The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	537694	600274	5500189	transposase	Enterobacteria_phage(33.33%)	44	NA	NA
WP_085948186.1|537694_538851_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001290252.1|539765_540335_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839281.1|540431_540629_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000777552.1|540640_541129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854753.1|541125_541500_-	toxin	NA	NA	NA	NA	NA
WP_001280948.1|541589_541958_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692311.1|542120_542342_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001186726.1|542404_542881_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849571.1|542896_543382_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	1.5e-12
WP_001234620.1|543436_544255_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_001119729.1|544354_544588_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_064758448.1|544666_545038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948135.1|545075_546288_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	96.6	1.3e-164
WP_001443552.1|546510_549027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106919082.1|549147_552267_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069684.1|552594_553467_-	GTPase family protein	NA	NA	NA	NA	NA
WP_106919083.1|553593_554807_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.0	1.9e-165
WP_000804452.1|557810_558413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323667.1|558499_558778_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071529669.1|559457_559607_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221499.1|560425_560995_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271016.1|561253_561655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221627.1|561642_562077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162123.1|563463_564621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170153.1|565335_566529_-	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_000781202.1|566543_567188_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000196044.1|567196_567898_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000131689.1|567913_568942_-	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000194235.1|568953_570312_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000024636.1|570438_571347_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000950651.1|572849_573242_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001378234.1|573248_575279_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.5	6.0e-34
WP_000611256.1|575275_575494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336097.1|575538_575898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336096.1|575870_576383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000009491.1|576382_576886_+	CdiI family contact-dependent growth inhibition immunity protein	NA	NA	NA	NA	NA
WP_000173339.1|577381_577552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000177055.1|578867_579125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099561176.1|579406_580619_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	5.1e-166
WP_001239076.1|581474_591146_-	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_000609742.1|593023_593698_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953025.1|593746_594736_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
WP_001121622.1|595342_596992_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_001368704.1|598654_600274_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	984701	1071730	5500189	protease,tRNA,head,terminase,lysis,integrase,transposase,tail,holin,portal,capsid,plate	Shigella_phage(36.84%)	93	973548:973562	998513:998527
973548:973562	attL	GACATTTCCCGCGCC	NA	NA	NA	NA
WP_085948138.1|984701_985915_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	2.2e-169
WP_000448925.1|986430_986847_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001443684.1|986885_988115_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.8	9.9e-234
WP_001368821.1|988402_989014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039225.1|989067_989481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211299.1|989473_990325_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	35.9	1.8e-32
WP_000531803.1|990575_991751_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.1	1.7e-145
WP_001331174.1|991711_991918_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|991977_992193_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001242757.1|992189_992552_-	phage protein	NA	K7PH61	Enterobacteria_phage	96.7	1.5e-65
WP_000008249.1|992542_993079_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_000081268.1|993207_994032_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	3.0e-149
WP_000135680.1|994096_994459_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000917896.1|995059_995356_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000450735.1|995541_996168_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|996265_996466_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|996503_997055_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|997230_997410_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104952.1|997399_998341_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.0	2.1e-143
WP_001368817.1|998337_998832_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	3.6e-86
998513:998527	attR	GACATTTCCCGCGCC	NA	NA	NA	NA
WP_000066918.1|998831_999485_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_000210173.1|999481_999808_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.0e-53
WP_001061415.1|1000215_1001013_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	4.9e-149
WP_099561176.1|1001852_1003066_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	5.1e-166
WP_001205470.1|1003340_1003697_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|1003676_1004891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|1004893_1006069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120496.1|1006360_1006687_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001197770.1|1006690_1007167_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	1.5e-84
WP_001368703.1|1007163_1007601_+|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	97.2	4.2e-70
WP_000099430.1|1008030_1008282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135093.1|1008494_1008845_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	7.5e-62
WP_000929185.1|1008970_1009465_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	3.3e-87
WP_122993517.1|1009698_1011195_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.2	2.8e-299
WP_000605604.1|1011206_1011389_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_000466246.1|1011388_1012630_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
WP_001193631.1|1012607_1013258_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257507.1|1013272_1014478_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_000601365.1|1014527_1014728_+	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000927710.1|1014730_1015054_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
WP_000702402.1|1015050_1015461_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	98.5	9.1e-75
WP_000213500.1|1015435_1015942_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	6.5e-91
WP_000779281.1|1015938_1016499_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	5.2e-105
WP_000497748.1|1016507_1016678_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000155690.1|1016661_1018158_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.6	6.5e-272
WP_000090995.1|1018157_1018514_+	hypothetical protein	NA	U5P076	Shigella_phage	98.3	5.9e-62
WP_000661054.1|1018513_1018783_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807177.1|1018924_1020760_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	1.7e-306
WP_042854271.1|1020820_1022149_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	5.5e-246
WP_000999510.1|1022145_1023225_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_001259120.1|1023224_1023773_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	1.5e-96
WP_000424737.1|1023772_1024198_+	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_000785312.1|1024184_1025243_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.4	8.6e-202
WP_000383559.1|1025233_1025818_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_000905003.1|1027966_1028521_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.8	2.8e-87
WP_000355481.1|1028578_1029352_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.9	1.9e-36
WP_001288444.1|1029758_1031192_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_072097749.1|1031226_1032441_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	1.0e-33
WP_000162574.1|1033246_1033729_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|1033860_1034337_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1034326_1034617_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1034678_1035020_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1035168_1036830_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1036915_1037794_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001300112.1|1037916_1038507_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287917.1|1038541_1039147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723175.1|1039269_1040556_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1040576_1041368_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1041534_1042896_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1043032_1043281_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1043299_1043848_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1043878_1044646_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1044687_1045035_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1045111_1045594_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1045609_1046836_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1046825_1047344_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1047493_1047859_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168044.1|1048068_1049139_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|1049149_1050271_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200118.1|1050313_1051474_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1051572_1051620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1051723_1052065_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1052335_1053073_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|1053207_1054188_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_042854265.1|1054184_1054916_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1055045_1057619_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|1063474_1064773_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1064769_1065093_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1065138_1066494_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082969.1|1066607_1069268_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001298975.1|1069299_1069998_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1070066_1070486_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1070692_1071730_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	1331762	1379536	5500189	protease,holin,head,terminase,integrase,tail,transposase,tRNA,portal,capsid,plate	Enterobacteria_phage(83.33%)	61	1336333:1336356	1383352:1383375
WP_000399680.1|1331762_1332743_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000683799.1|1332913_1334920_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1335078_1336299_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
1336333:1336356	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_000127749.1|1336582_1337761_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|1337757_1338753_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_001504485.1|1339021_1339915_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001173929.1|1339919_1340252_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078920.1|1340514_1340655_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|1340845_1341106_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_040072014.1|1341148_1342258_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.9	1.5e-204
WP_089578840.1|1342415_1343600_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
WP_050869436.1|1343599_1344112_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	96.5	1.6e-89
WP_000651572.1|1344167_1344542_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|1344550_1344706_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_106919087.1|1344692_1347500_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.8	0.0e+00
WP_000979954.1|1347512_1348001_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000905059.1|1348027_1348627_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.4	1.9e-97
WP_064758449.1|1348752_1349595_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	60.6	1.3e-38
WP_032164659.1|1349596_1350124_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	85.7	2.9e-81
WP_050869525.1|1350152_1350686_-|tail	tail fiber assembly protein	tail	A0A222YXY8	Escherichia_phage	97.7	4.6e-95
WP_106919088.1|1350688_1352785_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	57.4	2.7e-191
WP_000071720.1|1352787_1353318_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111955.1|1353310_1354207_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
WP_000213444.1|1354210_1354561_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271907.1|1354557_1355139_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.4	8.0e-101
WP_000356339.1|1355135_1355771_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920594.1|1355763_1356231_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_050869447.1|1356368_1356776_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	92.6	2.5e-61
WP_000072327.1|1356772_1357165_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1357161_1357485_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864912.1|1357487_1357688_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	3.0e-31
WP_050869446.1|1357687_1358182_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000632321.1|1358283_1359084_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	9.3e-132
WP_001055125.1|1359129_1360182_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	93.7	2.7e-187
WP_001262636.1|1360205_1361042_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.2	3.3e-148
WP_032083489.1|1361196_1362948_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_000087812.1|1362947_1363994_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_050869482.1|1364484_1365024_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	62.2	2.6e-21
WP_050009785.1|1365020_1365545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001603069.1|1365605_1365917_-	phage stability/partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	3.2e-48
WP_000686484.1|1365921_1366881_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
WP_050869483.1|1366957_1369780_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.1	0.0e+00
WP_000599382.1|1369786_1370152_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_106919089.1|1370148_1370769_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	2.0e-09
WP_021514992.1|1370824_1371649_-|protease	serine protease	protease	A0A0A7NPW9	Enterobacteria_phage	96.3	8.7e-125
WP_001036814.1|1371645_1371858_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	86.6	7.6e-25
WP_021514993.1|1371869_1372169_-	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.1e-40
WP_000153700.1|1372165_1372432_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|1372428_1372632_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|1372655_1373066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021656.1|1373159_1373273_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|1373269_1373512_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158971.1|1373523_1373811_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_050869485.1|1373821_1374172_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	6.2e-56
WP_050869486.1|1374291_1374498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004248.1|1374504_1374792_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	6.7e-24
WP_000581441.1|1374907_1375228_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	45.0	1.3e-12
WP_000023401.1|1375324_1376329_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_000004833.1|1376487_1377645_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_001289165.1|1377710_1378724_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283581.1|1378723_1379536_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
1383352:1383375	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
>prophage 4
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	1769509	1820936	5500189	head,terminase,integrase,transposase,tail,holin,portal,capsid	Enterobacteria_phage(34.55%)	65	1769863:1769881	1805708:1805726
WP_085948136.1|1769509_1770723_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.8e-166
1769863:1769881	attL	GCTCCAGTGCATCCAGCAC	NA	NA	NA	NA
WP_001300307.1|1771410_1772208_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533625.1|1772443_1773469_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_000096346.1|1773468_1773672_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048403.1|1773730_1776202_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	1.7e-59
WP_001090200.1|1776294_1776486_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1776482_1776671_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_085948186.1|1776776_1777932_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001133037.1|1778508_1778718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394546.1|1778718_1779357_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|1779368_1779521_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_024173647.1|1779813_1780152_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	1.5e-06
WP_000747951.1|1780543_1780786_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693883.1|1780769_1781195_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262366.1|1781266_1782337_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|1782343_1783090_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_000450617.1|1783111_1783828_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_042353845.1|1783860_1784142_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000699809.1|1784138_1784366_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|1784358_1784670_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|1784797_1785016_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|1785017_1785575_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1785808_1786021_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1786140_1786485_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|1786606_1786879_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|1786880_1787930_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|1787942_1788302_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|1788310_1788865_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|1789089_1789287_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|1789422_1790136_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001368722.1|1790586_1791018_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_106919090.1|1791496_1793347_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411809.1|1793648_1793855_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731192.1|1793859_1794204_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992157.1|1794254_1794788_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	3.1e-99
WP_001303555.1|1794943_1795126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1795138_1795270_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|1795497_1795683_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|1796209_1796524_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1796605_1796830_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|1797224_1797734_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012816790.1|1797705_1799634_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
WP_000259008.1|1799617_1799824_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	1.8e-10
WP_106919091.1|1799820_1801413_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_000256809.1|1802930_1803278_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|1803335_1804364_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000201523.1|1804415_1804790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|1804782_1805136_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000975041.1|1805150_1805684_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.3e-57
WP_000683066.1|1805680_1806076_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
1805708:1805726	attR	GTGCTGGATGCACTGGAGC	NA	NA	NA	NA
WP_000106786.1|1806083_1806836_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	4.6e-133
WP_000479106.1|1806849_1807281_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	2.1e-42
WP_000533415.1|1807307_1807721_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	6.0e-42
WP_000082502.1|1807701_1810281_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000847304.1|1810277_1810607_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001357740.1|1810606_1811305_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194790.1|1811310_1812054_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_064721023.1|1811999_1812632_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.6e-105
WP_000649829.1|1812822_1813350_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_106919092.1|1813483_1816960_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.0	0.0e+00
WP_001435161.1|1817028_1817652_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.9e-68
WP_000279043.1|1817716_1819030_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.6	9.1e-76
WP_001023997.1|1819031_1819301_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	95.5	6.0e-43
WP_000950813.1|1819477_1820458_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_095111390.1|1820804_1820936_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
>prophage 5
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	1902194	1967301	5500189	holin,terminase,head,integrase,transposase,tail,tRNA,portal,capsid	Enterobacteria_phage(50.0%)	73	1906179:1906194	1915637:1915652
WP_001025336.1|1902194_1903928_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001300190.1|1904143_1904710_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185741.1|1904723_1905470_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|1905857_1906958_+	cytochrome c	NA	NA	NA	NA	NA
1906179:1906194	attL	ACTCATCGCCAGGAAA	NA	NA	NA	NA
WP_000176771.1|1906982_1909412_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564746.1|1909576_1910548_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1910544_1911288_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|1911328_1911724_-	membrane protein	NA	NA	NA	NA	NA
WP_042854221.1|1911776_1912547_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000362001.1|1912528_1913842_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	97.0	2.8e-250
WP_000073102.1|1913897_1914134_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	8.4e-41
WP_001030139.1|1914142_1914289_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000492057.1|1914292_1914535_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	2.4e-35
WP_001091864.1|1914566_1914938_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	98.4	3.8e-64
WP_000566775.1|1915555_1915948_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.1	2.3e-35
1915637:1915652	attR	TTTCCTGGCGATGAGT	NA	NA	NA	NA
WP_000002325.1|1916134_1916350_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	60.6	5.5e-15
WP_032162797.1|1916908_1917109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042854230.1|1917114_1917579_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	74.4	6.3e-24
WP_032162798.1|1917962_1918667_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.8	8.3e-68
WP_000786996.1|1918790_1919054_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	52.9	1.8e-12
WP_032162799.1|1919050_1919758_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	83.8	3.3e-109
WP_072097753.1|1919805_1920783_+	peptidase	NA	A5LH69	Enterobacteria_phage	62.8	2.7e-101
WP_032162801.1|1920779_1921013_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	48.6	1.9e-13
WP_032162802.1|1920999_1921893_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	44.7	3.8e-57
WP_032162803.1|1921910_1922801_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	64.1	3.0e-83
WP_032162804.1|1922797_1924198_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	9.2e-244
WP_001065348.1|1924194_1924452_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	69.7	6.2e-21
WP_032162806.1|1924503_1925493_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.8	2.3e-193
WP_021570435.1|1925510_1925876_+	hypothetical protein	NA	A5LH77	Enterobacteria_phage	90.0	1.3e-56
WP_024241392.1|1925899_1926322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021570437.1|1926584_1927454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|1927722_1927926_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000466957.1|1929598_1930030_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_106919093.1|1930507_1932358_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_085948186.1|1932606_1933762_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000411809.1|1934072_1934279_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_032163095.1|1935308_1935842_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	1.5e-101
WP_032140280.1|1936396_1936483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|1936704_1936890_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1937417_1937732_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1937813_1938038_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001429103.1|1938464_1938971_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
WP_024182572.1|1938942_1940871_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_000259002.1|1940854_1941061_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|1941057_1942650_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253979.1|1942639_1944145_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000256824.1|1944181_1944529_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_000522591.1|1944586_1945615_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|1945666_1946050_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|1946042_1946396_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_050869331.1|1946411_1946945_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	2.6e-58
WP_000683079.1|1946941_1947337_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235112.1|1947344_1948097_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000479108.1|1948110_1948542_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533411.1|1948568_1948982_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_047087948.1|1948962_1951524_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.8	0.0e+00
WP_000847345.1|1951520_1951850_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152532.1|1951849_1952548_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000140735.1|1952553_1953297_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.4e-144
WP_071790928.1|1953233_1953866_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.1	5.7e-92
WP_032162954.1|1953926_1957406_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_032162956.1|1957472_1958072_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	3.7e-109
WP_032362297.1|1958136_1959450_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.4	9.7e-78
WP_001101700.1|1959451_1959721_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_032162748.1|1959831_1960413_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.3	1.1e-46
WP_012816780.1|1960480_1961116_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_032162749.1|1961243_1962302_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144084.1|1962380_1963031_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
WP_001132098.1|1963214_1963805_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_099561169.1|1963791_1963914_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001217551.1|1964050_1964299_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
WP_000891620.1|1964652_1965219_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|1965528_1967301_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	2192894	2251022	5500189	protease,head,terminase,integrase,tRNA,portal,capsid	uncultured_Caudovirales_phage(71.43%)	59	2191149:2191164	2250547:2250562
2191149:2191164	attL	AGTGGGCACGGGCGGG	NA	NA	NA	NA
WP_001295400.1|2192894_2194169_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_000789751.1|2194230_2195091_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765764.1|2195134_2195740_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100931.1|2195845_2197348_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|2197958_2198594_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|2198593_2199289_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920784.1|2199292_2199913_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000915761.1|2200974_2203197_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|2203189_2203768_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|2203767_2204349_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|2204425_2204866_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|2204951_2205167_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|2205439_2205565_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_032162755.1|2205807_2206848_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|2206882_2207884_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459406.1|2207987_2209160_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125609.1|2209169_2210762_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179513.1|2210936_2211965_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483362.1|2212076_2212844_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969095.1|2213072_2213663_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000945924.1|2214050_2215862_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
WP_001075865.1|2215858_2217232_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001227014.1|2217270_2218536_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043354.1|2218580_2220089_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170701.1|2220189_2221365_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066628.1|2221563_2223210_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_001099102.1|2223352_2224756_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001295399.1|2224752_2225682_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732526.1|2225757_2227059_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	5.5e-17
WP_001092519.1|2227062_2227782_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|2227910_2228246_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000513673.1|2228242_2228965_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|2229001_2230384_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|2230569_2231514_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001342403.1|2232037_2233570_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|2233580_2234969_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085272.1|2236075_2237305_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.2e-131
WP_001443601.1|2237669_2237858_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	9.1e-14
WP_157909274.1|2237907_2238237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000179576.1|2238361_2238667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226784.1|2238856_2239054_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001368658.1|2239046_2239511_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_042854119.1|2239711_2240146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204971.1|2240147_2240381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770138.1|2240386_2240686_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761829.1|2240682_2242437_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.3	2.1e-91
WP_000164428.1|2242784_2243036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294165.1|2243032_2243338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126697.1|2243347_2243758_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233301.1|2243768_2244041_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132077.1|2244166_2244391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137341.1|2244682_2245840_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_001475696.1|2245895_2246453_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	4.1e-62
WP_136719415.1|2246490_2247666_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	1.1e-184
WP_001020667.1|2247662_2248001_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	1.3e-29
WP_000137525.1|2247997_2248291_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	63.9	1.4e-32
WP_001145909.1|2248290_2248731_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.1	2.9e-55
WP_000113645.1|2249020_2249377_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127874.1|2249360_2251022_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	5.7e-277
2250547:2250562	attR	AGTGGGCACGGGCGGG	NA	NA	NA	NA
>prophage 7
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	2265375	2333469	5500189	protease,head,terminase,integrase,tail,transposase,holin,capsid	Stx2-converting_phage(35.38%)	79	2257195:2257211	2292870:2292886
2257195:2257211	attL	CCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000041687.1|2265375_2267802_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001295396.1|2268000_2268306_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001443598.1|2268413_2269124_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2269126_2269687_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2269721_2270063_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2270197_2270524_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2270729_2271944_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836067.1|2271955_2272975_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_072095801.1|2273032_2273143_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|2273162_2274458_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001368608.1|2274477_2274714_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000102128.1|2274801_2277264_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.5	2.3e-125
WP_000199475.1|2277356_2277545_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2277541_2277730_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2278294_2278504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394546.1|2278504_2279143_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|2279154_2279307_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362153.1|2279572_2279992_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|2280092_2280374_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693888.1|2280357_2280783_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|2280805_2281768_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_045906934.1|2281774_2282521_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	6.9e-113
WP_032163040.1|2282542_2283313_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	2.1e-80
WP_001118160.1|2283328_2283724_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000761448.1|2283724_2284138_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	1.5e-56
WP_032163038.1|2284579_2285527_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	97.5	4.1e-179
WP_032163036.1|2286040_2286385_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	1.1e-57
WP_000220601.1|2286589_2286889_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|2286894_2287152_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|2287287_2287560_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001265113.1|2287561_2288608_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_000904103.1|2288620_2288980_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|2288988_2289519_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|2289760_2289958_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|2290092_2290806_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|2291255_2291687_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_044711843.1|2292164_2294102_+	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	96.9	0.0e+00
2292870:2292886	attR	CCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000143462.1|2294237_2294417_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290217.1|2294457_2294730_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284506.1|2294806_2295022_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087703.1|2295026_2295560_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	8.1e-100
WP_001056883.1|2295834_2296404_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455402.1|2296403_2296553_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|2296780_2296966_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2297491_2297806_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|2297887_2298112_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001372000.1|2298153_2298519_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.6e-62
WP_000958380.1|2298808_2299372_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|2299368_2301030_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_024246490.1|2301093_2303031_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.9	0.0e+00
WP_001063099.1|2303075_2303297_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125984.1|2305823_2306150_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2306160_2306511_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2306507_2306954_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2306950_2307295_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|2307361_2308078_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710954.1|2308092_2308467_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	8.6e-64
WP_122993730.1|2308562_2308772_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000212998.1|2308822_2312065_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.5	0.0e+00
WP_000807927.1|2312057_2312399_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_064460438.1|2312398_2313097_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	96.1	1.1e-128
WP_074399377.1|2313107_2313353_+	hypothetical protein	NA	A0A0P0ZE89	Stx2-converting_phage	93.3	2.6e-16
WP_000099160.1|2313268_2314807_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|2314855_2315203_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2315199_2315604_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_074399383.1|2315656_2316313_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	100.0	1.3e-126
WP_078191759.1|2316258_2316891_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	1.0e-101
WP_064460440.1|2317137_2320614_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.4	0.0e+00
WP_001360257.1|2320682_2321306_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_064460441.1|2321370_2322684_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023356.1|2322685_2322955_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_024017371.1|2323066_2323639_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	48.7	2.7e-40
WP_024017370.1|2323856_2324555_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_001121225.1|2326605_2327256_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_099355886.1|2327850_2328165_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	77.8	5.6e-24
WP_000347482.1|2328224_2329508_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000214712.1|2331092_2331296_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|2331473_2332160_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948186.1|2332313_2333469_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 8
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	2531037	2583550	5500189	protease,terminase,integrase,tail,holin,portal,tRNA	Escherichia_phage(38.98%)	63	2532946:2532971	2578189:2578214
WP_000837924.1|2531037_2532171_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2532311_2532746_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
2532946:2532971	attL	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_001143784.1|2533315_2533957_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2534038_2534668_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2534740_2535316_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023406.1|2535428_2535698_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_106919096.1|2535699_2536923_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	98.0	1.1e-78
WP_001228289.1|2536987_2537587_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000514990.1|2537654_2541128_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_096851774.1|2541368_2541998_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000194798.1|2541943_2542687_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001356552.1|2542697_2543396_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000847298.1|2543395_2543725_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918276.1|2543721_2546367_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000532073.1|2546410_2546719_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2546745_2547168_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2547181_2547934_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2547941_2548340_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2548352_2548976_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2548978_2549260_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2549252_2549579_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2549666_2551691_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2551635_2553138_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2553137_2553350_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|2553346_2555470_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2555466_2555943_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|2556458_2556644_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2556871_2557018_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2557017_2557587_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2557857_2558391_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001072899.1|2558395_2558611_-|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2558688_2558934_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2558974_2559154_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142970.1|2559290_2561237_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000640110.1|2561938_2562481_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_000228017.1|2562477_2562768_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000940305.1|2562767_2563367_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_071525388.1|2563438_2563690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902698.1|2563926_2564139_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000418464.1|2564261_2565383_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001138877.1|2565369_2566020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014164.1|2566174_2566405_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001151116.1|2566401_2566824_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000450718.1|2566839_2567601_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_000788984.1|2567623_2568370_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_001356605.1|2568376_2569165_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000702017.1|2569242_2569665_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001033914.1|2569661_2569904_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|2570000_2570420_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|2570726_2570879_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000887681.1|2571290_2572139_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560226.1|2572185_2572407_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_001427414.1|2572406_2572577_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000102194.1|2572657_2575327_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000166315.1|2575319_2576129_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042853000.1|2576185_2576380_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|2576372_2576561_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_000079604.1|2576660_2576876_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040845.1|2576877_2578113_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_001157382.1|2578164_2579100_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
2578189:2578214	attR	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_000123745.1|2579228_2580602_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387395.1|2581079_2582063_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2582317_2583550_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 9
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	2776992	2839497	5500189	head,terminase,holin,integrase,tail,tRNA,capsid	Stx2-converting_phage(29.79%)	65	2785283:2785297	2839922:2839936
WP_001297484.1|2776992_2778099_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2778134_2778776_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2778779_2780150_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|2780317_2780989_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735406.1|2780988_2782449_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2782524_2783646_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359439.1|2783791_2785021_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2785270_2786407_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2785283:2785297	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799400.1|2786390_2787254_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938111.1|2787616_2788978_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_001368611.1|2789354_2792756_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	7.8e-220
WP_001301673.1|2793347_2795696_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2795715_2795805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|2795911_2796181_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|2796182_2797496_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001434935.1|2797560_2798160_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	4.4e-110
WP_106919097.1|2798227_2801701_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
WP_047085664.1|2801939_2802572_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_000194787.1|2802517_2803261_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001368648.1|2803271_2803970_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000807964.1|2803969_2804311_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_050869705.1|2804303_2807546_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.3	0.0e+00
WP_001513217.1|2807593_2807803_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030040.1|2807898_2808273_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|2808278_2808995_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|2809061_2809406_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2809402_2809849_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2809845_2810196_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2810205_2810532_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2813058_2813280_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_044165196.1|2813324_2815262_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_042854280.1|2815325_2816987_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958355.1|2816983_2817547_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	78.0	1.4e-65
WP_000279816.1|2817838_2818204_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	7.8e-62
WP_001341372.1|2818245_2818431_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000347013.1|2818560_2818701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|2819057_2819282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|2819346_2819553_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001003112.1|2820199_2820733_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_000138558.1|2820892_2821165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|2821420_2821627_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000143050.1|2821917_2823768_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000762928.1|2824938_2825760_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000904098.1|2825756_2826131_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
WP_001265175.1|2826143_2827193_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_001341388.1|2827194_2827473_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000884071.1|2827640_2827853_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.1	1.2e-17
WP_001278450.1|2828041_2828146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627694.1|2828261_2828846_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.0e-34
WP_001118159.1|2828902_2829298_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000450874.1|2829313_2830084_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.3	2.2e-82
WP_000788938.1|2830109_2830850_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095671.1|2830856_2831819_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693916.1|2831840_2832266_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2832249_2832573_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948452.1|2832697_2833174_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001443692.1|2833492_2833648_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	5.7e-06
WP_001171966.1|2833807_2834026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358071.1|2834029_2834194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2834594_2834783_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2834779_2834971_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048412.1|2835063_2837535_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|2837596_2837866_+	excisionase	NA	NA	NA	NA	NA
WP_000074973.1|2837834_2838953_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_001113310.1|2839029_2839497_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
2839922:2839936	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 10
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	2928739	2933682	5500189	transposase	Stx2-converting_phage(33.33%)	7	NA	NA
WP_000692323.1|2928739_2928961_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186738.1|2929023_2929500_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214398.1|2929515_2930001_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001234682.1|2930091_2930910_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
WP_001309734.1|2931256_2931691_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|2931687_2932038_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|2932068_2933682_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
>prophage 11
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	3012515	3255217	5500189	protease,head,terminase,integrase,tail,transposase,holin,portal,capsid,plate	Escherichia_phage(26.82%)	285	3130619:3130634	3246296:3246311
WP_000998025.1|3012515_3014048_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
WP_000233452.1|3014804_3017165_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|3017319_3017883_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|3018703_3020137_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3020355_3020553_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3020779_3021076_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282206.1|3022187_3024005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|3024191_3025394_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000611858.1|3025760_3026747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627404.1|3026743_3027235_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000409852.1|3028540_3029899_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_000287458.1|3030485_3032909_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000945561.1|3032917_3034936_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|3034928_3036254_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|3036255_3036669_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_001199172.1|3038125_3039397_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154414.1|3039402_3040530_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|3040587_3041418_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001323669.1|3041453_3041756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018486.1|3041960_3043469_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979513.1|3043627_3043837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299042.1|3043891_3047854_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|3047893_3048532_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|3048819_3049911_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001387701.1|3049910_3050603_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|3050614_3051001_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001299038.1|3051008_3051809_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001186.1|3051818_3052409_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|3052419_3052914_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001299028.1|3052934_3054263_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	6.3e-234
WP_001273658.1|3054345_3054519_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001151437.1|3054891_3055488_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3055508_3055736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044280.1|3055773_3057015_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000787869.1|3057307_3057556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000535358.1|3057673_3058564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420617.1|3058824_3059745_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|3059744_3060050_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209866.1|3060142_3060742_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062104.1|3060738_3063285_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|3063284_3064457_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3064586_3065279_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|3065251_3066280_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001121564.1|3066751_3067405_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_042853950.1|3067417_3068116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131653.1|3068316_3068898_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
WP_106420821.1|3068888_3069083_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_000767050.1|3069027_3069570_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023995.1|3069791_3070061_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_000268934.1|3070062_3071376_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001230429.1|3071440_3072040_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_106919098.1|3072106_3075583_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.9	0.0e+00
WP_047085664.1|3075821_3076454_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_000194787.1|3076399_3077143_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001368648.1|3077153_3077852_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000807964.1|3077851_3078193_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_050869705.1|3078185_3081428_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.3	0.0e+00
WP_001513217.1|3081475_3081685_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030040.1|3081780_3082155_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|3082160_3082877_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|3082943_3083288_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3083284_3083731_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_078191696.1|3083727_3084057_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	9.9e-56
WP_001056416.1|3084328_3084913_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001310454.1|3085080_3085329_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289295.1|3085330_3087421_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	6.8e-166
WP_000129790.1|3087492_3088425_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|3088427_3088649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|3088661_3088916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3088917_3089199_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|3089195_3089468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|3089472_3089766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|3089777_3090308_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323221.1|3090405_3090948_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000578573.1|3090951_3091485_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|3091484_3092000_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|3092003_3092555_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_078191697.1|3092551_3092863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|3092877_3093228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|3093243_3093576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|3093568_3093766_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000378480.1|3093755_3094052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214366.1|3094048_3094558_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000852377.1|3094627_3095053_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|3095124_3095625_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|3095659_3096088_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|3096071_3096290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|3096299_3096527_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|3096507_3096816_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|3096812_3097103_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|3097105_3097687_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|3097686_3099351_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532592.1|3099350_3100940_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_078191698.1|3100923_3102255_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	6.7e-151
WP_000094808.1|3102376_3102850_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|3103026_3104151_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|3104150_3105098_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_085562253.1|3105141_3105504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|3105500_3105920_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|3105916_3106477_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|3106477_3106723_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|3106719_3108222_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|3108230_3108596_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|3108610_3109087_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|3109213_3111289_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146116.1|3111275_3112625_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|3112608_3113733_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|3113722_3114337_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|3114329_3114767_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|3114766_3115849_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|3115839_3116400_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|3116399_3117311_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|3117345_3117867_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|3117946_3118150_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|3118371_3118932_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|3119031_3121071_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|3121217_3121400_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|3121435_3121681_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|3121719_3122184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|3122298_3122499_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|3122452_3123190_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_000125988.1|3123353_3123680_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_032257997.1|3126206_3126428_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	1.7e-35
WP_000172978.1|3126472_3128410_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	96.7	0.0e+00
WP_033809286.1|3128473_3130135_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|3130131_3130695_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
3130619:3130634	attL	GCGGCAATGGCTGACG	NA	NA	NA	NA
WP_000829190.1|3130983_3131349_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000095741.1|3131390_3131591_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000828068.1|3131722_3132049_-	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_001109019.1|3132394_3132946_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_071529499.1|3133184_3133370_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001280922.1|3133592_3133724_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_000189387.1|3133818_3133974_-	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	98.0	3.3e-22
WP_085948186.1|3134035_3135192_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_042854551.1|3135253_3135781_-	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	6.8e-91
WP_000087733.1|3136054_3136588_-	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_000284506.1|3136592_3136808_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290217.1|3136884_3137157_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143458.1|3137197_3137377_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142998.1|3137512_3139450_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000752026.1|3139949_3140219_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3140228_3141176_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000144759.1|3142108_3142303_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107963.1|3142299_3142905_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004024.1|3142904_3143627_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211425.1|3143701_3144436_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	99.6	9.4e-123
WP_001254256.1|3144710_3144893_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|3144889_3145417_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3145413_3145860_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3145816_3146053_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3146063_3146279_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3146411_3146690_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145907.1|3146760_3147051_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_042854040.1|3147047_3147749_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	7.6e-130
WP_000185454.1|3147745_3148684_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438541.1|3148716_3149013_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|3149151_3149379_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3149457_3150165_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|3150225_3150567_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|3150634_3151096_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|3151089_3152136_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000198444.1|3152791_3153175_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|3153233_3153704_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065377.1|3153854_3154223_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198863.1|3154295_3154460_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	100.0	6.2e-27
WP_000372941.1|3154428_3154572_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|3154647_3154944_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3154949_3155735_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186866.1|3155731_3156412_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|3156408_3156591_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|3156563_3156755_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077758510.1|3156765_3157047_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	98.9	9.3e-47
WP_000763378.1|3157145_3157367_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289864.1|3157363_3157771_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000582235.1|3157772_3158528_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	7.1e-142
WP_000208003.1|3158538_3159321_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.8	1.1e-47
WP_000376716.1|3159320_3159599_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_001368678.1|3159756_3160056_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000545713.1|3160091_3160259_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001281197.1|3160287_3160632_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_001303849.1|3160749_3160968_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533665.1|3160945_3162019_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_001399835.1|3162113_3164858_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	9.2e-38
WP_000829674.1|3164929_3166003_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3166051_3166225_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_012816753.1|3166214_3166445_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3166419_3166608_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3166618_3166831_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3167116_3167329_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3167770_3168076_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247608.1|3168182_3168827_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038077.1|3168823_3169570_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|3169569_3171666_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001300224.1|3171711_3172851_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3172838_3173285_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208667.1|3173304_3175485_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000644323.1|3175604_3176903_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|3176978_3177071_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460803.1|3177083_3178220_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263563.1|3178231_3179776_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004915.1|3179909_3180767_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063983.1|3180763_3181162_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003672.1|3181158_3181746_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186415.1|3181742_3182450_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107389.1|3182468_3184262_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001295940.1|3184258_3185377_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_012817749.1|3186493_3187246_+	type III effector	NA	NA	NA	NA	NA
WP_001023443.1|3187370_3187640_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	5.4e-44
WP_106919099.1|3187641_3188955_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001216290.1|3189019_3189643_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106919100.1|3189711_3193188_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.8	0.0e+00
WP_064758458.1|3193436_3194069_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.1	2.7e-102
WP_000140693.1|3194014_3194758_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	2.0e-144
WP_001357740.1|3194762_3195461_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|3195460_3195790_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_106919101.1|3195786_3198342_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.8	0.0e+00
WP_000533411.1|3198322_3198736_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_000479115.1|3198762_3199194_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143022.1|3199207_3199960_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.1e-126
WP_000683065.1|3199967_3200363_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975031.1|3200359_3200893_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_001204560.1|3200907_3201261_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000201513.1|3201253_3201637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522623.1|3201688_3202717_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|3202774_3203122_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253918.1|3203158_3204664_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000831809.1|3204653_3206246_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.2	9.3e-184
WP_000259002.1|3206242_3206449_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001300274.1|3206432_3208361_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	6.1e-262
WP_000235436.1|3208332_3208842_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|3209244_3209469_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|3209550_3209865_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3210392_3210578_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3210799_3210913_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3211133_3211667_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3211826_3212099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|3212354_3212561_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874348.1|3213009_3214860_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261909.1|3215627_3216341_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|3216478_3216676_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|3216962_3217781_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|3217932_3218304_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|3218293_3218665_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|3218677_3219727_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341388.1|3219728_3220007_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3220174_3220330_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3221533_3221671_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3222036_3222810_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3223161_3223575_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3223590_3224361_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788749.1|3224442_3225129_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	9.8e-106
WP_000273724.1|3226330_3226786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3226992_3227418_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3227401_3227674_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3227782_3228184_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3228211_3228403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3228402_3228690_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3228966_3229122_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394513.1|3229263_3229653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3229839_3230025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094185360.1|3230110_3231267_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000413705.1|3231865_3232054_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3232050_3232242_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000080172.1|3233025_3234639_-|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000624688.1|3234669_3235020_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|3235016_3235451_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000273151.1|3237423_3237666_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_085948186.1|3237851_3239007_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_106919110.1|3239000_3239930_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	52.3	3.9e-81
WP_000375136.1|3240337_3240997_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_000904444.1|3241087_3241417_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048255.1|3241413_3241692_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000116292.1|3241786_3242977_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_001295356.1|3243034_3243352_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000665217.1|3243396_3243810_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847791.1|3243982_3244645_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|3244740_3245199_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420533.1|3245230_3247285_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
3246296:3246311	attR	CGTCAGCCATTGCCGC	NA	NA	NA	NA
WP_001261231.1|3247407_3247854_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000875044.1|3247863_3250026_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000839153.1|3249988_3250618_-	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000288710.1|3250836_3251346_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000750416.1|3251702_3252743_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877161.1|3252818_3253271_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156526.1|3253456_3255217_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 12
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	3282936	3354233	5500189	protease,head,terminase,transposase,tRNA,capsid	Bacillus_phage(20.0%)	54	NA	NA
WP_000117880.1|3282936_3284337_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_000977920.1|3284938_3286027_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3286211_3287402_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000399648.1|3287680_3288661_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001109487.1|3288902_3289550_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3289576_3290125_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925997.1|3290305_3292153_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572619.1|3292413_3296874_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001299046.1|3296873_3297578_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288853.1|3297558_3298881_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_042853868.1|3298877_3299663_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899599.1|3299798_3300578_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436915.1|3300554_3301448_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011600.1|3301601_3302348_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3302344_3302527_-	protein YcaR	NA	NA	NA	NA	NA
WP_000570563.1|3303847_3304834_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551263.1|3304830_3306579_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	1.9e-57
WP_000705676.1|3306615_3308880_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3309086_3309371_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3309530_3311204_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3311314_3311998_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|3312170_3312935_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445231.1|3313103_3314387_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057149.1|3314457_3315546_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|3315744_3316437_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001297197.1|3316566_3318327_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3318732_3319590_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3319644_3321927_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3322118_3322859_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001190376.1|3322940_3323531_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242676.1|3323630_3324539_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|3324539_3325970_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|3326179_3327328_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3327642_3328269_+	hydrolase	NA	NA	NA	NA	NA
WP_000534648.1|3328304_3329168_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|3329169_3329787_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850305.1|3329797_3332242_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000886683.1|3332480_3333773_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067767.1|3333863_3335207_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3335217_3335829_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077016.1|3335983_3340051_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3340185_3340680_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3341224_3342190_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|3342312_3344079_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|3344079_3345801_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241686.1|3345842_3346547_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3346831_3347050_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3347734_3350011_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3350041_3350362_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_021540210.1|3351148_3351439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835287.1|3351702_3352245_-|terminase	terminase	terminase	O64316	Escherichia_phage	47.5	3.2e-35
WP_001179421.1|3352446_3352830_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190777.1|3352841_3353183_-|head	head decoration protein	head	NA	NA	NA	NA
WP_032162867.1|3353192_3354233_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.6	4.4e-65
>prophage 13
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	3476642	3532251	5500189	protease,head,terminase,lysis,integrase,tail,transposase,holin,portal,capsid	Enterobacteria_phage(48.44%)	72	3472279:3472293	3540645:3540659
3472279:3472293	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
WP_001399730.1|3476642_3477932_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000767413.1|3477990_3478467_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001102750.1|3479145_3480384_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	82.3	3.6e-207
WP_001131649.1|3480720_3481296_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	76.4	1.8e-76
WP_000652078.1|3481847_3482672_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	5.8e-153
WP_000950986.1|3482895_3483777_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.1	2.3e-147
WP_096150060.1|3483940_3484072_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950792.1|3484418_3485399_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	1.7e-87
WP_001023455.1|3485575_3485845_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_078289217.1|3485846_3487160_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	8.2e-77
WP_001230425.1|3487224_3487824_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.3e-109
WP_085948134.1|3488765_3489978_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.3	7.1e-168
WP_000090913.1|3492660_3493263_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.6e-88
WP_078191754.1|3493199_3493943_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.3	7.5e-144
WP_001152563.1|3493953_3494652_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	87.9	2.1e-119
WP_032163057.1|3494651_3494981_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_106919103.1|3494977_3497539_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	83.0	0.0e+00
WP_000533411.1|3497519_3497933_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_000479115.1|3497959_3498391_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143022.1|3498404_3499157_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.1e-126
WP_000683065.1|3499164_3499560_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975031.1|3499556_3500090_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_001204560.1|3500104_3500458_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000201513.1|3500450_3500834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522623.1|3500885_3501914_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|3501971_3502319_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253918.1|3502355_3503861_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000831809.1|3503850_3505443_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.2	9.3e-184
WP_000259002.1|3505439_3505646_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001300274.1|3505629_3507558_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	6.1e-262
WP_000235436.1|3507529_3508039_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|3508433_3508628_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881322.1|3508815_3509433_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	86.4	3.8e-93
WP_000092314.1|3509582_3510020_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	95.9	9.4e-70
WP_000075135.1|3510016_3510514_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_000411802.1|3510513_3510720_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_064460395.1|3511167_3513018_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000499454.1|3513316_3513475_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3513560_3514304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3514488_3515178_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3515192_3515315_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3515652_3516612_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028841.1|3516823_3517489_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_001108038.1|3517485_3518097_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_000566868.1|3518089_3518260_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|3518256_3518439_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000153263.1|3518435_3518963_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	8.0e-100
WP_000736898.1|3518959_3519400_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_000145931.1|3519473_3519764_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788866.1|3519760_3520462_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	1.4e-128
WP_000185509.1|3520458_3521358_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	98.7	2.5e-170
WP_000251073.1|3521390_3521684_-	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_001194218.1|3521803_3522019_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028394.1|3522122_3522755_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.0	4.6e-118
WP_000618038.1|3522751_3523156_+	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	7.3e-69
WP_000332935.1|3523375_3523831_+	Antitermination protein N	NA	J3JZZ6	Escherichia_phage	92.2	6.3e-61
WP_001271095.1|3523827_3524709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065374.1|3524897_3525266_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|3525338_3525503_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|3525471_3525615_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_085948134.1|3525659_3526873_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.3	7.1e-168
WP_000995449.1|3527002_3527299_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|3527304_3528090_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186788.1|3528086_3528767_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.8e-131
WP_000682297.1|3528763_3528946_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	96.7	2.4e-27
WP_000548537.1|3528918_3529110_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001360114.1|3529120_3529402_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763363.1|3529500_3529722_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120063.1|3529932_3530535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3530777_3530945_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3530984_3531203_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3531180_3532251_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3540645:3540659	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 14
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	3745487	3810655	5500189	protease,head,terminase,lysis,integrase,tail,transposase,tRNA,portal,capsid	Enterobacteria_phage(56.36%)	70	3753968:3754014	3800448:3800494
WP_000394594.1|3745487_3746624_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383945.1|3746892_3749130_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|3749116_3752089_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|3752089_3752980_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|3753162_3753924_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3753968:3754014	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|3754436_3755390_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|3755576_3757061_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937478.1|3757244_3757550_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239874.1|3757606_3758275_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|3758640_3758754_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|3758822_3759056_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087133.1|3759374_3759965_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000885588.1|3760062_3760638_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.9e-105
WP_000279113.1|3760637_3763553_-	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	2.5e-57
WP_001230323.1|3763617_3764217_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	2.6e-110
WP_106919104.1|3764283_3767682_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001309913.1|3767742_3768390_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000140729.1|3768287_3769031_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001152638.1|3769036_3769735_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	6.6e-134
WP_000847379.1|3769734_3770064_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000459457.1|3772533_3772968_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3772949_3773372_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001298904.1|3773387_3774128_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000683105.1|3774135_3774531_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|3774527_3775106_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|3775117_3775471_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158905.1|3775482_3775881_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000063280.1|3775922_3776948_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|3777003_3777336_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123319.1|3777345_3778665_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	1.5e-235
WP_001297098.1|3778645_3780247_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000198149.1|3780243_3780450_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|3780446_3782372_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000453580.1|3782346_3782892_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001298906.1|3783280_3783475_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	9.7e-27
WP_001031427.1|3783639_3783846_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001298896.1|3784131_3784542_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738500.1|3784832_3785126_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3785216_3785399_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3785615_3786113_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|3786112_3786328_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|3786916_3788014_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000332834.1|3788203_3788587_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	3.4e-55
WP_001360050.1|3788604_3789594_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061438.1|3789601_3790411_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767117.1|3790430_3790820_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210187.1|3790816_3791143_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|3791139_3791793_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001305611.1|3791792_3792287_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000104954.1|3792283_3793225_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|3793214_3793394_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|3793569_3794121_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|3794113_3794374_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|3794471_3795164_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|3795483_3795999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3796469_3796832_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_016240449.1|3796897_3797722_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000008165.1|3797849_3798386_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|3798376_3798739_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206810.1|3798738_3799044_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_000433946.1|3799043_3799415_+	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	82.8	2.5e-47
WP_001298992.1|3799270_3800434_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_001250422.1|3801404_3801920_-	fimbria assembly protein	NA	NA	NA	NA	NA
3800448:3800494	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_000691050.1|3801930_3802938_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_106919105.1|3805589_3806282_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3806501_3807044_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|3807524_3808391_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3808392_3808605_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3808712_3809234_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3809269_3810655_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 15
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	4112998	4175183	5500189	tRNA,transposase,protease,plate	Bradyrhizobium_phage(14.29%)	49	NA	NA
WP_000611742.1|4112998_4113412_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4113415_4115266_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348796.1|4115229_4116312_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4116336_4117617_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4117613_4118138_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|4118140_4119472_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343304.1|4119476_4120238_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001240530.1|4123745_4125158_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122988827.1|4125266_4128701_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000377957.1|4128711_4130064_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|4130087_4130570_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|4130613_4131528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236643.1|4131537_4132017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086139.1|4132153_4132939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297205.1|4133479_4134211_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917888.1|4134275_4134743_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_032162718.1|4134739_4135462_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052751.1|4135495_4136251_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644689.1|4136322_4137681_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211696.1|4137728_4138499_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4138576_4139377_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648601.1|4139617_4140532_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997043.1|4140528_4141332_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_001140174.1|4147091_4147664_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4147851_4148883_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4148875_4149529_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4149568_4150384_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4150501_4150906_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4150902_4151610_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|4151721_4153440_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|4154520_4155501_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|4155750_4156461_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4156474_4156897_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185291.1|4156893_4157439_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4157604_4157805_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4157791_4158052_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176573.1|4158100_4159399_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4159463_4159853_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020975.1|4159909_4162051_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055746.1|4162149_4163109_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|4163121_4166604_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4166640_4167237_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_042854149.1|4167233_4168382_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4168381_4169170_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4169173_4169629_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|4169733_4170759_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4170762_4171248_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4171369_4173802_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001439416.1|4173869_4175183_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 16
NZ_CP027219	Escherichia coli strain 2015C-3163 chromosome, complete genome	5500189	4654663	4662076	5500189	transposase	Stx2-converting_phage(33.33%)	8	NA	NA
WP_000684859.1|4654663_4655620_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175452.1|4655620_4656388_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	1.4e-12
WP_001356111.1|4656923_4657211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368706.1|4657182_4658238_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_085949152.1|4658336_4659610_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000080172.1|4659650_4661264_-|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000624688.1|4661294_4661645_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|4661641_4662076_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
>prophage 1
NZ_CP027220	Escherichia coli strain 2015C-3163 plasmid unnamed, complete sequence	94104	0	64854	94104	integrase,protease,transposase	Stx2-converting_phage(38.1%)	55	33222:33281	62211:64886
WP_000361610.1|1100_2078_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_106881565.1|2883_4096_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	98.6	3.5e-167
WP_086163899.1|4062_4161_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
WP_000592771.1|4269_6480_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|6523_6913_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_085948186.1|7279_8435_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000445934.1|9139_9535_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921957.1|9534_10494_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_077249722.1|10766_11669_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032324142.1|12052_12736_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	2.1e-28
WP_001443814.1|12735_12954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|12965_13400_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001341455.1|13444_13927_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|13923_14643_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032313270.1|14919_15237_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_000218854.1|16925_17360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247865.1|17452_17719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077776889.1|18698_18920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148286.1|18950_19202_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001341408.1|19781_20630_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000157095.1|20715_21051_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001291056.1|21282_21615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991402.1|21626_24347_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001341409.1|24567_24888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085953672.1|25655_26869_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
WP_136138333.1|26867_27281_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001034100.1|28084_31987_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_136139077.1|32924_33344_-	DUF1449 family protein	NA	NA	NA	NA	NA
33222:33281	attL	AAATTGTCCTGTCTGGCAACAATCGCGCCCATCTATATAGATGGACACGAACGATGAATT	NA	NA	NA	NA
WP_001341423.1|33274_33949_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|33945_34293_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_106881567.1|34296_35865_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000937603.1|36143_37331_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|37330_37696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|37932_38280_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_012917688.1|38329_39868_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
WP_012680945.1|40171_41170_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|41243_42965_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|43058_44165_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|44164_44986_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000839950.1|47634_48150_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217745.1|48151_51148_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987096.1|51197_53318_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_001213545.1|53321_54761_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000864810.1|55173_55527_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001164205.1|55699_56482_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465041.1|56483_56897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|57456_57687_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|57683_58100_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001165114.1|58261_58807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|58874_60030_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000704534.1|60835_61696_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|61823_62210_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001341423.1|62263_62938_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|62934_63282_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_106881567.1|63285_64854_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
62211:64886	attR	AAATTGTCCTGTCTGGCAACAATCGCGCCCATCTATATAGATGGACACGAACGATGAATTCCCAGACAAAAAAAGATATTCCCTGCTTCCGTTCTTATTTGCCTGATGCTCTGCGTTTAAGATTTGAAGATAAACTGACCATCCGGGCCATCGCTCAGCGTCTAGGTCTCAGTCATTCCACAATACATACGCTTTTTCAGCGATTTATTGCATCCGGTATCGCATGGCCATTGCCCGATTCAGTTTCATTAGCTCAGCTTGATGCCATCCTTTATGCCAACAGAAAGAAGGAATTAACAGAGCCTCAAATCAGCGAAGGCACATGGCGAAAAGAACGGCGAGCCAGCTACAGCCGTGAATTTAAGGTCCGTCTGGCTAAGCAGGCATTACAGCCCGGTGCTGTTGTTGCCCGGATCGCCAGAGAGCACGGTATCAATGATAACCTGCTGTTTAAATGGAAAAGCCAGTACGAGGACGGCTTACTGAGCGATGATGACATACAGGAATGCATGCCTGTCCCGGTGGCTCTGACTGATACGCCAGAGCCGACCAGACCAGTTACAAATCCCTTCTGGCGTAACAAGCCTGATGAGTGCCCTGAGAGTGATCCCGGAAACGTCCCACGGTGCGAGCTGCATCTTAAATCAGGTGTGGTAAAACTGTTTGACCCTCTCACTCCGGAAATGTTACGGGCGCTAATCCGCGAAATGAAAGGAGGTACCCGATGATAACGCTGCCAACCGGTACCAGAATCTGGATCATCGCTGGCATCACAGATATGCGTTGTGGCTTCAACGGCCTGGCTTCGAAGGTGCAGAACACGCTGAAAGATGACCCGTTCTCCGGGCATATCTTCGTCTTCCGGGGCCGCAGTGGCAAAATGGTGAAAATACTGTGGGCCGATCGTGACGGGTTATGCCTGTTCGCCAAACGCCTGGAACGGGGCCGCTTCGTCTGGCCGGTAACCCGGGAAGGGAAAGTGCACCTGACGCCAGCTCAGTTATCCATGCTACTGGAGGGGATCGCGTGGCAACATCCCAAACGGACAGAACGGCCTGGCATCCGGATATAACCCGTGATAAAACAGGGGAATGAACAACACACTCCCCGACGACATCGAGCAACTGAAGGCCCTGCTGATCGCACAGCAGGCTGTTATCGTCTGTCTGGTGAAATAACCGGCTATGCCCGCGAGATCAGCTCACTCAGAGCGCTGGTCGCTAAACTGCAGAGAATGTTGTTCGGTCGCAGCAGCGAGAAAAGCCGCGAGAAGATAGAAAAGAAGATCGCACGGGCAGAAACGCGTATAACCGAGCTCCAGAACAGGCTTGGTGAGGCGCAGTTGCAACTCACCTCAATGGCCGGAGAGACAGCGCCGAAAACATCAGACTCTCCCGTCCGCAAAGCACTTCCGGCAACACTTCCCCGTGACAGGCAGGTTATCTCCCCGGCAGAAACCGAATGCCCCGTCTGCAGCGGCAAACTGAAACCGCTGGGAGAAAGCATCTCTGAACAACTGGATATCATCAACACCGCGTTCAGGGTAATCGAAACGGTTCGCCCAAAACTGGCCTGCAGCCGGTGCGACTGTATAGTTCAGGCTCCGCAGCCACCAAAACCCATCGAGCGCAGTTACGCCAGTCCGGCTCTGCTGGCCCGCATAATCATGGCTAAGTTCGCCGAGCATCTGCCGCTGTACCGTCAGTCGGAAATCTATGCCCGCCAGGGCGTGGAGCTGCACCGCAATACGATGGGGCGCTGGGTTGACATCATGGGAGAGCAGCTTCGCCCGCTGTATGATGAACTGAAGCACTATGTGCTGATGGCGGGTAAAGTGCATGCCGATGACACGCCGGTAAATGTACTGGAGCCGGGTCAGGGTAAAACCCGTACCGGACGGCTGTGGGTCTATGTTCGTGACGATCGCAACGCCGGTTCGACCATGCCGGCAGCGGTGTGGTTCTCATACTCTCCCGACCGCAAAGGCATCCACCCACAGCAACATCTGGCGGACTACAGAGGTATCCTGCAGGCCGATGCATATGCGGGTTACAATGCTCTTTACGAAAGCGGTCAGGTAACCGAAGCGGCTTGTATGGCACATGCCCGACGCAAGATCCACGATGTACATGTCCGCCATCCAACGACAGTAACGGGAGAAGCGCTCCGTCGTATCGGGGAACTGTACGCTATCGAGGCTGAGATCCGCGGCAGTCCGGCAGAAGAGCGACTGGCGGTCAGAAAAGCCAGAACGGTACCGCTAATGCAGTCGTTGTATGAGTGGCTCCAGGGGCAGATGAGCACGCTGTCGCGCCACTCGGATACAGCGAAAGCGTTCACCTATCTGCTGAAGCAATGGGACGCTCTGAACGAATACTGCCGCAATGGCTGGGTGGAGATCGACAATAACCTGTGTGAAAACGCCCTCCGGGTAGTTGCACTGGGGCGGCGTAACTACATGTTCTTCGGCTCTGATGGTGGAGGCGAGAGTGCGGCAGTGATGTACAGCCTGATCGGTAGCTGCAAACTTAACGGAATCGAGCCGGAAACGTGGCTATGCCACGTGATCAGTGTAATCAACACCTGGCCTGCCAACCGCGTGAAAGAGTTGTTGCCCTGGAATGTCACTCAATCTGTAAACTAATTTTTACCCCACGTCCTTCACGGTGCGCTTAC	NA	NA	NA	NA
>prophage 2
NZ_CP027220	Escherichia coli strain 2015C-3163 plasmid unnamed, complete sequence	94104	82632	83109	94104		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000422675.1|82632_83109_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
>prophage 3
NZ_CP027220	Escherichia coli strain 2015C-3163 plasmid unnamed, complete sequence	94104	89463	93275	94104	transposase	Stx2-converting_phage(100.0%)	5	NA	NA
WP_106881567.1|89463_91032_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000631725.1|91035_91383_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|91379_92054_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001339397.1|92250_92928_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_042854352.1|92927_93275_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	9.8e-46
