The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027105	Escherichia coli strain RM14721 chromosome, complete genome	4620018	426656	550009	4620018	transposase,plate,protease,tRNA,integrase	Stx2-converting_phage(25.0%)	111	494911:494926	526888:526903
WP_001295074.1|426656_428174_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|428410_429868_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295383.1|429926_432074_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|432153_433488_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187177.1|433853_435392_-	DNA-binding transcriptional activator CadC	NA	NA	NA	NA	NA
WP_085950260.1|438729_438927_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001487841.1|439148_439526_-	toxin CbtA	NA	NA	NA	NA	NA
WP_001485190.1|439615_439984_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001384112.1|440033_440678_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	33.8	5.9e-28
WP_000692353.1|440696_440918_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001462952.1|440986_441463_-	RadC family protein	NA	NA	NA	NA	NA
WP_001462967.1|441478_441964_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001522407.1|442055_442874_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	4.7e-46
WP_001278282.1|442972_443206_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_029490458.1|443211_443889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001384104.1|444007_444892_-	ferrous iron transport B family protein	NA	NA	NA	NA	NA
WP_001484938.1|445005_445965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001379943.1|446021_446825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001461551.1|448926_449658_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001380331.1|450016_450577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001380332.1|450645_450879_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_123001400.1|451479_452277_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	98.5	4.7e-144
WP_106668445.1|452276_453449_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.2	2.0e-228
WP_106668515.1|453566_453782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001461550.1|453870_454494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001379413.1|454590_454824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001379414.1|454843_455056_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001461549.1|455562_456060_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001380969.1|456081_457626_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_106668446.1|457641_458979_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_106668447.1|458975_459629_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_106668448.1|459631_461362_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001380974.1|461367_461859_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_106668449.1|462027_464715_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.7	1.5e-93
WP_096970652.1|464701_465343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050557211.1|465366_465567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106668450.1|465645_468165_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_106668451.1|468161_469844_+	T6SS effector phospholipase Tle1-EAEC	NA	NA	NA	NA	NA
WP_001464652.1|469863_470541_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_001491347.1|470684_471362_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-EAEC	NA	NA	NA	NA	NA
WP_000033410.1|471393_471660_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	39.0	6.9e-07
WP_106668452.1|471663_472812_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_106668453.1|472804_476194_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_106668454.1|476193_477792_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_106668455.1|477793_478486_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_021552182.1|478493_480257_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_089643446.1|480211_481312_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_021552180.1|481292_481829_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_021552179.1|481831_482281_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032157452.1|482347_482653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106668456.1|482707_484072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097741820.1|485179_487348_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_158701376.1|487821_488058_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	1.1e-24
WP_000080195.1|488108_489722_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|489752_490103_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|490099_490525_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000422741.1|490612_491038_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|491034_491385_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|491415_493029_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000612626.1|493299_493647_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_053287609.1|493695_495234_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	3.7e-294
494911:494926	attL	GAACTGGCGAAAGCGT	NA	NA	NA	NA
WP_024190830.1|495377_495647_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021552175.1|495667_496312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024190829.1|496749_496938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021552171.1|497400_498903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021552170.1|498859_499984_-	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	30.3	4.6e-36
WP_001421562.1|503581_503752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106668516.1|503990_504737_+	porin family protein	NA	NA	NA	NA	NA
WP_106668457.1|504911_506414_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_106668458.1|506678_507941_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	1.2e-77
WP_001188520.1|508320_508896_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_089588191.1|508932_510630_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|510605_510944_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|511059_512361_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|512478_513915_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|514251_514728_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|514743_516000_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|516275_516569_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|516612_518259_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|518396_518750_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_089588192.1|518942_519812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940526.1|520206_521235_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|521276_521843_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|521894_522020_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|522130_522277_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|522458_522776_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238369.1|522772_523306_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001300820.1|523394_524528_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|524590_524950_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|524960_525356_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|525366_526101_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192984.1|526093_527902_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
526888:526903	attR	ACGCTTTCGCCAGTTC	NA	NA	NA	NA
WP_000004771.1|528226_529204_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001336293.1|529422_530925_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|530976_531291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|531287_531602_+	YjeO family protein	NA	NA	NA	NA	NA
WP_086625173.1|531630_534954_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|534975_535944_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|536040_537093_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|537187_537733_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|538596_538650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|538632_539772_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_089588253.1|539770_541318_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|541289_541751_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000640382.1|541769_543107_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|543116_544964_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|544956_545907_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|545992_546301_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|546376_547657_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|547742_549002_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|549004_550009_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 2
NZ_CP027105	Escherichia coli strain RM14721 chromosome, complete genome	4620018	1514523	1538318	4620018	protease,lysis,integrase	Enterobacteria_phage(47.37%)	42	1507665:1507679	1542668:1542682
1507665:1507679	attL	CTGGAAGATGGCCTG	NA	NA	NA	NA
WP_000533643.1|1514523_1515594_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|1515571_1515790_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|1515829_1515997_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000022062.1|1516085_1516367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208005.1|1516481_1517279_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
WP_000582229.1|1517289_1518045_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	5.5e-142
WP_001289864.1|1518046_1518454_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000763386.1|1518450_1518672_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	6.4e-35
WP_001386642.1|1518770_1519052_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|1519062_1519254_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000149532.1|1519226_1519409_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.8e-28
WP_000186848.1|1519405_1520086_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1520082_1520868_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1520873_1521170_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_089588389.1|1521244_1521388_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	97.9	6.0e-18
WP_001198861.1|1521356_1521521_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065358.1|1521593_1521962_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	97.5	6.5e-64
WP_089588356.1|1522149_1523031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340004.1|1523027_1523351_-	antitermination protein	NA	A4KWR8	Enterobacteria_phage	94.3	1.4e-49
WP_089588355.1|1523703_1524108_-	hypothetical protein	NA	Q716D7	Shigella_phage	96.3	1.8e-67
WP_000028392.1|1524104_1524737_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|1524844_1525060_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251067.1|1525179_1525473_+	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_074534295.1|1525505_1526405_+	replication protein	NA	M1FN81	Enterobacteria_phage	99.0	1.0e-171
WP_001568553.1|1526401_1527103_+	replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.9e-128
WP_000145931.1|1527099_1527390_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736913.1|1527463_1527904_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153280.1|1527900_1528428_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254223.1|1528424_1528601_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|1528603_1528945_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950954.1|1528937_1529132_+	protein ninF	NA	NA	NA	NA	NA
WP_001099698.1|1529151_1529514_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.6	1.5e-60
WP_000971095.1|1529510_1529651_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001405603.1|1529736_1530120_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	1.7e-54
WP_000737266.1|1530309_1531407_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|1531979_1532195_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_032267560.1|1532194_1532692_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	1.2e-89
WP_001228688.1|1532908_1533094_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|1533290_1534748_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_089588342.1|1534885_1535677_+	ParB N-terminal domain-containing protein	NA	F8J155	Lactobacillus_virus	40.5	7.0e-47
WP_089588343.1|1535669_1536272_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	52.7	1.1e-52
WP_001295303.1|1537028_1538318_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
1542668:1542682	attR	CTGGAAGATGGCCTG	NA	NA	NA	NA
>prophage 3
NZ_CP027105	Escherichia coli strain RM14721 chromosome, complete genome	4620018	1618274	1686035	4620018	capsid,tail,plate,portal,head,protease,terminase,integrase,lysis	Salmonella_phage(65.38%)	80	1611559:1611573	1672874:1672888
1611559:1611573	attL	TTTTTCTTCCACCAG	NA	NA	NA	NA
WP_000290938.1|1618274_1619306_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
WP_001513672.1|1619494_1619686_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047320.1|1619701_1620271_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001247707.1|1620396_1620618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|1620650_1621160_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|1621167_1621368_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_106668475.1|1621331_1621673_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	95.6	5.6e-54
WP_001244166.1|1621740_1621974_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752614.1|1621973_1622201_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_000104158.1|1622197_1623055_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	1.6e-161
WP_097410485.1|1623051_1625466_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_001154431.1|1625620_1625809_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|1625819_1626053_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1626166_1626844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001583354.1|1627129_1628521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089624423.1|1628548_1629574_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.1	2.9e-170
WP_001098431.1|1629573_1631340_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216237.1|1631482_1632316_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742510.1|1632332_1633391_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000059191.1|1633394_1634045_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|1634140_1634605_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|1634604_1634808_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1634811_1635027_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|1635046_1635520_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000727853.1|1635521_1635899_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_012135855.1|1635895_1636324_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	78.0	9.9e-48
WP_001039931.1|1636419_1636851_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	1.1e-70
WP_000829119.1|1636843_1637290_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	86.3	2.3e-63
WP_000993757.1|1637358_1637937_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	9.4e-94
WP_000177590.1|1637933_1638293_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268276.1|1638279_1639188_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_001086844.1|1639180_1639786_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	9.8e-110
WP_106668476.1|1639782_1641303_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.9	3.2e-197
WP_106668517.1|1641302_1641905_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	4.3e-97
WP_097410370.1|1641876_1642320_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	49.0	6.9e-36
WP_106668518.1|1642322_1642814_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	8.2e-06
WP_097410371.1|1642844_1643411_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	88.5	5.3e-89
WP_000046141.1|1643553_1644726_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_001207660.1|1644735_1645251_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281004.1|1645305_1645608_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
WP_000763311.1|1645622_1645742_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_097410372.1|1645734_1648812_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.6	0.0e+00
WP_000980392.1|1648808_1649294_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_001011777.1|1649290_1650391_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	1.4e-175
WP_000972391.1|1650481_1650700_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1650935_1652621_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1652890_1653268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|1653297_1653555_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|1653714_1654002_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1653985_1654708_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1654768_1655671_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1655758_1656235_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126073.1|1656585_1657698_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1657792_1658926_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|1658935_1659889_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|1659885_1660731_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1660790_1661279_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149756.1|1661319_1662447_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_001295339.1|1662645_1663377_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|1663667_1664336_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1664335_1665052_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1665058_1665790_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1665807_1666536_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|1666753_1667269_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1667394_1667718_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|1667714_1668545_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|1668541_1669555_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1669653_1671084_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|1671094_1672096_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815362.1|1672132_1673851_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
1672874:1672888	attR	TTTTTCTTCCACCAG	NA	NA	NA	NA
WP_000178677.1|1673983_1674952_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|1674963_1676616_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1676759_1677659_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1678153_1678849_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|1679274_1680933_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|1680929_1681886_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|1682036_1683152_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|1683148_1685095_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_001351689.1|1685167_1685392_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1685714_1686035_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 4
NZ_CP027105	Escherichia coli strain RM14721 chromosome, complete genome	4620018	2290818	2398856	4620018	transposase,tail,capsid,portal,head,coat,terminase,integrase,lysis	Enterobacteria_phage(35.48%)	119	2367270:2367285	2403552:2403567
WP_106668489.1|2290818_2292147_-|coat	phage coat protein	coat	NA	NA	NA	NA
WP_001408028.1|2292202_2292478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106668490.1|2292771_2293107_-	type II/III secretion system domain protein	NA	NA	NA	NA	NA
WP_000017777.1|2295089_2295287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000712390.1|2295424_2295637_+	hypothetical protein	NA	A0A0N9HH59	Vibrio_phage	66.7	6.6e-13
WP_089588309.1|2296263_2297586_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|2297585_2297852_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001083595.1|2298074_2299475_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
WP_106668492.1|2304548_2306141_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_086625498.1|2306219_2307173_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194916.1|2307421_2308957_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	9.4e-16
WP_089588120.1|2308950_2309979_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222729.1|2309978_2310971_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_089588121.1|2310982_2312005_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_086625499.1|2312031_2312907_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|2312930_2313221_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|2313277_2314036_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001351738.1|2314039_2314954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089588122.1|2315160_2316612_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_089588132.1|2316838_2317786_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.3e-18
WP_001191027.1|2318394_2318754_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_089588123.1|2318753_2319680_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156615.1|2319743_2321132_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366501.1|2321232_2322114_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089588124.1|2322191_2323307_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|2323456_2324647_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|2324671_2325337_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000268704.1|2325457_2325742_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000273128.1|2325731_2326052_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
WP_000843419.1|2326271_2326706_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|2326726_2327110_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803653.1|2327141_2327360_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087211.1|2327390_2328290_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_086625503.1|2328484_2329672_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|2329798_2329894_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592802.1|2330112_2331003_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
WP_000671737.1|2331257_2331650_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024558.1|2331927_2332446_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_089588125.1|2332489_2334535_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|2334671_2335418_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|2335506_2336193_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|2336369_2336573_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_089588126.1|2336607_2338068_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	2.5e-42
WP_000347482.1|2338156_2339440_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2340044_2340158_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2340226_2340460_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|2340776_2341367_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2341464_2342040_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279139.1|2342039_2345114_-	membrane protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_089588128.1|2345848_2349262_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
WP_000090873.1|2349321_2349954_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	6.5e-96
WP_089588129.1|2349890_2350634_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	6.6e-148
WP_089588130.1|2350639_2351338_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	7.1e-128
WP_000847321.1|2351337_2351667_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
WP_089588131.1|2351663_2354243_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.7	0.0e+00
WP_000459458.1|2354235_2354670_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479169.1|2354651_2355074_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_089568597.1|2355089_2355830_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	2.3e-129
WP_000683142.1|2355837_2356233_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_000975081.1|2356229_2356808_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000753006.1|2356819_2357173_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_077780954.1|2357184_2357583_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.3e-62
WP_000063284.1|2357624_2358650_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	6.0e-192
WP_001295978.1|2358705_2359038_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123305.1|2359047_2360367_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001349919.1|2360347_2361949_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000198149.1|2361945_2362152_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027259.1|2362148_2364074_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|2364048_2364594_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|2364982_2365216_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2365273_2365684_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2365835_2366009_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2366180_2366336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2366414_2366480_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2366482_2366671_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2366681_2366894_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2367256_2367754_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2367270:2367285	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|2367750_2368284_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000422741.1|2368619_2369045_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2369041_2369392_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|2369422_2371036_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000839590.1|2371136_2371352_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2372105_2372321_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2372621_2372834_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2372888_2372978_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2373255_2374008_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2374021_2375071_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2375072_2375351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2375417_2375669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2375885_2376041_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2376112_2376400_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2376399_2376639_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2376663_2376969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2377171_2377504_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|2377940_2379254_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|2379431_2379614_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_001310834.1|2380920_2381277_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_088172348.1|2381417_2382631_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
WP_122991531.1|2383049_2384015_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|2383995_2384517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2384500_2384731_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2384814_2385222_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2385388_2385544_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|2385703_2385922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|2385925_2386090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2386489_2386678_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_089588188.1|2386674_2386866_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048342.1|2386958_2389430_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|2389517_2389754_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876958.1|2389788_2391069_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001360138.1|2391088_2391199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|2391256_2392276_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2392287_2393502_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2393707_2394034_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2394168_2394510_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2394544_2395105_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2395107_2395818_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|2395925_2396231_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|2396429_2398856_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
2403552:2403567	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 5
NZ_CP027105	Escherichia coli strain RM14721 chromosome, complete genome	4620018	2967637	2975945	4620018		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001375261.1|2967637_2969638_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2969762_2970224_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2970263_2970734_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2970780_2971500_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2971496_2973182_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2973403_2974135_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2974194_2974302_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2974282_2975014_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|2975018_2975945_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 6
NZ_CP027105	Escherichia coli strain RM14721 chromosome, complete genome	4620018	3573826	3587009	4620018		Escherichia_phage(50.0%)	12	NA	NA
WP_001272898.1|3573826_3576388_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141322.1|3576493_3577150_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3577200_3577968_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3578163_3579072_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3579068_3580331_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_020239554.1|3580327_3580966_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	8.3e-83
WP_001136934.1|3580970_3581747_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104442.1|3581835_3583200_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3583293_3584286_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|3584348_3585488_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3585627_3586254_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3586247_3587009_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 1
NZ_CP027106	Escherichia coli strain RM14721 plasmid pRM14721, complete sequence	106432	5444	69423	106432	integrase,transposase	Escherichia_phage(23.53%)	55	13366:13386	61513:61533
WP_106668519.1|5444_9356_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.6	6.2e-112
WP_106668520.1|9451_9823_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_106668521.1|10038_10809_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_106668557.1|11371_11767_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.7e-65
WP_069916572.1|11833_12856_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.3e-199
WP_001317493.1|12852_13635_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
13366:13386	attL	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
WP_000612591.1|13707_14055_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_106668522.1|14104_15643_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	1.4e-298
WP_106668523.1|16988_17810_-	type 4b pilus CFA/III pre-pilin peptidase CofP	NA	NA	NA	NA	NA
WP_106668524.1|17812_18859_-	colonization factor CofJ	NA	NA	NA	NA	NA
WP_106668525.1|18872_19898_-	type 4b pilus CFA/III biogenesis protein CofI	NA	NA	NA	NA	NA
WP_106668558.1|19881_21216_-	type 4b pilus CFA/III assembly ATPase CofH	NA	NA	NA	NA	NA
WP_106668526.1|21413_21899_-	type 4b pilus CFA/III biogenesis protein CofG	NA	NA	NA	NA	NA
WP_059259589.1|21886_22714_-	type 4b pilus CFA/III biogenesis protein CofF	NA	NA	NA	NA	NA
WP_032220572.1|22715_23276_-	type 4b pilus CFA/III biogenesis protein CofE	NA	NA	NA	NA	NA
WP_106668527.1|23277_24735_-	type 4b pilus CFA/III secretin CofD	NA	NA	NA	NA	NA
WP_059259582.1|24752_25166_-	type 4b pilus CFA/III biogenesis protein CofC	NA	NA	NA	NA	NA
WP_106668528.1|25182_26754_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_158701379.1|26821_27535_-	type IV pilus major pilin	NA	Q8LTI3	Vibrio_virus	35.2	5.2e-17
WP_001407527.1|27835_28279_-	type 4b pilus CFA/III lytic transglycosylase CofT	NA	NA	NA	NA	NA
WP_106668560.1|28291_29143_-	type 4b pilus CFA/III transcriptional regulator CofS	NA	NA	NA	NA	NA
WP_059259578.1|29435_29738_-	type 4b pilus CFA/III transcriptional regulator CofR	NA	NA	NA	NA	NA
WP_158701380.1|31054_32089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158701381.1|32159_32390_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	100.0	2.0e-07
WP_106668530.1|33178_35158_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_001316853.1|35432_36776_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_106668531.1|37706_37874_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001066925.1|37994_38735_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_106668532.1|38977_39955_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.5	3.6e-101
WP_106668533.1|40732_41323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106668534.1|41322_41586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813631.1|42173_42392_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159861.1|42393_42699_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000772446.1|47116_48283_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|48282_49254_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_106668537.1|50981_51287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106668538.1|51515_53216_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.2	2.2e-170
WP_106668539.1|53795_54449_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	38.4	1.5e-23
WP_001104893.1|54449_54671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106668540.1|54684_55119_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_106668541.1|55163_55934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|56123_57236_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_077693994.1|57587_57890_+	antirestriction protein	NA	NA	NA	NA	NA
WP_001599376.1|57936_58359_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_106668544.1|59519_59753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106668445.1|59848_61021_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.2	2.0e-228
WP_123001400.1|61020_61818_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	98.5	4.7e-144
61513:61533	attR	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
WP_106668545.1|61936_63298_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_106668561.1|63676_64348_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_096115306.1|64402_64837_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_106668546.1|64833_65553_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032189914.1|65564_65753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|65832_65991_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001317494.1|67007_68063_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.4	8.7e-21
WP_053901803.1|68403_69423_+|transposase	IS110-like element ISEc66 family transposase	transposase	NA	NA	NA	NA
