The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	214025	260250	5313278	tail,transposase,tRNA,head,terminase,capsid,holin	Stx2-converting_phage(34.09%)	48	NA	NA
WP_000956557.1|214025_214559_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|214976_215258_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_001061339.1|215294_215867_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|215866_216601_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|216603_216795_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_000829414.1|216847_217264_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	69.9	1.4e-30
WP_085948178.1|217772_218985_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001242740.1|219193_219544_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|219534_220071_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_000081302.1|220198_221023_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
WP_000135680.1|221088_221451_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001345148.1|222154_222847_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_001191679.1|222944_223205_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
WP_000515862.1|223197_223749_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001047110.1|225261_226014_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|226323_226476_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143076.1|227293_229144_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_000411802.1|229592_229799_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|229798_230296_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|230512_230698_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|231225_231540_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001377217.1|231793_232324_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	93.2	1.2e-90
WP_000958398.1|232439_233003_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_009453642.1|232999_234661_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000173088.1|234724_236662_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_001063096.1|236706_236928_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|239291_239618_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|239627_239978_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|239974_240421_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|240417_240762_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275461.1|240828_241545_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_001030043.1|241550_241925_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|242020_242230_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212952.1|242281_245524_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_000807964.1|245516_245858_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152209.1|245857_246556_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
WP_000194763.1|246566_247310_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_126303346.1|247255_247888_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_000514845.1|248123_251600_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
WP_001216290.1|251668_252292_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279033.1|252356_253670_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023417.1|253671_253941_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000442132.1|254101_254524_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001345294.1|254653_255712_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001117798.1|255790_256441_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132154.1|256623_257214_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|257715_257964_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000543817.1|259212_260250_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	374886	437123	5313278	tRNA,integrase,protease,transposase	Vibrio_phage(14.29%)	60	416625:416654	440812:440841
WP_000811566.1|374886_375162_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|375278_376904_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|376987_378151_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|378153_378792_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|378801_379200_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012546.1|379217_379877_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|379927_380626_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|380644_381046_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293281.1|381172_381904_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076318.1|382083_384444_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001177639.1|384482_384908_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|385112_386411_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|386514_386712_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|386793_387798_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|387800_389060_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|389145_390426_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|390502_390811_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|390896_391847_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|391839_393687_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|393696_395034_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|395052_395514_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_106898629.1|395485_397033_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294195.1|397031_398171_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|398153_398207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|399070_399616_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|399710_400763_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|400859_401828_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|401849_405173_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|405201_405516_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|405512_405827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|405878_407381_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|407599_408577_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|408901_410710_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|410702_411437_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|411447_411843_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|411853_412213_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|412275_413409_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|413497_414031_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|414027_414345_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|414526_414673_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|414783_414909_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|414960_415527_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|415568_416597_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
416625:416654	attL	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
WP_001008073.1|416986_417856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|418059_418413_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729116.1|418550_420206_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|420249_420543_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|420818_422075_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|422090_422567_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|422903_424340_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|424457_425759_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|425874_426213_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|426188_427886_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|427922_428498_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|428877_430143_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000631719.1|431804_432152_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_000603950.1|434473_435022_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_001340019.1|435944_436148_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159026288.1|436079_436409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159026289.1|436472_437123_+|transposase	transposase	transposase	NA	NA	NA	NA
440812:440841	attR	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 3
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	491024	563209	5313278	tRNA,integrase,protease,transposase	Escherichia_phage(38.46%)	54	494424:494444	539086:539106
WP_000416419.1|491024_493880_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.6	3.0e-140
WP_001188289.1|493879_494362_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
494424:494444	attL	GGGAGAGGGTTAGGGTGAGGG	NA	NA	NA	NA
WP_000397144.1|494455_495967_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|496233_497334_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|497333_498416_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001345322.1|500165_501185_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	3.5e-43
WP_001219053.1|501665_502376_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.7	1.3e-41
WP_000357928.1|502379_503042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361917.1|503555_504473_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000157137.1|504465_505239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766442.1|505818_507168_-	phospholipase	NA	NA	NA	NA	NA
WP_001193075.1|507286_509371_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_001180889.1|509381_511979_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_001095581.1|512155_515830_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_085948178.1|516047_517260_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000566901.1|520841_521444_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_023982161.1|521440_522043_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000168567.1|523446_524319_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001338066.1|524400_524523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991446.1|524530_525511_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	9.4e-102
WP_001044128.1|525575_526682_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001295734.1|526701_527418_-	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_000790592.1|528873_529476_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	1.5e-54
WP_000044711.1|529953_530550_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000695543.1|531030_531579_+	metal ABC transporter substrate-binding lipoprotein/fibrin-binding adhesin FimA	NA	NA	NA	NA	NA
WP_000824107.1|531643_532183_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000066557.1|532219_532945_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_085948178.1|535571_536785_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001244827.1|536971_537502_+	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000870592.1|537514_538018_+	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_000832227.1|538037_538940_+	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000558253.1|539189_540533_-	gluconate permease GntP	NA	NA	NA	NA	NA
539086:539106	attR	CCCTCACCCTAACCCTCTCCC	NA	NA	NA	NA
WP_000438591.1|540872_542057_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000208201.1|542137_543598_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.3e-50
WP_000833679.1|543812_544586_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000062565.1|544726_545557_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_120795393.1|546148_546232_+	iraD leader peptide	NA	NA	NA	NA	NA
WP_000986213.1|546228_546621_+	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_000340733.1|546613_547525_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000568417.1|547589_548762_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000211972.1|548774_549236_-	membrane protein	NA	NA	NA	NA	NA
WP_001295597.1|549232_549916_-	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_001151854.1|550165_550720_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
WP_001141203.1|550732_551911_-	MFS transporter	NA	NA	NA	NA	NA
WP_001298932.1|551978_552839_-	YjiK family protein	NA	NA	NA	NA	NA
WP_000657679.1|552903_553161_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_000222502.1|553157_553925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298930.1|553934_555086_-	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_001038277.1|555201_556482_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001137002.1|556522_557755_-	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_000181112.1|558221_559178_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.7e-60
WP_000199283.1|559422_560835_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000394274.1|561011_561176_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|561996_563209_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 4
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	955202	966089	5313278	integrase,transposase	Enterobacteria_phage(22.22%)	10	948794:948807	963403:963416
948794:948807	attL	AACAAATTGCCGCC	NA	NA	NA	NA
WP_000749863.1|955202_956258_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|956545_957649_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893251.1|957660_958914_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_000772642.1|959269_960484_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000251023.1|960626_961508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083330.1|961705_961903_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_001035842.1|961902_962334_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_001019379.1|962346_963180_+	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_085948178.1|963313_964526_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
963403:963416	attR	GGCGGCAATTTGTT	NA	NA	NA	NA
WP_000942525.1|965018_966089_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
>prophage 5
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	1179898	1287825	5313278	tRNA,transposase,head,tail,capsid,protease	Escherichia_phage(34.48%)	92	NA	NA
WP_000186631.1|1179898_1180378_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365177.1|1180581_1181376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342071.1|1181513_1181855_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000078269.1|1181968_1184473_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_000883048.1|1184734_1185667_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|1185669_1186962_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|1187086_1187494_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|1187494_1187953_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|1187949_1188867_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157532.1|1189012_1189690_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_001345010.1|1189676_1190459_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|1190521_1191376_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|1191436_1192246_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|1192235_1192859_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1192829_1193516_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561841.1|1193512_1195927_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001320180.1|1200548_1200809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|1202040_1203135_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1203203_1204130_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|1204359_1204842_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1204919_1205735_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001342079.1|1205824_1207606_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000943558.1|1207618_1208395_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1208494_1209373_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1209541_1210996_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|1211055_1212417_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|1212473_1213775_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001315307.1|1213796_1214942_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540946.1|1215070_1215856_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|1215866_1217102_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|1217123_1218173_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|1218489_1220157_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|1220166_1221426_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|1221436_1222252_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|1222248_1223142_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815554.1|1223278_1224346_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1224342_1224852_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|1224969_1225692_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|1225694_1226189_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|1226362_1227748_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|1227783_1228305_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1228412_1228625_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|1228626_1229493_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1229973_1230516_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|1230735_1231428_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001345007.1|1231458_1234068_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|1235119_1235635_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1235637_1236270_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001345004.1|1237480_1237813_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063245.1|1237868_1238894_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158868.1|1238935_1239331_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752958.1|1239342_1239642_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_085947772.1|1239662_1240875_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000985133.1|1240968_1241547_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683103.1|1241543_1241939_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_001342267.1|1241946_1242687_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|1242702_1243125_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|1243106_1243541_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_106898639.1|1243533_1245714_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.6	0.0e+00
WP_085948178.1|1245719_1246932_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153244794.1|1246898_1247045_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.4e-06
WP_000239881.1|1247002_1247671_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|1247727_1248033_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|1248216_1249701_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201824.1|1249887_1250841_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177454.1|1251353_1252115_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224569.1|1252297_1253188_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001345000.1|1253188_1256161_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383942.1|1256147_1258385_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|1258653_1259790_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001344803.1|1259916_1260240_-	sugar-binding protein	NA	NA	NA	NA	NA
WP_000333355.1|1260283_1260721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092528.1|1261025_1261391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289036.1|1261392_1266192_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	38.9	1.9e-17
WP_001160811.1|1266211_1266673_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103161.1|1266700_1268602_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.9e-27
WP_000253805.1|1269338_1270787_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770957.1|1270776_1271460_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	3.9e-30
WP_000074251.1|1271616_1272990_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709879.1|1273147_1273480_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000573931.1|1274731_1277875_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	3.2e-58
WP_000786320.1|1277976_1279353_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153146.1|1279420_1280668_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000351464.1|1280775_1281429_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|1281522_1281891_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682517.1|1281955_1282204_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130618.1|1282269_1283388_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956455.1|1283829_1283982_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000956465.1|1284332_1284485_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001369229.1|1284606_1285227_-	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
WP_106898640.1|1285401_1286646_-	TonB-dependent siderophore receptor	NA	A0A0N7BTS3	Escherichia_phage	96.0	3.6e-05
WP_085948178.1|1286611_1287825_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 6
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	1480637	1503827	5313278	integrase,transposase,head,tail,capsid	Enterobacteria_phage(56.52%)	24	1475230:1475246	1496140:1496156
1475230:1475246	attL	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_000263438.1|1480637_1481714_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
WP_000638251.1|1481727_1482138_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.2	1.1e-64
WP_085948178.1|1482121_1483335_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001254039.1|1483969_1485475_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256792.1|1485511_1485859_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|1485916_1486945_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|1486996_1487371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|1487363_1487717_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|1487731_1488307_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|1488303_1488699_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143011.1|1488706_1489459_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
WP_000479083.1|1489472_1489904_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533403.1|1489930_1490344_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_106888365.1|1490324_1492904_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.4	0.0e+00
WP_000847298.1|1492900_1493230_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000194798.1|1493937_1494681_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_159026291.1|1494626_1495256_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	98.6	6.6e-109
WP_000514984.1|1495496_1498973_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
1496140:1496156	attR	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_001230465.1|1499040_1499640_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
WP_000268900.1|1499704_1501018_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001023459.1|1501019_1501289_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|1501394_1502276_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_106898642.1|1502492_1503332_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	2.5e-151
WP_021351651.1|1503455_1503827_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
>prophage 7
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	1724940	1771017	5313278	transposase,protease,holin	Escherichia_phage(34.62%)	57	NA	NA
WP_000156528.1|1724940_1726701_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1726886_1727339_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1727414_1728455_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1728811_1729321_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001444487.1|1729593_1730169_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1730131_1732294_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1732303_1732750_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1732872_1734927_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1734958_1735417_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1735512_1736175_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1736347_1736761_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1736805_1737123_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|1737180_1738371_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1738465_1738744_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1738740_1739070_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1739160_1739820_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000273151.1|1741220_1741463_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001090200.1|1744090_1744282_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1744278_1744467_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1744998_1745373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1745384_1745537_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1745808_1746525_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1746574_1746790_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1746786_1747212_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1747283_1748354_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|1748394_1748817_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266135.1|1748813_1749110_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001209481.1|1749106_1749568_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1749545_1749902_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1749952_1750165_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1750250_1750415_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1750416_1750680_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1750690_1751560_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1751675_1751780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1751968_1752181_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_032280206.1|1752348_1752609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265133.1|1752628_1753678_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|1753690_1754062_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1754051_1754423_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1754574_1755393_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1755679_1755877_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1756014_1756728_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874357.1|1757495_1759346_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411814.1|1759793_1760000_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1760255_1760528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1760687_1761221_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675929.1|1761441_1761555_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_012816791.1|1761776_1761962_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1762488_1762803_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1762884_1763109_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_085948178.1|1763158_1764372_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_012817858.1|1764458_1765352_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1765797_1766181_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_001058323.1|1766798_1767917_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|1767913_1769707_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|1769725_1770433_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1770429_1771017_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	1993364	2061147	5313278	integrase,tail,transposase,tRNA,head,terminase,capsid,holin	Stx2-converting_phage(35.85%)	73	1988458:1988472	1994939:1994953
1988458:1988472	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074981.1|1993364_1994483_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
WP_000003742.1|1994451_1994721_-	excisionase	NA	NA	NA	NA	NA
WP_000048442.1|1994782_1997248_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1994939:1994953	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|1997340_1997532_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1997528_1997717_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122993436.1|1998056_1998197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1998200_1998419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447517.1|1998459_1998849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1999144_1999423_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1999424_1999616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|1999636_2000008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444689.1|2000105_2000408_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_000693943.1|2000404_2000830_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|2000852_2001815_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151120.1|2001855_2002278_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	1.3e-63
WP_000004322.1|2002274_2002529_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001002672.1|2002521_2002833_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_001204666.1|2003138_2003717_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156210.1|2003676_2004774_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_085948178.1|2005408_2006622_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072058819.1|2006659_2006800_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
WP_012817871.1|2006967_2007240_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|2007241_2008297_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|2008297_2008663_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|2008671_2009202_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2009443_2009641_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935544.1|2009791_2010850_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_000874287.1|2011646_2013497_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000411802.1|2013944_2014151_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|2014155_2014500_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|2014550_2015084_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|2015354_2015924_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2015923_2016070_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2016297_2016483_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2016907_2017135_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|2017176_2017542_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958415.1|2017832_2018396_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|2018392_2020054_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000172984.1|2020117_2022055_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|2022099_2022321_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|2025009_2025336_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2025345_2025696_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2025692_2026139_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2026135_2026480_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275472.1|2026546_2027263_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|2027268_2027643_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|2027738_2027948_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212932.1|2027999_2031242_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|2031234_2031576_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_001447444.1|2031575_2032274_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_001302649.1|2032290_2032611_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2032718_2032892_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_000967279.1|2033939_2034677_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_122996286.1|2034622_2035255_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514853.1|2035491_2038971_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
WP_001230459.1|2039037_2039637_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000268887.1|2039701_2041024_+|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
WP_001023356.1|2041025_2041295_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|2041401_2041491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2041510_2043859_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_000145590.1|2048018_2048597_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001301834.1|2048619_2048745_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2048824_2049100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938117.1|2049160_2050522_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_000799400.1|2050885_2051749_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|2051732_2052869_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|2053118_2054348_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|2054493_2055615_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|2055690_2057151_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|2057150_2057822_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2057989_2059360_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|2059363_2060005_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|2060040_2061147_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	2162363	2219049	5313278	holin,tail,transposase,terminase,protease,portal	Enterobacteria_phage(44.9%)	62	NA	NA
WP_000268365.1|2162363_2162912_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
WP_085948178.1|2164743_2165956_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000075578.1|2166020_2166557_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_072127369.1|2166589_2166871_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_001444682.1|2166867_2167164_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_001209477.1|2167160_2167622_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_000403788.1|2167599_2167956_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_000137950.1|2168051_2168423_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000610381.1|2168419_2168773_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000220602.1|2168978_2169278_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_001260976.1|2169283_2169541_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_001447497.1|2169676_2169955_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001344904.1|2169956_2171006_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_000904137.1|2171018_2171393_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762902.1|2171389_2172211_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|2172437_2172635_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483498.1|2172785_2173844_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000142980.1|2174438_2176385_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000143458.1|2176522_2176702_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290214.1|2176742_2176988_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_001072901.1|2177065_2177281_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001344902.1|2177284_2177530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159026290.1|2177555_2178693_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.0	8.8e-144
WP_085948178.1|2178699_2179912_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_106898646.1|2179896_2180295_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	79.6	1.7e-46
WP_000992150.1|2180331_2180865_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_012578895.1|2181383_2181569_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000373407.1|2182044_2182521_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|2182517_2184641_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|2184637_2184850_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974564.1|2184849_2186352_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2186296_2188321_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2188408_2188735_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2188727_2189009_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|2189011_2189635_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2189647_2190046_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2190053_2190806_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2190819_2191242_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|2191268_2191577_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918237.1|2191620_2194266_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|2194262_2194592_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001344666.1|2195299_2196043_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122996286.1|2195988_2196621_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514851.1|2196867_2200344_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_001230455.1|2200411_2201011_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279057.1|2201075_2202389_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_000692020.1|2203794_2204385_+	protein kinase	NA	NA	NA	NA	NA
WP_001079509.1|2205421_2205928_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2205973_2206474_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2206559_2206739_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|2207119_2207926_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|2207925_2209119_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001344826.1|2209130_2210489_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|2210492_2212088_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|2212087_2213650_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2213741_2213786_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|2213923_2214805_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2214801_2215422_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|2215522_2216395_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|2216434_2217025_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|2217021_2217780_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|2217999_2219049_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 10
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	2295590	2392652	5313278	integrase,tRNA,transposase,tail,head,terminase,capsid,holin	Escherichia_phage(41.38%)	115	2307409:2307427	2371251:2371269
WP_000628065.1|2295590_2296823_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2297077_2298061_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|2298538_2299912_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2300040_2300976_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|2301027_2302263_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|2302264_2302480_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|2302579_2302768_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|2302805_2302955_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|2303010_2303820_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|2303812_2306413_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|2306514_2306790_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2306864_2307035_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2307034_2307256_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
2307409:2307427	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_001312793.1|2307697_2308186_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2308182_2308338_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|2308348_2308528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|2308770_2309190_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|2309269_2309524_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|2309520_2309943_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|2310020_2310809_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|2310815_2311562_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|2311584_2312346_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|2312361_2312784_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|2312889_2313102_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|2313187_2313352_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|2313353_2313617_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|2313627_2313789_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|2313867_2314113_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|2314544_2315696_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_047086260.1|2315663_2316653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|2316652_2318044_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|2318543_2319143_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|2319142_2319433_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|2319429_2319984_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|2320545_2320977_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143077.1|2321547_2323401_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000284522.1|2323550_2323766_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|2323770_2324115_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992086.1|2324165_2324699_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_001344811.1|2324972_2325512_+	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
WP_085948178.1|2325514_2326728_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000285960.1|2326804_2326981_+	phage antirepressor	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
WP_001280923.1|2327075_2327207_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|2327429_2327615_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|2328015_2328342_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|2328473_2328674_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|2328715_2329081_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|2329370_2329934_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|2329930_2331592_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173011.1|2331655_2333593_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063099.1|2333637_2333859_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125984.1|2336223_2336550_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|2336559_2336910_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|2336906_2337353_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|2337349_2337694_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275467.1|2337762_2338479_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	4.7e-127
WP_001030041.1|2338484_2338859_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
WP_001453698.1|2338954_2339164_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000937595.1|2341272_2342460_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|2342459_2342825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001369428.1|2342843_2344286_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
WP_000807940.1|2344278_2344620_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001369426.1|2344619_2345318_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_001369422.1|2345323_2346067_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_096860308.1|2346012_2346645_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_000514717.1|2346987_2350461_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.2	0.0e+00
WP_001228290.1|2350528_2351128_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000216548.1|2351279_2352584_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
WP_001023476.1|2352585_2352855_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_106409364.1|2353969_2354092_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2354198_2355110_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_085948178.1|2355656_2356870_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303943.1|2357896_2358175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2358602_2358749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2358885_2359533_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144879.1|2359716_2360307_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001261191.1|2362812_2363166_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000171274.1|2363256_2363976_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|2364015_2364414_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|2364518_2365058_-	septation protein A	NA	NA	NA	NA	NA
WP_000028540.1|2365087_2365831_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|2366187_2366826_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|2366871_2368002_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2367979_2368228_-	excisionase	NA	NA	NA	NA	NA
WP_000048484.1|2368292_2370764_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000199480.1|2370859_2371048_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|2371044_2371233_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|2371632_2371800_+	hypothetical protein	NA	NA	NA	NA	NA
2371251:2371269	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
WP_000920491.1|2371793_2372027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2372004_2372412_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171894.1|2372434_2372653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2372725_2373025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2373289_2373697_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000705622.1|2373983_2374535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2374506_2375547_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2375458_2376001_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450683.1|2376034_2376769_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001505071.1|2376765_2376930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2377628_2378387_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|2378665_2378878_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|2379098_2379356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032178572.1|2379425_2379704_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001265289.1|2379705_2380761_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|2380761_2381127_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|2381123_2381813_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_106898647.1|2383337_2385122_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
WP_085948178.1|2385147_2386360_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_064764776.1|2386326_2386449_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	86.1	4.3e-09
WP_001023452.1|2386450_2386720_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2386860_2387736_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121225.1|2387960_2388611_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_096245710.1|2389206_2389521_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|2389580_2390864_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|2390952_2392413_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|2392448_2392652_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 11
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	2531871	2652207	5313278	lysis,integrase,terminase,holin,transposase,head,tail,capsid,protease,portal	Stx2-converting_phage(40.38%)	113	2612064:2612080	2647436:2647452
WP_000826406.1|2531871_2533080_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_001261013.1|2533606_2534275_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|2534577_2535171_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|2535167_2536160_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001315480.1|2536351_2537263_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140877.1|2537257_2537794_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2537856_2538081_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|2538220_2539876_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013783.1|2540100_2541444_-	VOC family protein	NA	NA	NA	NA	NA
WP_001345051.1|2541660_2542584_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098530.1|2542621_2544262_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2544660_2544810_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2544881_2545055_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|2545299_2545830_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048669.1|2546018_2547020_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2548560_2549361_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139621.1|2549632_2553535_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|2553735_2554341_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|2554391_2555708_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431813.1|2555697_2557455_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890909.1|2557470_2558367_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177525.1|2558366_2558972_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000477179.1|2559142_2561449_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|2561512_2562373_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123455.1|2562603_2563194_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000041176.1|2563175_2564126_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|2564226_2565540_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|2565566_2566772_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2566771_2567194_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|2567183_2568611_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969777.1|2568612_2569401_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2569400_2570168_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206377.1|2570164_2571235_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|2571242_2571740_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|2571754_2572501_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2572509_2572797_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|2572808_2573738_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|2574022_2576068_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535449.1|2576315_2578589_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001067510.1|2580368_2581274_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001341369.1|2581445_2581772_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|2581779_2581965_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900925.1|2581961_2584601_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2584808_2585798_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|2585908_2586331_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2586327_2586594_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628171.1|2586867_2590392_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837930.1|2590758_2591892_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
WP_001295593.1|2592032_2592467_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2593047_2593689_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2593770_2594400_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2594472_2595048_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2595160_2595430_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268964.1|2595431_2596745_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2596809_2597409_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2597479_2600977_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_106898648.1|2601110_2601638_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.4e-59
WP_064732755.1|2601828_2602461_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2602406_2603150_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_012817879.1|2603160_2603859_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_000807964.1|2603858_2604200_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212770.1|2604192_2607435_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
WP_001453698.1|2607486_2607696_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2607791_2608166_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275445.1|2608171_2608888_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	95.8	3.7e-124
WP_000133393.1|2608954_2609299_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2609295_2609742_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2609738_2610089_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2610098_2610425_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_106898649.1|2610427_2613007_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.4	0.0e+00
2612064:2612080	attL	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001063025.1|2612952_2613174_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2613218_2615156_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001369319.1|2615219_2616881_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000958415.1|2616877_2617441_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_000279803.1|2617731_2618097_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000095736.1|2618138_2618366_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|2618734_2618959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2619044_2619230_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992122.1|2619747_2620281_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|2620331_2620676_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411811.1|2620680_2620887_-|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000143036.1|2621332_2623183_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001344632.1|2623629_2623761_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_085948178.1|2624016_2625229_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000476993.1|2625448_2625676_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2625753_2626161_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|2626353_2626506_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001344637.1|2626517_2626883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|2626851_2627139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2627554_2627743_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|2627739_2627931_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048302.1|2628024_2630496_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001296941.1|2630583_2630820_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876990.1|2630854_2632135_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001360138.1|2632154_2632265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|2632322_2633342_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|2633353_2634568_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2634773_2635100_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2635234_2635576_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2635610_2636171_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2636173_2636884_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|2636991_2637297_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001342196.1|2639980_2642404_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|2642414_2643032_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|2643033_2643888_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2643930_2644545_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071526378.1|2644703_2645996_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|2645948_2646644_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|2646768_2647989_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
2647436:2647452	attR	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001019545.1|2648123_2649017_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|2649123_2650377_+	MFS transporter	NA	NA	NA	NA	NA
WP_000233090.1|2651202_2651286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260840.1|2651385_2652207_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 12
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	2775686	2814102	5313278	plate,holin,tail,transposase,tRNA,head,terminase,capsid,portal	Enterobacteria_phage(86.11%)	44	NA	NA
WP_100206497.1|2775686_2775965_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
WP_000159459.1|2775975_2776254_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000514277.1|2776265_2776508_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_085948178.1|2776572_2777786_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000686506.1|2779358_2780318_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000211267.1|2780322_2780634_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000236489.1|2781830_2782355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087824.1|2782369_2783416_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000613748.1|2783415_2785167_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_001262673.1|2785321_2786158_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|2786181_2787234_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632344.1|2787279_2788080_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|2788182_2788677_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|2788676_2788877_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2788879_2789203_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2789199_2789592_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780569.1|2789588_2789996_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920593.1|2790133_2790601_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356341.1|2790593_2791229_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271894.1|2791225_2791807_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|2791803_2792154_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111942.1|2792157_2793054_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071739.1|2793046_2793577_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108519.1|2793579_2795712_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000144026.1|2795711_2796290_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000954196.1|2796333_2796906_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979957.1|2797062_2797551_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000853433.1|2797563_2800371_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000333503.1|2800357_2800513_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651581.1|2800521_2800896_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000290445.1|2800951_2801464_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
WP_000005431.1|2801463_2802648_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000132811.1|2802805_2803915_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_001035742.1|2804140_2805643_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|2805886_2806147_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|2806337_2806478_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|2806784_2807084_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672378.1|2807088_2809476_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018594.1|2809490_2810474_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2810757_2810802_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2810924_2811281_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2811333_2811531_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2811627_2812170_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|2812173_2814102_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 13
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	3028227	3124129	5313278	integrase,terminase,holin,transposase,head,tail,capsid,portal	Escherichia_phage(36.92%)	111	3121281:3121340	3133855:3133955
WP_106898651.1|3028227_3029440_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000287769.1|3029556_3029967_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_001015023.1|3029966_3030332_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_001245704.1|3030409_3031897_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001344676.1|3031930_3032344_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118907.1|3032530_3033736_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790498.1|3033732_3033966_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000334609.1|3034072_3034744_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_000826461.1|3034783_3035992_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.9e-209
WP_000879833.1|3037383_3038181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734033.1|3038190_3038742_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|3038910_3039243_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|3039576_3039891_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994449.1|3040104_3041763_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|3041755_3042751_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|3042743_3043430_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213292.1|3043429_3044803_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|3044821_3045265_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620091.1|3045261_3046389_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133124.1|3046493_3046958_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|3046962_3047967_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|3047963_3048377_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|3048379_3048745_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|3048744_3049482_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|3049491_3049761_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942326.1|3049768_3050554_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103994.1|3050843_3051467_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|3051510_3051753_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|3051861_3052089_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949111.1|3052386_3053202_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001377491.1|3053198_3054893_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009309.1|3055063_3055246_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|3055324_3056242_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|3056414_3057335_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|3057323_3057794_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|3057774_3059193_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365565.1|3059259_3059955_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|3059994_3060360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824375.1|3060926_3062090_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_000218214.1|3062680_3063532_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826738.1|3063639_3064998_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|3064997_3065669_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920136.1|3065801_3066215_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|3066323_3067328_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240109.1|3067328_3067964_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_122993428.1|3068199_3068871_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|3069213_3069744_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_122993429.1|3070978_3071992_-	peptidase M85	NA	NA	NA	NA	NA
WP_106898652.1|3072667_3073981_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	5.7e-78
WP_001230459.1|3074045_3074645_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_122996286.1|3078433_3079066_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|3079011_3079755_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|3079760_3080459_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|3080458_3080788_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081781.1|3080784_3083397_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000533440.1|3083377_3083791_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|3083817_3084240_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|3084253_3085006_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683079.1|3085013_3085409_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|3085405_3085939_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|3085954_3086308_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|3086300_3086684_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|3086735_3087764_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|3087821_3088169_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|3088205_3089711_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001369121.1|3089700_3091293_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|3091289_3091496_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001426431.1|3091479_3093408_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_001426432.1|3093379_3093886_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
WP_001444498.1|3094312_3094537_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001302717.1|3094618_3094933_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012817896.1|3095460_3095646_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001092858.1|3096163_3096697_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000284516.1|3097259_3097475_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|3097551_3097824_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|3097864_3098044_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000023159.1|3098181_3100119_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_153244796.1|3100104_3100248_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_000466957.1|3100597_3101029_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000422741.1|3101116_3101542_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3101538_3101889_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080194.1|3101919_3103533_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000301789.1|3104018_3104732_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|3104866_3105064_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640033.1|3105287_3105842_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_001217447.1|3105850_3106210_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|3106222_3107272_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|3107273_3107546_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3107667_3108012_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3108131_3108344_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3108577_3109135_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3109136_3109355_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|3109482_3109794_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|3109786_3110014_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3110010_3110292_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|3110324_3111041_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|3111062_3111809_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_001262366.1|3111815_3112886_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693883.1|3112957_3113383_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|3113366_3113648_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|3113747_3114167_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|3114433_3114586_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|3114597_3115236_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133034.1|3115236_3115446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3116016_3116205_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3116201_3116393_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106898673.1|3116953_3118167_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001300307.1|3120406_3121204_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
3121281:3121340	attL	TAATATGCGCCCCGTTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTT	NA	NA	NA	NA
WP_001345280.1|3121559_3122834_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
WP_096950631.1|3122821_3122950_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.0	2.8e-06
WP_106898653.1|3122915_3124129_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	8.4e-169
3133855:3133955	attR	TAATATGCGCCCCGTTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAA	NA	NA	NA	NA
>prophage 14
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	3345201	3414080	5313278	integrase,transposase,terminase,capsid,protease,holin	Enterobacteria_phage(20.69%)	62	3383144:3383179	3415020:3415055
WP_000101907.1|3345201_3346443_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000387403.1|3346939_3347146_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001345228.1|3347100_3348909_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	41.1	2.9e-08
WP_023981888.1|3349124_3349364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|3349336_3349570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205000.1|3349562_3349796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|3349801_3350101_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|3350097_3351498_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|3351699_3351945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|3352075_3352270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|3352273_3352435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229488.1|3352562_3353051_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001369202.1|3353213_3354137_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001113637.1|3357514_3358162_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211568.1|3358196_3359249_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000824439.1|3359245_3359803_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|3359799_3361743_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|3361739_3362219_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|3362215_3362425_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|3362421_3363159_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971722.1|3363200_3363863_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|3363859_3364477_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|3364495_3365098_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835176.1|3365107_3365557_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013506.1|3365553_3366417_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|3366403_3367099_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|3367105_3369592_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|3369588_3369852_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|3369841_3370336_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|3370744_3371233_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758043.1|3371381_3373028_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|3373245_3374889_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|3374964_3375615_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|3375614_3376679_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|3376752_3377808_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|3377919_3379011_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249151.1|3379749_3382422_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|3382438_3383089_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
3383144:3383179	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000876032.1|3383288_3386138_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|3386412_3387189_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|3387193_3388843_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_122993426.1|3388843_3393238_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025665.1|3394039_3395362_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_072145794.1|3396055_3396712_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.5e-34
WP_000881317.1|3396608_3397193_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.1	1.4e-84
WP_085948178.1|3397603_3398817_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000075144.1|3399089_3399587_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|3399586_3399802_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3399944_3400343_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3400423_3400582_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001235460.1|3401674_3402298_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|3402294_3402960_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|3402956_3403559_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|3403533_3404100_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_042352449.1|3404635_3405568_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001345214.1|3405606_3406434_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_001254228.1|3406937_3407120_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001281192.1|3407276_3407621_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|3407726_3407945_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|3407922_3408993_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_000012296.1|3409615_3411304_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|3411452_3414080_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
3415020:3415055	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 15
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	3502754	3596420	5313278	lysis,integrase,terminase,holin,tRNA,transposase,bacteriocin,tail,capsid,protease,portal	Escherichia_phage(53.16%)	105	3534306:3534330	3596615:3596639
WP_001283576.1|3502754_3503567_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3503566_3504580_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|3504645_3505782_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|3505880_3506876_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|3506872_3508051_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|3508334_3509555_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683806.1|3509713_3511720_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3511840_3512119_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|3512152_3512701_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|3512700_3513510_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043815.1|3513509_3514334_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|3514337_3515423_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|3515457_3516390_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|3516555_3517107_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|3517179_3518031_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|3518032_3518572_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|3518568_3519057_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|3519053_3519563_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482748.1|3519578_3520331_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112824.1|3520350_3522996_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|3523077_3523641_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3524324_3524810_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426169.1|3525012_3527157_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|3527156_3528467_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_106898655.1|3528646_3528931_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|3529302_3530643_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|3531009_3532068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3532249_3533005_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3533298_3534231_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3534306:3534330	attL	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_000012450.1|3542872_3544138_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3544148_3544400_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_085948178.1|3544628_3545842_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000509481.1|3546171_3546828_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3546921_3547323_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3547379_3547520_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835359.1|3547752_3548487_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	99.6	2.2e-135
WP_001301884.1|3548577_3549195_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3549200_3549479_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3549493_3550762_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|3550758_3552384_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|3552678_3552867_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3553006_3553276_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_024183271.1|3553277_3555314_-|tail	tail fiber protein	tail	A0A0P0ZD90	Stx2-converting_phage	100.0	9.4e-88
WP_000207923.1|3555310_3555961_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|3555960_3556524_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3556507_3556969_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3557018_3557408_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3557463_3558678_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3558701_3559709_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3559866_3562011_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3562010_3563717_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3563697_3564504_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3564559_3564763_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3564912_3565206_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|3565237_3565702_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|3565709_3565859_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|3565858_3566428_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|3566702_3567236_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|3567240_3567456_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3567532_3567805_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3567845_3568025_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106898657.1|3568159_3570097_-	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.2	0.0e+00
WP_000738068.1|3570582_3570852_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3570863_3571823_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204880.1|3572604_3573039_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3573031_3573226_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|3573222_3573828_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004009.1|3573827_3574550_-	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	100.0	1.3e-129
WP_000211423.1|3574624_3575359_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	99.6	5.5e-123
WP_001254256.1|3575633_3575816_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153270.1|3575812_3576340_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001304104.1|3576336_3576783_-	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_001281772.1|3576739_3576976_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_085948178.1|3577165_3578379_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000818843.1|3578659_3578866_-	hypothetical protein	NA	G9L683	Escherichia_phage	100.0	2.7e-27
WP_001036031.1|3578938_3579208_-	hypothetical protein	NA	Q08J36	Stx2-converting_phage	100.0	4.9e-45
WP_000131492.1|3579207_3580644_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_000065668.1|3580633_3581533_-	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_000166207.1|3581525_3581672_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438528.1|3581704_3582001_-	hypothetical protein	NA	Q08J40	Stx2-converting_phage	100.0	5.2e-48
WP_001180318.1|3582139_3582367_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3582445_3583153_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|3583213_3583555_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221211.1|3583622_3584084_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|3584077_3585124_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000198445.1|3585780_3586164_+	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000167595.1|3586222_3586693_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001198861.1|3586883_3587048_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|3587016_3587160_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|3587235_3587532_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|3587537_3588323_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186866.1|3588319_3589000_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682304.1|3588996_3589179_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000548528.1|3589151_3589343_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001447688.1|3589353_3589635_+	hypothetical protein	NA	Q08J56	Stx2-converting_phage	100.0	6.5e-48
WP_000763383.1|3589733_3589955_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289935.1|3589951_3590725_+	ead/Ea22-like family protein	NA	Q08J58	Stx2-converting_phage	100.0	1.0e-143
WP_000797281.1|3590876_3591065_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951706.1|3591066_3591276_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000203836.1|3592743_3593367_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000669287.1|3593409_3593577_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_106898674.1|3594443_3594602_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	98.1	1.1e-20
WP_000994801.1|3594637_3595006_+	DUF1627 domain-containing protein	NA	A0A0P0ZCA9	Stx2-converting_phage	100.0	8.8e-53
WP_000453637.1|3595084_3595267_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3595250_3596420_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
3596615:3596639	attR	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 16
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	3826107	3938983	5313278	terminase,tRNA,transposase,tail,protease,portal	Enterobacteria_phage(54.0%)	106	NA	NA
WP_001298974.1|3826107_3826845_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3826976_3828311_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3828520_3829402_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3829505_3830093_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3830148_3830532_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3830835_3831525_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3831572_3832610_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3832816_3833236_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3833304_3834003_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3834034_3836695_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3836808_3838164_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3838209_3838533_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3838529_3839828_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3845680_3848254_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3848383_3849115_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3849111_3850092_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3850226_3850964_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3851234_3851576_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3851679_3851727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3851825_3852986_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225214.1|3853028_3854150_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3854160_3855231_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3855440_3855806_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3855955_3856474_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|3856463_3857690_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589821.1|3857705_3858188_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3858264_3858612_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264774.1|3858653_3859421_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3859451_3860000_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3860018_3860267_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3860515_3861877_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3862043_3862835_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3862855_3864142_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3864196_3864790_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3864912_3865791_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3865876_3867538_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3867686_3868028_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3868089_3868380_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3868369_3868846_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3868977_3869460_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217540.1|3870308_3870557_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023452.1|3870924_3871194_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_106898659.1|3871195_3872509_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	1.5e-78
WP_001230459.1|3872573_3873173_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_106898660.1|3873239_3876716_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.7	0.0e+00
WP_122996286.1|3876962_3877595_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|3877540_3878284_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|3878289_3878988_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|3878987_3879317_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918236.1|3879313_3881959_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000532073.1|3882002_3882311_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|3882337_3882760_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|3882773_3883526_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_001444799.1|3883533_3883824_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.0	2.1e-49
WP_085948178.1|3883878_3885091_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000682711.1|3885094_3885241_-	hypothetical protein	NA	Q687G0	Enterobacteria_phage	100.0	3.5e-21
WP_106898661.1|3885253_3885877_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.5	2.0e-105
WP_001281348.1|3885879_3886161_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|3886153_3886480_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|3886567_3888592_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|3888536_3890039_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102413.1|3890038_3890251_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|3890247_3892371_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|3892367_3892844_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|3893318_3893504_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000752026.1|3894507_3894777_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3894786_3895734_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|3896240_3896675_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|3896667_3896862_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|3896858_3897464_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_085948178.1|3898207_3899421_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000214990.1|3900981_3902730_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_001426837.1|3902731_3904450_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
WP_000993087.1|3906010_3906988_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000271938.1|3907007_3908276_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000772858.1|3908298_3909747_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001087606.1|3909760_3911041_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001344737.1|3911351_3912752_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|3912772_3913435_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|3913435_3913885_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000508177.1|3913968_3914127_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000137280.1|3914309_3914609_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001229468.1|3914618_3915143_+	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000115383.1|3915189_3915594_-	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000492649.1|3916261_3916711_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000281320.1|3916747_3917092_-	YgaC family protein	NA	NA	NA	NA	NA
WP_001295174.1|3917243_3917573_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_001223219.1|3917820_3918066_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	4.1e-06
WP_000080947.1|3918062_3918473_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246506.1|3918445_3920590_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	9.3e-195
WP_000777939.1|3920599_3921559_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000985494.1|3921913_3923116_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000774994.1|3923108_3924173_+	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_001216521.1|3924230_3925223_+	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000165722.1|3925414_3926599_+	MFS transporter	NA	NA	NA	NA	NA
WP_000445658.1|3926722_3927460_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000119771.1|3927449_3927785_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000378442.1|3927875_3928406_+	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_001295175.1|3928532_3929705_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_001295176.1|3929721_3931260_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001130207.1|3931323_3931839_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000611802.1|3931988_3933545_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001287457.1|3933617_3934046_-	DedA family protein	NA	NA	NA	NA	NA
WP_000273309.1|3934042_3934609_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000906486.1|3935932_3936118_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|3936352_3938983_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
>prophage 17
NZ_CP027221	Escherichia coli strain 2015C-3101 chromosome, complete genome	5313278	3975978	3983118	5313278		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3975978_3978540_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3978645_3979302_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|3979352_3980120_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3980315_3981224_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590389.1|3981220_3982483_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|3982479_3983118_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP027223	Escherichia coli strain 2015C-3101 plasmid unnamed2	72543	0	7549	72543	head,holin,tail	Escherichia_phage(57.14%)	8	NA	NA
WP_106898678.1|0_947_-|head	internal head protein	head	A0A1B0V7H1	Salmonella_phage	94.0	3.1e-158
WP_001345482.1|948_1551_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580776.1|1537_1981_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|1977_2307_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_024177048.1|2197_2572_+	hypothetical protein	NA	A0A077SL44	Escherichia_phage	63.1	1.0e-24
WP_122993347.1|3060_3633_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_106898679.1|3676_4255_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
WP_001286326.1|7114_7549_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
>prophage 2
NZ_CP027223	Escherichia coli strain 2015C-3101 plasmid unnamed2	72543	13704	35014	72543		Escherichia_phage(50.0%)	25	NA	NA
WP_001697757.1|13704_14586_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.3	1.1e-173
WP_000523978.1|14600_15212_-	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
WP_072101257.1|15222_15468_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	3.4e-37
WP_106898680.1|15497_15788_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	1.1e-39
WP_000846124.1|15846_16116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120526.1|16374_17049_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	94.0	6.8e-19
WP_016231365.1|17449_17671_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.3	8.1e-38
WP_000743174.1|17667_18711_+	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	93.4	1.1e-172
WP_001187871.1|18875_19676_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_106898681.1|19705_20551_+	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	98.9	3.8e-152
WP_001426344.1|20601_20847_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001313475.1|21028_21184_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_001339188.1|21300_21555_-	hypothetical protein	NA	Q71TM5	Escherichia_phage	98.8	5.9e-40
WP_000041774.1|22436_23252_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_000085155.1|23261_24851_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.2	6.2e-305
WP_000067713.1|24911_26618_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000038868.1|26842_27844_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	3.7e-178
WP_000888906.1|30330_31215_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
WP_001281116.1|31548_31941_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_000336812.1|31952_32093_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000007769.1|32118_32541_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000890203.1|32580_33369_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_001369296.1|33377_33557_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_001177859.1|33831_34116_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000472523.1|34108_35014_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	5.9e-159
>prophage 3
NZ_CP027223	Escherichia coli strain 2015C-3101 plasmid unnamed2	72543	40306	72187	72543	transposase,terminase	Escherichia_phage(75.61%)	43	NA	NA
WP_000751806.1|40306_41134_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	99.6	2.8e-131
WP_001276599.1|41517_42882_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_001198661.1|42881_43880_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	98.8	9.0e-193
WP_000245706.1|44259_44481_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	82.2	2.1e-30
WP_000535208.1|45581_46214_-	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_085948178.1|46862_48075_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000602717.1|48536_49322_-	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000896801.1|49308_50037_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_000235786.1|51268_51646_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840930.1|51792_52038_+	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_024224109.1|52040_52619_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	92.2	9.8e-99
WP_001561105.1|52685_52841_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	98.0	2.0e-19
WP_000484116.1|53342_53969_+	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
WP_032353941.1|53965_54643_+	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	98.2	1.0e-131
WP_032271828.1|54639_55341_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	98.3	1.1e-141
WP_023442324.1|55642_56905_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	1.7e-233
WP_000021755.1|56977_57484_+	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
WP_000675643.1|57678_58260_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	100.0	2.0e-112
WP_023442323.1|58252_58519_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	98.8	4.5e-43
WP_023442322.1|58505_59207_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.8	7.0e-51
WP_001018057.1|59203_59494_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_000403776.1|60160_60520_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	8.0e-59
WP_000935430.1|60565_60778_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	2.2e-32
WP_000797281.1|60840_61029_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951706.1|61030_61240_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_032271829.1|61236_62067_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	78.2	1.3e-125
WP_024224112.1|62063_62324_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	96.5	9.3e-41
WP_000516537.1|62409_62643_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_000269004.1|62821_63115_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
WP_024224113.1|63121_63496_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.0	7.0e-66
WP_000057453.1|63477_64128_+	hypothetical protein	NA	A0A077SK55	Escherichia_phage	94.5	2.1e-97
WP_001408981.1|64400_64661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024224114.1|64976_65228_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	97.6	1.4e-38
WP_052921651.1|65234_65807_-	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	96.8	6.9e-105
WP_024224146.1|65982_66372_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	98.4	4.1e-69
WP_001216044.1|66666_67047_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.8e-62
WP_024224144.1|67051_67231_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	2.3e-22
WP_023442316.1|67258_68302_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.1	4.8e-205
WP_001326849.1|68390_68843_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_106898683.1|68928_70122_+|terminase	terminase	terminase	A0A077SL59	Escherichia_phage	99.5	2.3e-179
WP_000124159.1|70121_71606_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_071527722.1|71827_71947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001361625.1|71965_72187_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	81.2	6.0e-25
