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207522.1|2687237_2688173_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367891.1|2688256_2689927_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	1.8e-76
>prophage 157
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2696865	2699448	5364442	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|2696865_2699448_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 158
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2706458	2708898	5364442		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231415.1|2706458_2707547_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|2707686_2708898_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 159
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2713713	2714360	5364442		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|2713713_2714097_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|2714150_2714360_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 160
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2729785	2731900	5364442		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|2729785_2730214_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|2730334_2731900_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 161
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2735009	2736230	5364442		Streptococcus_phage(100.0%)	1	NA	NA
WP_000029808.1|2735009_2736230_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	6.1e-58
>prophage 162
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2751371	2757414	5364442		Klosneuvirus(50.0%)	3	NA	NA
WP_001005919.1|2751371_2752187_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096713.1|2752183_2753317_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077704.1|2753532_2757414_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
>prophage 163
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2768843	2771987	5364442		Leptospira_phage(100.0%)	1	NA	NA
WP_000573931.1|2768843_2771987_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	3.2e-58
>prophage 164
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2775257	2868132	5364442	head,protease,transposase,tRNA,tail,capsid	Escherichia_phage(33.33%)	79	NA	NA
WP_000770957.1|2775257_2775941_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	3.9e-30
WP_000253805.1|2775930_2777379_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000103161.1|2778115_2780017_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.9e-27
WP_001160811.1|2780044_2780506_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_001289036.1|2780525_2785325_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	38.9	1.9e-17
WP_000092528.1|2785326_2785692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333355.1|2785996_2786434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001344803.1|2786477_2786801_+	sugar-binding protein	NA	NA	NA	NA	NA
WP_000420935.1|2786927_2788064_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383942.1|2788332_2790570_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001345000.1|2790556_2793529_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|2793529_2794420_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177454.1|2794602_2795364_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001201824.1|2795876_2796830_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226384.1|2797016_2798501_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|2798684_2798990_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|2799046_2799715_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_153244794.1|2799672_2799819_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.4e-06
WP_085948178.1|2799784_2800998_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000840226.1|2801003_2803184_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_000459457.1|2803176_2803611_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|2803592_2804015_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|2804030_2804771_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683103.1|2804778_2805174_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_000985132.1|2805170_2805749_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_085947772.1|2805841_2807055_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000752958.1|2807075_2807375_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_000158868.1|2807386_2807782_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063245.1|2807823_2808849_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_001345004.1|2808904_2809237_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000805428.1|2810447_2811080_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001255226.1|2811082_2811598_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001345007.1|2812649_2815259_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988363.1|2815289_2815982_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|2816201_2816744_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729154.1|2817224_2818091_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|2818092_2818305_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143540.1|2818412_2818934_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912342.1|2818969_2820355_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_000256002.1|2820528_2821023_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000212252.1|2821025_2821748_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_001295318.1|2821865_2822375_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000815554.1|2822371_2823439_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000855355.1|2823575_2824469_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000152513.1|2824465_2825281_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000495365.1|2825291_2826551_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000580836.1|2826560_2828228_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000703909.1|2828544_2829594_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_085948178.1|2829653_2830867_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001301144.1|2830928_2832164_+	allantoate deiminase	NA	NA	NA	NA	NA
WP_000540946.1|2832174_2832960_+	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001315307.1|2833088_2834234_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_001298987.1|2834255_2835557_-	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000006887.1|2835613_2836975_-	allantoinase AllB	NA	NA	NA	NA	NA
WP_000401100.1|2837034_2838489_-	putative allantoin permease	NA	NA	NA	NA	NA
WP_000765839.1|2838657_2839536_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000943558.1|2839635_2840412_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001342079.1|2840424_2842206_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000141275.1|2842295_2843111_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000776388.1|2843188_2843671_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000460145.1|2843900_2844827_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_001158001.1|2844895_2845990_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_001320180.1|2847221_2847482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000561841.1|2852103_2854518_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|2854514_2855201_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001295836.1|2855171_2855795_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_000148941.1|2855784_2856594_+	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295322.1|2856654_2857509_+	chaperedoxin	NA	NA	NA	NA	NA
WP_001345010.1|2857571_2858354_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001157532.1|2858340_2859018_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_000904502.1|2859163_2860081_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000970323.1|2860077_2860536_+	NfeD family protein	NA	NA	NA	NA	NA
WP_001026747.1|2860536_2860944_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000982172.1|2861068_2862361_-	amino acid permease	NA	NA	NA	NA	NA
WP_000883048.1|2862363_2863296_-	glutaminase A	NA	NA	NA	NA	NA
WP_000078269.1|2863557_2866062_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_001342071.1|2866175_2866517_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000365177.1|2866654_2867449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186631.1|2867652_2868132_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
>prophage 165
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2874761	2886976	5364442	transposase	Acanthamoeba_polyphaga_moumouvirus(20.0%)	12	NA	NA
WP_000801832.1|2874761_2875721_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_001250125.1|2875717_2876680_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|2876915_2877560_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678194.1|2877740_2879615_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|2879724_2880330_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|2880329_2880659_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|2880711_2882643_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|2882771_2883323_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_001188905.1|2883475_2883853_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_000844848.1|2883922_2884450_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_000051146.1|2884463_2884625_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_085948259.1|2885762_2886976_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	2.4e-99
>prophage 166
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2892871	2896021	5364442		Leptospira_phage(100.0%)	1	NA	NA
WP_001132475.1|2892871_2896021_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 167
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2904856	2908403	5364442		Bacillus_phage(100.0%)	2	NA	NA
WP_001256174.1|2904856_2906638_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_001235583.1|2906630_2908403_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.4e-49
>prophage 168
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2911726	2912422	5364442		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|2911726_2912422_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 169
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2915550	2920597	5364442	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|2915550_2915823_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|2916031_2918386_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|2918573_2919848_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|2919973_2920597_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 170
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2944428	2953409	5364442	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|2944428_2944899_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150472.1|2944987_2946091_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_000543535.1|2946094_2946544_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|2946694_2947234_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|2947532_2948417_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974809.1|2948593_2948941_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|2949069_2950041_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|2950051_2951899_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|2951926_2952259_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|2952281_2953409_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 171
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2960361	2970334	5364442		Bacillus_phage(60.0%)	7	NA	NA
WP_000893632.1|2960361_2961657_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
WP_000113933.1|2961714_2962404_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|2962593_2963796_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698931.1|2963792_2966936_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001345020.1|2967061_2968246_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219321.1|2968389_2969298_-	fructokinase	NA	NA	NA	NA	NA
WP_001345021.1|2969422_2970334_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.3	1.8e-102
>prophage 172
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2974623	2975739	5364442		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|2974623_2975739_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 173
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2983154	2987702	5364442	transposase	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000830745.1|2983154_2984312_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
WP_001295335.1|2984312_2984936_-	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
WP_000795077.1|2985023_2986316_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|2986489_2987702_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 174
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2991818	2992586	5364442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939373.1|2991818_2992586_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 175
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	2997882	2998992	5364442		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|2997882_2998992_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 176
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3002169	3004130	5364442		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|3002169_3003183_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|3003179_3004130_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 177
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3009540	3013820	5364442		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805913.1|3009540_3010623_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.2	1.8e-191
WP_000177886.1|3010745_3013820_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
>prophage 178
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3017660	3023357	5364442		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952485.1|3017660_3018560_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
WP_106895305.1|3018599_3019883_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|3019872_3021132_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010284.1|3021470_3023357_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 179
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3031733	3036271	5364442		Tupanvirus(50.0%)	4	NA	NA
WP_000692745.1|3031733_3032783_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	8.3e-72
WP_000750340.1|3032869_3033826_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|3033822_3034794_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447335.1|3034786_3036271_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 180
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3048265	3058741	5364442	holin	Escherichia_phage(33.33%)	5	NA	NA
WP_001341217.1|3048265_3052249_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	2.5e-124
WP_000131044.1|3052821_3054855_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|3054983_3055571_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089070.1|3055584_3057057_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159100.1|3057070_3058741_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
>prophage 181
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3064316	3067242	5364442	transposase	Erysipelothrix_phage(50.0%)	3	NA	NA
WP_001046293.1|3064316_3065642_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474083.1|3065750_3065978_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|3066029_3067242_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 182
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3081047	3090850	5364442	integrase,transposase	Enterobacteria_phage(28.57%)	8	3083717:3083730	3097246:3097259
WP_000942525.1|3081047_3082118_-	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_085948178.1|3082605_3083819_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
3083717:3083730	attL	AACAAATTGCCGCC	NA	NA	NA	NA
WP_000083330.1|3084149_3084347_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_000251023.1|3084544_3085426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772642.1|3085568_3086783_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000893251.1|3087138_3088392_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_001285288.1|3088403_3089507_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3089794_3090850_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
3097246:3097259	attR	GGCGGCAATTTGTT	NA	NA	NA	NA
>prophage 183
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3095527	3096694	5364442		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001399806.1|3095527_3096694_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	1.2e-31
>prophage 184
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3119977	3122935	5364442		Catovirus(50.0%)	2	NA	NA
WP_001143093.1|3119977_3122422_+	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
WP_000859525.1|3122539_3122935_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
>prophage 185
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3136803	3140722	5364442		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543898.1|3136803_3137577_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|3137762_3138023_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|3138025_3138304_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3138459_3139200_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3139170_3139938_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3140143_3140722_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 186
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3148079	3154535	5364442		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000509076.1|3148079_3152318_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
WP_000103324.1|3152393_3154535_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
>prophage 187
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3165498	3168318	5364442		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614355.1|3165498_3168318_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.0	7.6e-80
>prophage 188
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3178747	3186600	5364442		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001297205.1|3178747_3179479_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3179543_3180011_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326291.1|3180007_3180730_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|3180763_3181519_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644694.1|3181590_3182949_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000155276.1|3182996_3183767_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230966.1|3183844_3184645_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648609.1|3184885_3185800_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997040.1|3185796_3186600_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
>prophage 189
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3193259	3194291	5364442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3193259_3194291_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 190
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3207251	3211367	5364442		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294774.1|3207251_3210734_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3210770_3211367_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 191
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3220195	3220954	5364442		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001341242.1|3220195_3220954_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.7	2.2e-26
>prophage 192
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3233552	3234977	5364442	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753948.1|3233552_3234977_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 193
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3238906	3239251	5364442		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3238906_3239251_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 194
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3245162	3245960	5364442		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3245162_3245960_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 195
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3251139	3257945	5364442	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001369168.1|3251139_3253569_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
WP_001294700.1|3253642_3254173_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|3254187_3254892_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|3255069_3255525_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937432.1|3255561_3256488_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174639.1|3256526_3257945_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 196
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3267851	3268754	5364442		Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|3267851_3268754_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 197
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3272016	3278484	5364442		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|3272016_3272943_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|3273051_3273714_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|3273754_3274291_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001341254.1|3274496_3276887_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_001189601.1|3276933_3278484_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 198
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3286229	3287654	5364442		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3286229_3287654_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 199
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3296281	3296833	5364442		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|3296281_3296833_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 200
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3301078	3302122	5364442		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3301078_3302122_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 201
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3328096	3329821	5364442		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|3328096_3329821_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 202
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3342522	3343221	5364442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|3342522_3343221_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 203
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3349553	3354976	5364442		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035661.1|3349553_3351905_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	7.9e-38
WP_001117018.1|3352069_3354976_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 204
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3362720	3365474	5364442		Microcystis_phage(50.0%)	5	NA	NA
WP_000257163.1|3362720_3363569_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_000796358.1|3363593_3364193_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_001248979.1|3364228_3364696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998542.1|3364794_3364974_-	antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|3364994_3365474_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 205
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3373369	3379030	5364442		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|3373369_3374884_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|3374914_3376057_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349932.1|3376185_3377403_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000351348.1|3377476_3379030_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.1e-31
>prophage 206
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3384500	3385649	5364442		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|3384500_3385649_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 207
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3390055	3392872	5364442	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286861.1|3390055_3392872_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.0	4.6e-77
>prophage 208
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3399913	3408967	5364442		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681360.1|3399913_3401080_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|3401608_3401818_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118450.1|3401921_3403037_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	5.4e-29
WP_000516135.1|3403125_3405042_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|3405418_3405823_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|3405848_3406562_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|3406710_3407277_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|3407311_3407899_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|3408013_3408967_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 209
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3417228	3536234	5364442	head,plate,holin,protease,integrase,lysis,transposase,tRNA,tail,terminase,capsid	Shigella_phage(27.27%)	144	3411614:3411637	3539357:3539380
3411614:3411637	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_001223181.1|3417228_3417915_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|3418314_3418455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|3418550_3419267_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920344.1|3419325_3420678_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219604.1|3420735_3422160_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188659.1|3422159_3422849_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|3422861_3423335_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|3423545_3424415_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|3424411_3425059_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001297279.1|3425110_3425632_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|3425717_3426044_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|3426133_3428071_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|3428281_3429949_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|3430255_3431488_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|3431508_3432891_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|3432939_3433908_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|3434013_3434658_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105861.1|3434685_3435702_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|3436157_3436877_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|3436956_3438180_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|3438231_3439554_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|3439680_3440460_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143245.1|3440717_3442268_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088396.1|3442239_3443103_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563066.1|3443215_3443998_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|3443994_3445068_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|3445189_3445351_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|3445477_3446083_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202569.1|3446475_3448062_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	1.2e-29
WP_001217539.1|3448281_3448530_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001121225.1|3449122_3449773_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001101699.1|3450057_3450327_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_065763498.1|3450328_3451642_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	1.7e-77
WP_001426435.1|3451706_3452306_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	7.5e-110
WP_106895306.1|3452373_3455850_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.2	0.0e+00
WP_047085664.1|3456088_3456721_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_000194787.1|3456666_3457410_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001341641.1|3457420_3458119_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|3458118_3458460_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_000528251.1|3458744_3459482_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|3459435_3459636_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|3459750_3460215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|3460253_3460499_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|3460534_3460717_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|3460863_3462903_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|3463002_3463563_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|3463785_3463989_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|3464068_3464590_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|3464624_3465536_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|3465535_3466096_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|3466086_3467169_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|3467168_3467606_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|3467598_3468213_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|3468202_3469327_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|3469310_3470660_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113525.1|3470646_3472722_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000213225.1|3472848_3473325_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|3473339_3473705_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|3473713_3475216_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|3475212_3475458_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|3475458_3476019_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|3476015_3476435_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002060.1|3476431_3476800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|3476843_3477791_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850811.1|3477790_3478915_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_000094804.1|3479091_3479565_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|3479683_3481009_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|3480992_3482582_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|3482581_3484246_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000360581.1|3484245_3484827_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279084.1|3484829_3485120_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|3485116_3485425_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|3485405_3485633_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|3485642_3485861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|3485844_3486273_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|3486307_3486808_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|3486879_3487305_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|3487374_3487884_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|3487880_3488177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|3488166_3488364_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|3488356_3488689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|3488727_3488913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|3488909_3489461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|3489464_3489980_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564283.1|3489979_3490513_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000323222.1|3490516_3491059_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|3491156_3491687_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|3491698_3491992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|3491996_3492269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3492265_3492547_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|3492548_3492803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|3492815_3493037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|3493039_3493972_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289290.1|3494042_3496133_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|3496134_3496383_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|3496573_3497104_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_122993730.1|3500487_3500697_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000710954.1|3500792_3501167_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	8.6e-64
WP_001275441.1|3501181_3501898_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|3501964_3502309_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3502305_3502752_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3502748_3503099_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3503108_3503435_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063099.1|3505961_3506183_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173011.1|3506227_3508165_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_106895309.1|3508228_3509890_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.1	0.0e+00
WP_000958380.1|3509886_3510450_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001372000.1|3510739_3511105_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.6e-62
WP_001302977.1|3511146_3511332_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3511461_3511602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3511958_3512183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024173637.1|3512206_3512674_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.2e-68
WP_001003112.1|3513100_3513634_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_000138558.1|3513793_3514066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053921381.1|3514321_3514528_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	6.9e-31
WP_025380333.1|3514820_3516671_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000868396.1|3517879_3518806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131905.1|3518792_3519341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|3519353_3519695_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_032275192.1|3519712_3520702_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	3.6e-194
WP_001072673.1|3520709_3521525_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
WP_000767110.1|3521676_3522072_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210151.1|3522068_3522395_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	2.0e-53
WP_001426462.1|3522391_3523045_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	9.6e-127
WP_001444393.1|3523044_3523539_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	3.3e-87
WP_122992285.1|3523535_3523904_-	hypothetical protein	NA	U5P0A0	Shigella_phage	97.5	1.1e-68
WP_001250270.1|3524484_3524697_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000514174.1|3524872_3525457_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001231956.1|3525484_3525682_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|3525777_3526431_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_000135680.1|3526888_3527251_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000008211.1|3528267_3528804_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242736.1|3528794_3529145_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	95.7	2.8e-56
WP_001018057.1|3529141_3529432_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_000672528.1|3529428_3530163_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	55.2	1.7e-39
WP_001289896.1|3530159_3530792_+	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	77.1	2.7e-78
WP_000951712.1|3530793_3531003_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
WP_000207968.1|3530999_3531362_+	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	97.4	8.9e-58
WP_000797279.1|3531534_3531723_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_001426280.1|3532236_3532608_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.2	8.0e-46
WP_001426278.1|3532604_3532967_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	95.8	1.6e-67
WP_001061360.1|3532966_3533182_+	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	98.4	1.1e-31
WP_000566662.1|3533412_3534639_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_001218280.1|3535010_3536234_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	97.8	1.5e-234
3539357:3539380	attR	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
>prophage 210
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3544424	3545704	5364442		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|3544424_3544964_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|3544966_3545704_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 211
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3548931	3554296	5364442		Tupanvirus(50.0%)	4	NA	NA
WP_000106030.1|3548931_3549954_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091571.1|3550092_3551007_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410131.1|3551221_3552583_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919575.1|3552631_3554296_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 212
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3571302	3572516	5364442	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085948178.1|3571302_3572516_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 213
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3575529	3576486	5364442	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181112.1|3575529_3576486_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.7e-60
>prophage 214
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3583987	3584542	5364442		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|3583987_3584542_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 215
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3591109	3592570	5364442		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208201.1|3591109_3592570_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.3e-50
>prophage 216
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3597922	3599135	5364442	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085948178.1|3597922_3599135_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 217
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3604157	3605834	5364442		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|3604157_3604754_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790592.1|3605231_3605834_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	1.5e-54
>prophage 218
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3609196	3610177	5364442		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991446.1|3609196_3610177_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	9.4e-102
>prophage 219
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3631018	3642371	5364442	integrase,tRNA	Enterobacteria_phage(20.0%)	8	3614993:3615007	3637114:3637128
3614993:3615007	attL	CCAGCTGGCTTTTGA	NA	NA	NA	NA
WP_001219055.1|3631018_3631729_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.7	1.8e-41
WP_001345322.1|3632209_3633229_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	3.5e-43
WP_001294535.1|3633358_3634861_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.6e-84
WP_001295681.1|3634979_3636062_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|3636061_3637162_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
3637114:3637128	attR	CCAGCTGGCTTTTGA	NA	NA	NA	NA
WP_000397144.1|3637428_3638940_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_001188289.1|3639033_3639516_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416419.1|3639515_3642371_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.6	3.0e-140
>prophage 220
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3650649	3656746	5364442		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|3650649_3651585_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|3651597_3652059_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|3652131_3652518_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|3652723_3655420_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|3655560_3655614_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181332.1|3655798_3656746_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
>prophage 221
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3660384	3663146	5364442		Vibrio_phage(50.0%)	2	NA	NA
WP_000187778.1|3660384_3662523_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|3662681_3663146_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 222
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3667461	3673940	5364442		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|3667461_3668460_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|3668492_3669488_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_024262570.1|3669474_3670497_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205815.1|3670510_3672013_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_089520309.1|3672152_3673100_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|3673409_3673940_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 223
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3695941	3759799	5364442	protease,integrase,tRNA,transposase	Morganella_phage(12.5%)	59	3692546:3692575	3718037:3718066
3692546:3692575	attL	TGTAGGCCTGATAAGCGTAGCGCATCAGGC	NA	NA	NA	NA
WP_001254202.1|3695941_3696232_-|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
WP_085948178.1|3696325_3697538_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000603950.1|3699677_3700226_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_000631719.1|3702547_3702895_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001218841.1|3704556_3705822_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|3706201_3706777_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|3706813_3708511_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|3708486_3708825_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|3708940_3710242_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|3710359_3711796_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|3712132_3712609_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|3712624_3713881_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|3714156_3714450_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3714493_3716140_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|3716277_3716631_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008073.1|3716834_3717704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032272278.1|3718093_3719122_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
3718037:3718066	attR	TGTAGGCCTGATAAGCGTAGCGCATCAGGC	NA	NA	NA	NA
WP_000257278.1|3719163_3719730_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|3719781_3719907_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|3720017_3720164_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|3720345_3720663_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|3720659_3721193_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|3721281_3722415_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|3722477_3722837_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|3722847_3723243_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|3723253_3723988_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192991.1|3723980_3725789_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|3726113_3727091_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|3727309_3728812_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|3728863_3729178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|3729174_3729489_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|3729517_3732841_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|3732862_3733831_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|3733927_3734980_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|3735074_3735620_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|3736478_3736532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294195.1|3736514_3737654_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|3737652_3739200_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|3739171_3739633_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|3739651_3740989_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122520.1|3740998_3742846_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|3742838_3743789_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3743874_3744183_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460353.1|3744259_3745540_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3745625_3746885_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3746887_3747892_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3747973_3748171_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3748274_3749573_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3749777_3750203_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076318.1|3750241_3752602_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001293281.1|3752781_3753513_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|3753639_3754041_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|3754059_3754758_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012546.1|3754808_3755468_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|3755485_3755884_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|3755893_3756532_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943991.1|3756534_3757698_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_001299838.1|3757781_3759407_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|3759523_3759799_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 224
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3771367	3771982	5364442	transposase	Helicobacter_phage(100.0%)	1	NA	NA
WP_072098057.1|3771367_3771982_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	4.7e-43
>prophage 225
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3776007	3776997	5364442		Salmonella_phage(100.0%)	1	NA	NA
WP_000953030.1|3776007_3776997_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	1.1e-97
>prophage 226
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3790118	3791331	5364442	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085948178.1|3790118_3791331_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 227
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3813316	3814819	5364442		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|3813316_3814819_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 228
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3819659	3820448	5364442		Planktothrix_phage(100.0%)	1	NA	NA
WP_001193388.1|3819659_3820448_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.6e-27
>prophage 229
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3826052	3827602	5364442		Bacillus_virus(50.0%)	2	NA	NA
WP_001075526.1|3826052_3826811_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000611428.1|3826921_3827602_+	phosphonate C-P lyase system protein PhnL	NA	G9BWD6	Planktothrix_phage	33.6	1.3e-17
>prophage 230
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3831587	3833573	5364442		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001066006.1|3831587_3833573_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 231
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3838818	3840966	5364442		Escherichia_phage(100.0%)	1	NA	NA
WP_012817910.1|3838818_3840966_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 232
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3850248	3852207	5364442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|3850248_3852207_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 233
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3857792	3859142	5364442		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3857792_3859142_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 234
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3862959	3866572	5364442		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|3862959_3863496_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|3863749_3866572_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 235
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3870779	3921159	5364442	head,holin,transposase,tRNA,tail,terminase,capsid	Stx2-converting_phage(32.61%)	52	NA	NA
WP_001147328.1|3870779_3871859_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|3871911_3873327_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235522.1|3873409_3874393_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|3874558_3874801_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543817.1|3874934_3875972_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_085948178.1|3877413_3878627_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001132154.1|3879283_3879874_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001117798.1|3880056_3880707_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001345294.1|3880785_3881844_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3881973_3882396_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023417.1|3882556_3882826_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000279033.1|3882827_3884141_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001216290.1|3884205_3884829_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000514845.1|3884897_3888374_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
WP_126303346.1|3888609_3889242_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_000194763.1|3889187_3889931_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_106895312.1|3889941_3890640_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	7.6e-130
WP_000807964.1|3890639_3890981_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212952.1|3890973_3894216_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_001453698.1|3894267_3894477_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030043.1|3894572_3894947_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275461.1|3894952_3895669_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_000133388.1|3895735_3896080_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3896076_3896523_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3896519_3896870_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3896879_3897206_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|3899569_3899791_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173088.1|3899835_3901773_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_009453642.1|3901836_3903498_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000958398.1|3903494_3904058_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_001377217.1|3904173_3904704_-	HNH endonuclease	NA	H6WZK7	Escherichia_phage	93.2	1.2e-90
WP_001303878.1|3904957_3905272_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|3905799_3905985_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|3906201_3906699_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|3906698_3906905_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143076.1|3907353_3909204_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_001339373.1|3910021_3910174_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_001047110.1|3910483_3911236_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_000515862.1|3912748_3913300_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001191679.1|3913292_3913553_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
WP_001345148.1|3913650_3914343_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135680.1|3915046_3915409_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081302.1|3915474_3916299_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
WP_000008211.1|3916426_3916963_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|3916953_3917304_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145671.1|3917300_3917774_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_000829414.1|3917920_3918337_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	69.9	1.4e-30
WP_001014294.1|3918389_3918581_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_001094871.1|3918583_3919318_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001061339.1|3919317_3919890_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093918.1|3919926_3920208_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_000956557.1|3920625_3921159_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 236
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3925350	3925959	5364442		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3925350_3925959_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 237
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3935174	3936290	5364442		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3935174_3936290_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 238
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3952295	3953087	5364442		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130533.1|3952295_3953087_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 239
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3964971	3968655	5364442		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|3964971_3968655_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 240
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3984028	3985618	5364442		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|3984028_3985618_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 241
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	3990986	3992750	5364442		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|3990986_3991259_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940105.1|3991445_3992036_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|3992078_3992750_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 242
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4001964	4010293	5364442		Vibrio_phage(50.0%)	2	NA	NA
WP_000653940.1|4001964_4006188_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	7.2e-66
WP_000263098.1|4006264_4010293_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 243
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4014409	4017462	5364442		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|4014409_4015594_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|4016511_4017462_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 244
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4025969	4027814	5364442		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591365.1|4025969_4027814_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 245
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4044849	4052096	5364442		Serratia_phage(33.33%)	5	NA	NA
WP_000184877.1|4044849_4047147_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4047197_4047518_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004456.1|4047532_4048612_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_032272232.1|4048920_4051422_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|4051433_4052096_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 246
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4065087	4069272	5364442		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000015190.1|4065087_4069272_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.4e-24
>prophage 247
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4074909	4079412	5364442		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|4074909_4076241_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4076307_4077234_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4077326_4077812_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4077896_4078142_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4078566_4079412_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 248
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4090985	4095846	5364442		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|4090985_4091684_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4091680_4093054_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270270.1|4093159_4093834_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|4093982_4094966_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|4095225_4095846_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 249
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4111669	4114720	5364442		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|4111669_4114720_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 250
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4123594	4126374	5364442		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|4123594_4124380_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621651.1|4124413_4125310_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|4125477_4126374_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 251
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4142741	4145212	5364442		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|4142741_4143791_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001345123.1|4143802_4145212_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 252
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4149290	4152077	5364442		uncultured_virus(100.0%)	1	NA	NA
WP_000250055.1|4149290_4152077_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 253
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4165756	4166371	5364442		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|4165756_4166371_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 254
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4175161	4178448	5364442		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|4175161_4175938_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|4175940_4176456_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|4176459_4176729_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|4176807_4178448_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 255
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4190860	4192690	5364442		Catovirus(100.0%)	1	NA	NA
WP_001345114.1|4190860_4192690_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 256
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4200172	4204031	5364442		Bacillus_phage(100.0%)	3	NA	NA
WP_000383411.1|4200172_4202335_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
WP_001213584.1|4202418_4203135_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|4203134_4204031_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 257
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4207067	4209868	5364442		Salmonella_phage(100.0%)	2	NA	NA
WP_001369782.1|4207067_4208546_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
WP_000678273.1|4208542_4209868_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.3e-07
>prophage 258
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4226177	4232321	5364442		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|4226177_4227308_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145196.1|4227312_4227987_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|4227964_4228846_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226587.1|4228864_4229932_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000006625.1|4229931_4231194_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|4231190_4232321_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 259
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4236363	4241775	5364442		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|4236363_4236693_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_032273878.1|4236823_4238089_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	4.1e-41
WP_001299253.1|4238222_4239707_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|4239753_4241775_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 260
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4250248	4251895	5364442		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012624.1|4250248_4251895_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
>prophage 261
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4265288	4271141	5364442		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|4265288_4266179_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|4266203_4267169_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387752.1|4267173_4268679_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|4268686_4269106_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|4269272_4271141_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 262
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4274309	4275302	5364442		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|4274309_4275302_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 263
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4289081	4292443	5364442		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|4289081_4290452_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|4290613_4292443_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 264
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4297972	4301813	5364442		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|4297972_4299013_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|4299099_4300059_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|4300058_4300949_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|4301039_4301813_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
>prophage 265
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4312799	4314137	5364442		Moraxella_phage(100.0%)	1	NA	NA
WP_001345100.1|4312799_4314137_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	1.5e-62
>prophage 266
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4324335	4331704	5364442		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|4324335_4324593_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|4324556_4324916_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|4324932_4325073_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|4325302_4325383_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059105.1|4325679_4327083_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|4327087_4328188_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|4328187_4329261_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|4329289_4331704_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 267
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4336411	4337560	5364442		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|4336411_4337560_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 268
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4341986	4342940	5364442		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|4341986_4342400_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|4342511_4342940_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 269
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4349293	4358455	5364442		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|4349293_4351009_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|4351005_4352499_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511287.1|4352545_4352995_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|4353104_4353452_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|4353441_4353804_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|4353800_4354298_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|4354305_4355490_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|4355908_4355998_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|4356562_4356661_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168480.1|4356766_4358455_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 270
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4365593	4366928	5364442		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|4365593_4366928_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 271
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4379045	4380437	5364442		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4379045_4380437_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 272
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4385558	4392309	5364442		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|4385558_4387667_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|4387685_4387961_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|4388015_4388639_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001426185.1|4388896_4390579_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	4.3e-22
WP_000924289.1|4390575_4391193_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297374.1|4391484_4392309_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 273
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4395682	4400246	5364442		Xanthomonas_phage(33.33%)	6	NA	NA
WP_001298007.1|4395682_4396138_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_001369511.1|4397511_4398180_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|4398396_4398633_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|4398653_4398821_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|4398918_4399728_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|4399766_4400246_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 274
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4412177	4422918	5364442		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|4412177_4413110_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001307464.1|4413398_4414271_+	protein YibB	NA	NA	NA	NA	NA
WP_001214184.1|4414545_4415742_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	6.4e-36
WP_000646014.1|4415751_4416777_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|4417027_4418062_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483854.1|4418048_4419008_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|4419011_4420295_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|4420304_4421849_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|4422093_4422525_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|4422666_4422918_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 275
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4445062	4455221	5364442	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_001346013.1|4445062_4445896_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
WP_000072850.1|4446048_4446891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015171.1|4446911_4451045_-	RHS element protein RhsA	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.7e-25
WP_000779792.1|4451273_4451882_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206271.1|4451979_4453371_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582493.1|4453367_4455221_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	6.7e-16
>prophage 276
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4479400	4480942	5364442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|4479400_4480942_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 277
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4486260	4487256	5364442		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|4486260_4487256_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 278
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4491480	4491693	5364442		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|4491480_4491693_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 279
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4495347	4497681	5364442		Escherichia_phage(100.0%)	1	NA	NA
WP_000013916.1|4495347_4497681_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.1e-71
>prophage 280
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4513599	4515584	5364442		Planktothrix_phage(100.0%)	2	NA	NA
WP_001196495.1|4513599_4514583_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
WP_000107031.1|4514579_4515584_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G9BWD6	Planktothrix_phage	33.7	1.1e-20
>prophage 281
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4562081	4562729	5364442		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|4562081_4562729_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 282
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4565963	4571055	5364442	transposase	uncultured_Caudovirales_phage(75.0%)	6	NA	NA
WP_085948271.1|4565963_4567177_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	3.8e-169
WP_000100276.1|4567382_4568384_-	permease	NA	NA	NA	NA	NA
WP_001175589.1|4568490_4568787_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000065767.1|4568920_4569346_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	7.3e-51
WP_000922639.1|4569358_4570648_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|4570701_4571055_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 283
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4574169	4576212	5364442		Indivirus(100.0%)	1	NA	NA
WP_001344930.1|4574169_4576212_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	2.6e-45
>prophage 284
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4589817	4592553	5364442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149135.1|4589817_4592553_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 285
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4595928	4601580	5364442		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_106895315.1|4595928_4600164_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	2.1e-25
WP_001190062.1|4600366_4600768_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173630.1|4600773_4601580_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
>prophage 286
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4609473	4613605	5364442		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|4609473_4610139_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130624.1|4610359_4610605_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106580.1|4610706_4612905_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000964718.1|4612978_4613605_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 287
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4616611	4619430	5364442		Planktothrix_phage(50.0%)	3	NA	NA
WP_000617723.1|4616611_4617280_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.0	6.1e-28
WP_001041999.1|4617272_4618331_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|4618575_4619430_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 288
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4625163	4626646	5364442		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|4625163_4625931_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|4625932_4626646_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 289
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4630187	4631998	5364442		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|4630187_4631258_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073591.1|4631254_4631998_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.9e-09
>prophage 290
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4652007	4654455	5364442		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|4652007_4654455_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 291
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4663684	4664911	5364442		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105463.1|4663684_4664911_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	3.4e-133
>prophage 292
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4669290	4671684	5364442		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|4669290_4671684_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 293
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4677653	4678532	5364442		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|4677653_4678532_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 294
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4685095	4688862	5364442		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|4685095_4685815_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|4685811_4687164_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|4687239_4688862_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 295
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4705835	4706672	5364442		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|4705835_4706672_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 296
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4730899	4740440	5364442		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601850.1|4730899_4731463_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	3.5e-61
WP_000963792.1|4731548_4732769_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|4732835_4734926_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|4734976_4735609_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148909.1|4735910_4736315_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|4736369_4737239_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|4737292_4737511_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057362.1|4737504_4738527_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|4738526_4740440_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 297
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4745973	4751547	5364442		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|4745973_4746360_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|4746359_4746719_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|4746726_4747014_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|4747139_4747514_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|4747610_4748081_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|4748177_4750292_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|4750362_4751547_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 298
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4771424	4772896	5364442	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004477.1|4771424_4772372_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
WP_000114986.1|4772386_4772896_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 299
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4783377	4787531	5364442		Planktothrix_phage(50.0%)	4	NA	NA
WP_000078339.1|4783377_4784136_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	9.7e-30
WP_001369379.1|4784143_4785247_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019674.1|4785256_4786438_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|4786505_4787531_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 300
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4794035	4794920	5364442		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|4794035_4794920_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 301
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4800257	4804771	5364442		Escherichia_phage(50.0%)	4	NA	NA
WP_000843960.1|4800257_4801088_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_000275535.1|4801430_4802285_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001341904.1|4802320_4803211_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000132907.1|4803271_4804771_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
>prophage 302
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4814813	4815857	5364442		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4814813_4815857_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 303
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4832353	4834878	5364442	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|4832353_4833421_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|4833510_4834878_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 304
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4838844	4839342	5364442	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|4838844_4839342_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 305
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4843047	4844538	5364442		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|4843047_4844538_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 306
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4854464	4869259	5364442		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|4854464_4855394_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|4855489_4857826_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|4858055_4858709_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|4858705_4859434_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|4859430_4860063_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|4860276_4860549_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|4860545_4861400_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|4861445_4861937_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|4862054_4862342_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|4862364_4863798_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|4863845_4864571_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|4864577_4865135_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|4865103_4865679_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|4865675_4866242_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|4866262_4867249_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922902.1|4867262_4868240_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|4868449_4869259_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 307
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4873327	4874804	5364442		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|4873327_4873606_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|4873832_4874804_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 308
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4881432	4884305	5364442	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|4881432_4883367_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|4883456_4884305_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 309
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4887824	4896324	5364442	transposase	Escherichia_phage(33.33%)	5	NA	NA
WP_085948178.1|4887824_4889037_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000207685.1|4889685_4891029_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|4891659_4892112_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|4892139_4893627_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133033.1|4893651_4896324_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 310
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4901805	4903695	5364442		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001297428.1|4901805_4903695_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 311
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4909522	4917315	5364442		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|4909522_4909825_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449041.1|4909875_4910319_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|4910298_4910817_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001298741.1|4910944_4911580_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147619.1|4911652_4912693_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|4912806_4913382_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|4913391_4913982_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|4914001_4914397_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249157.1|4914354_4916391_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809253.1|4916454_4917315_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
>prophage 312
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4940324	4941470	5364442		Streptococcus_phage(100.0%)	1	NA	NA
WP_001297158.1|4940324_4941470_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 313
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4949457	4951752	5364442		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|4949457_4951752_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 314
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4977768	4978734	5364442		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|4977768_4978734_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 315
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	4991155	5007340	5364442	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082880.1|4991155_4994248_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	5.9e-158
WP_000212475.1|4994431_4995415_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|4995633_4995966_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627213.1|4996007_4997498_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000094671.1|4997804_4999325_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	3.1e-35
WP_000018000.1|4999478_5000102_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001065886.1|5000378_5001143_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|5001396_5001903_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|5001981_5003823_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918826.1|5004017_5005763_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|5005873_5006089_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|5006326_5007340_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 316
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5013716	5014955	5364442	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708470.1|5013716_5014955_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.7e-92
>prophage 317
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5020092	5021526	5364442		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869168.1|5020092_5021526_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	1.5e-39
>prophage 318
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5031040	5042002	5364442		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|5031040_5031694_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|5031954_5032125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|5032182_5032956_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188373.1|5033071_5033887_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|5033924_5035085_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|5035090_5035762_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|5035909_5037391_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|5037595_5038225_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|5038225_5038648_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444756.1|5038672_5039500_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105738.1|5039499_5040081_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|5040109_5042002_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 319
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5045829	5056652	5364442		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|5045829_5046222_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183500.1|5046274_5046757_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281881.1|5047302_5049561_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|5049793_5050531_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|5050605_5052018_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095149.1|5052128_5054348_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|5054390_5054648_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|5054698_5055625_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|5055824_5056652_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 320
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5062728	5063613	5364442		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|5062728_5063613_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 321
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5085828	5087001	5364442		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524977.1|5085828_5087001_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	1.4e-40
>prophage 322
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5119407	5123869	5364442	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_085948269.1|5119407_5120621_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.4e-99
WP_077631037.1|5120662_5120800_+	malate transporter	NA	NA	NA	NA	NA
WP_001344959.1|5121108_5121312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|5122655_5123869_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 323
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5133153	5134692	5364442		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723934.1|5133153_5134692_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	29.3	1.0e-09
>prophage 324
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5157381	5158543	5364442	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085948265.1|5157381_5158543_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
>prophage 325
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5168084	5171001	5364442	integrase,transposase	Escherichia_phage(50.0%)	2	5160470:5160485	5177548:5177563
5160470:5160485	attL	ATAAAGAGGATGATTT	NA	NA	NA	NA
WP_085948178.1|5168084_5169298_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001218764.1|5169741_5171001_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	8.4e-79
5177548:5177563	attR	AAATCATCCTCTTTAT	NA	NA	NA	NA
>prophage 326
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5196834	5197989	5364442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|5196834_5197989_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 327
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5218990	5219668	5364442		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|5218990_5219668_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 328
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5237676	5238909	5364442		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|5237676_5238909_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 329
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5247438	5252806	5364442		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195029.1|5247438_5250312_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	4.8e-263
WP_000951964.1|5250572_5251316_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001344773.1|5251372_5252806_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
>prophage 330
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5256730	5272122	5364442	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|5256730_5257627_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|5257651_5258362_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813220.1|5258367_5260101_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|5260191_5261289_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|5261299_5262817_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192826.1|5262859_5263408_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|5263462_5263534_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|5263530_5263656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|5263657_5265106_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001345944.1|5265541_5267461_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|5267460_5267949_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|5267984_5269352_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|5269387_5270704_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|5270721_5272122_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 331
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5296401	5297157	5364442		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|5296401_5297157_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 332
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5319996	5322491	5364442		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603508.1|5319996_5320758_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
WP_000256438.1|5321072_5322491_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 333
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5332122	5338895	5364442		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|5332122_5332836_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|5332904_5333594_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|5334278_5334809_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|5334821_5337068_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|5337218_5338094_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|5338100_5338895_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 334
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5344372	5355500	5364442		Bacillus_phage(50.0%)	5	NA	NA
WP_001138219.1|5344372_5347261_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	9.0e-68
WP_001285980.1|5347253_5350796_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	2.6e-08
WP_000775974.1|5350795_5352622_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.9	5.4e-26
WP_000237947.1|5352683_5354015_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|5354246_5355500_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
>prophage 335
NZ_CP027307	Escherichia coli strain 2015C-3108 chromosome, complete genome	5364442	5359358	5363539	5364442	tRNA	Tetraselmis_virus(33.33%)	4	NA	NA
WP_001066234.1|5359358_5359955_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	5.3e-23
WP_001341841.1|5360026_5360974_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.9	6.9e-17
WP_000678646.1|5361558_5362656_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|5362732_5363539_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
>prophage 1
NZ_CP027309	Escherichia coli strain 2015C-3108 plasmid unnamed2, complete sequence	93724	9897	92362	93724	transposase,tRNA,head,plate,tail,terminase,portal,protease,holin,integrase	Escherichia_phage(92.55%)	99	11811:11829	39565:39583
WP_000209226.1|9897_10332_+	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	93.8	8.1e-74
WP_001230915.1|10334_10595_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	100.0	1.8e-44
WP_086252943.1|10928_11225_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
WP_001344839.1|11454_11736_+	hypothetical protein	NA	A0A222YW96	Escherichia_phage	97.8	2.0e-41
11811:11829	attL	ATGTTAGAAAACTAATTTA	NA	NA	NA	NA
WP_000077917.1|11849_13058_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.3	1.7e-230
WP_032220960.1|15525_16353_+|protease	serine protease	protease	A0A077SLJ6	Escherichia_phage	98.2	6.9e-130
WP_000488304.1|17421_17613_+	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
WP_096850647.1|17612_18005_+	hypothetical protein	NA	A0A222YWH1	Escherichia_phage	99.2	8.4e-70
WP_000435256.1|18113_18506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001444356.1|18886_19867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096850648.1|19866_21375_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	57.0	7.3e-162
WP_000888609.1|21402_21642_-	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
WP_063074802.1|22835_23864_+|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	1.5e-57
WP_000349257.1|23973_24282_+	hypothetical protein	NA	Q5QBE7	Escherichia_phage	100.0	1.4e-51
WP_096850650.1|24278_24755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000640907.1|24751_25246_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	99.4	2.2e-91
WP_106895323.1|25260_25938_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	74.2	2.5e-93
WP_000432096.1|25944_26721_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	99.6	1.3e-141
WP_000113017.1|26753_26951_-	hypothetical protein	NA	A0A222YWI9	Escherichia_phage	100.0	2.9e-26
WP_001216038.1|26955_27336_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	100.0	2.5e-63
WP_001190712.1|27335_27557_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000098854.1|27665_28088_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	100.0	1.8e-70
WP_000506729.1|28222_28612_-	DNA repair protein	NA	A0A222YZE2	Escherichia_phage	98.4	4.1e-69
WP_001443773.1|28623_28770_-	hypothetical protein	NA	A0A222YXH0	Escherichia_phage	100.0	1.7e-20
WP_106895326.1|28943_29153_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	97.1	3.1e-31
WP_001142397.1|29137_29422_-	hypothetical protein	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
WP_000208025.1|29405_30572_-	hypothetical protein	NA	A0A222YWE8	Escherichia_phage	80.0	2.7e-164
WP_000951712.1|30568_30778_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
WP_000224731.1|30779_30974_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.3	2.1e-29
WP_000078034.1|30975_31701_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	72.6	7.0e-86
WP_000476201.1|31697_31937_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	93.7	5.3e-35
WP_000158003.1|31929_32133_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_000664380.1|32216_32897_-	hypothetical protein	NA	Q71T76	Escherichia_phage	68.4	1.6e-84
WP_044083693.1|32913_33909_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	99.4	2.1e-197
WP_000613619.1|34006_34699_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	99.1	7.0e-136
WP_000104067.1|34695_35007_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	98.1	6.9e-59
WP_000139730.1|35003_35228_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	94.6	1.9e-34
WP_001018059.1|35224_35500_-	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	82.4	8.0e-35
WP_000672516.1|35496_36282_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	90.4	9.0e-71
WP_000213525.1|36278_36602_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	85.3	1.4e-41
WP_001344855.1|36601_37270_-	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	97.3	2.3e-120
WP_000834215.1|37266_37776_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	66.0	4.1e-40
WP_044868358.1|37765_38050_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	92.6	6.3e-43
WP_021545915.1|38079_38703_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	82.8	7.6e-89
WP_032271985.1|38975_39572_+	recombinase	NA	A0A222YXV2	Escherichia_phage	90.4	1.4e-68
WP_155954547.1|39711_39870_+	hypothetical protein	NA	NA	NA	NA	NA
39565:39583	attR	TAAATTAGTTTTCTAACAT	NA	NA	NA	NA
WP_071587538.1|40245_40365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201264.1|40383_40599_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	100.0	1.1e-36
WP_089581012.1|40598_41540_+	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	91.4	2.3e-161
WP_000717719.1|41599_41884_+	hypothetical protein	NA	A0A222YY28	Escherichia_phage	96.8	1.1e-42
WP_000201621.1|42029_42380_+	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	100.0	9.2e-60
WP_032271984.1|42420_43320_-	hypothetical protein	NA	A0A222YYN1	Escherichia_phage	90.3	5.9e-151
WP_023908597.1|43588_44242_+	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	98.6	1.9e-114
WP_000542383.1|44570_44900_+	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_032271983.1|44892_46086_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	97.0	9.1e-200
WP_000986754.1|46119_46848_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	58.8	4.0e-73
WP_001022420.1|46869_47070_-	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
WP_000806445.1|47126_47465_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_000162415.1|47535_47838_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_000532305.1|48000_48792_+	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	99.2	6.7e-151
WP_106895324.1|48788_49556_+|plate	baseplate	plate	A0A222YWF4	Escherichia_phage	98.4	9.2e-137
WP_000046499.1|49559_50540_+	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	99.7	7.2e-187
WP_000828873.1|50536_51190_+	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	99.1	2.1e-102
WP_001258014.1|51249_52155_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	88.0	3.6e-148
WP_032153356.1|52168_52819_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	91.2	3.6e-118
WP_000045770.1|52811_53717_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	97.3	1.5e-170
WP_001287146.1|53765_55427_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.6	0.0e+00
WP_000595051.1|55695_55983_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
WP_000585022.1|55975_56617_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	99.5	6.3e-115
WP_000076909.1|56904_57243_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	99.1	2.6e-51
WP_001217887.1|57256_58213_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.4	2.2e-180
WP_001272821.1|58479_58764_+	alanine racemase	NA	A0A222YXW1	Escherichia_phage	83.0	4.0e-37
WP_000483458.1|59607_60099_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	100.0	1.2e-62
WP_000020025.1|60251_60710_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	100.0	2.1e-88
WP_000331486.1|60726_61119_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	99.2	1.5e-66
WP_001038834.1|61277_62975_+	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	100.0	0.0e+00
WP_001396841.1|63122_63401_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	100.0	3.1e-42
WP_001033851.1|63468_65127_+|tail	tail sheath protein	tail	A0A222YWC8	Escherichia_phage	97.8	1.7e-305
WP_000801017.1|65171_65906_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
WP_001112721.1|65973_66546_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	99.5	1.8e-100
WP_000012433.1|66554_67046_+	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
WP_000187856.1|67100_67652_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	2.3e-97
WP_000021878.1|67667_68375_+	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_001077897.1|68756_69512_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_001025044.1|69900_70722_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	99.3	1.7e-157
WP_000965098.1|74525_74900_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	98.4	3.5e-65
WP_021545906.1|74896_76327_+	hypothetical protein	NA	A0A222YWB2	Escherichia_phage	99.8	1.1e-271
WP_000654652.1|76337_77183_+	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	100.0	4.5e-161
WP_001396839.1|77574_77724_+	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
WP_000972092.1|80807_81335_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	94.9	8.9e-91
WP_000972165.1|81363_81897_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.9	6.0e-95
WP_106895325.1|81899_83420_-|tail	phage tail protein	tail	A0A222YYI1	Escherichia_phage	91.3	2.7e-273
WP_085948178.1|84013_85227_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000457140.1|85447_85774_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
WP_000526264.1|85773_86220_+	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_097744290.1|86823_88767_+|head	head protein	head	A0A222YWA3	Escherichia_phage	96.6	3.0e-309
WP_000156173.1|88766_89135_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	8.0e-38
WP_001043710.1|89229_90615_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	1.8e-236
WP_072048486.1|91129_92362_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	99.0	3.4e-234
