The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027612	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 chromosome, complete genome	5065840	439615	446519	5065840	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|439615_441094_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|441090_441813_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|442131_443493_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|443738_444632_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|444871_445645_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|445655_446519_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 2
NZ_CP027612	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 chromosome, complete genome	5065840	645551	732484	5065840	tRNA,protease,head,holin,tail,portal,terminase,capsid,integrase	Klebsiella_phage(34.62%)	95	668279:668306	709455:709482
WP_002913226.1|645551_646364_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002913227.1|646363_647377_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002913228.1|647440_648577_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_004188930.1|648687_649665_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004149211.1|649751_650927_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|651136_652357_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_004151101.1|652515_654504_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|654565_654847_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002913339.1|654878_655427_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|655426_656236_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_002913341.1|656235_657057_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913342.1|657059_658145_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_002913346.1|658186_659119_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|659286_659838_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913355.1|659858_660344_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_023278783.1|660553_662698_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913358.1|662697_664008_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002913359.1|664167_664452_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_004149222.1|664819_666148_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|666209_666971_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_002913363.1|667260_668190_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.1	4.4e-133
668279:668306	attL	TGTCCCCTTAGTTAAATGGATATAACGA	NA	NA	NA	NA
WP_129088477.1|668617_668914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050849656.1|668934_669180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135712439.1|669161_669548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104467678.1|669612_669939_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	9.6e-27
WP_069334941.1|669938_670178_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	6.1e-15
WP_135712645.1|670324_673879_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	67.2	2.1e-34
WP_106475425.1|673957_677029_-	kinase	NA	A0A286S259	Klebsiella_phage	98.0	0.0e+00
WP_104467718.1|677025_677406_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	96.0	2.8e-70
WP_104467717.1|677415_677898_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	97.5	6.7e-85
WP_048287725.1|677884_678364_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.1	3.9e-93
WP_106475426.1|678363_680811_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.6	2.0e-278
WP_004143894.1|680855_681323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004143895.1|681388_681652_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_001177591.1|681684_682038_-|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_048287728.1|682081_682573_-|tail	phage major tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	8.6e-88
WP_000561415.1|682629_682995_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000763233.1|682991_683531_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_004184710.1|683523_683856_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_004899632.1|683857_684055_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_004104233.1|684124_684442_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	1.2e-21
WP_106475427.1|684519_685758_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	70.1	4.7e-159
WP_000999827.1|685767_686367_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_104467662.1|686359_687586_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.0	2.5e-208
WP_023328632.1|687733_689485_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	71.6	9.7e-251
WP_001119413.1|689488_689986_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
WP_021313631.1|690144_690495_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.9	1.2e-51
WP_019705415.1|690556_690802_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	2.1e-34
WP_048287734.1|691204_691399_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	4.3e-19
WP_072060499.1|691773_691953_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.3	1.9e-21
WP_032448071.1|691903_692179_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	37.1	6.0e-06
WP_048997722.1|692181_692811_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	8.4e-88
WP_000243811.1|692810_693092_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_001294159.1|693078_693465_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_029497192.1|693674_694079_-	antitermination protein	NA	S5M7R9	Escherichia_phage	54.0	5.5e-32
WP_104467614.1|694068_694713_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.2	3.4e-84
WP_104467615.1|694709_695354_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_104467616.1|695323_696295_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	1.6e-109
WP_048997717.1|696291_697821_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	5.1e-203
WP_004104272.1|697813_698089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333906.1|698571_699102_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	61.8	7.9e-55
WP_048333908.1|699130_699391_-	hypothetical protein	NA	A0A1B5FPK9	Escherichia_phage	42.0	1.2e-08
WP_048333964.1|699496_700201_+	helix-turn-helix domain-containing protein	NA	G8C7U1	Escherichia_phage	60.1	3.7e-68
WP_048333909.1|700258_701293_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	43.2	3.9e-74
WP_048333910.1|701330_701537_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	56.7	5.1e-10
WP_104467617.1|702292_702805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104278.1|703253_703613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104467618.1|703656_704469_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_094818648.1|704550_705411_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.1	1.0e-72
WP_077254003.1|705725_705950_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.8	3.2e-13
WP_060876550.1|705942_706230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104467622.1|706526_706835_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	72.1	3.4e-18
WP_104467620.1|706842_707028_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	60.0	3.8e-12
WP_142675426.1|707143_707986_-	RNA helicase	NA	NA	NA	NA	NA
WP_104467621.1|708090_709260_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.8	5.6e-202
WP_002913367.1|709778_710261_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
709455:709482	attR	TGTCCCCTTAGTTAAATGGATATAACGA	NA	NA	NA	NA
WP_023158760.1|710628_711510_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_002913369.1|711519_712428_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
WP_002913370.1|712560_713019_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
WP_004151099.1|713015_714212_+	MFS transporter	NA	NA	NA	NA	NA
WP_099119320.1|714550_714622_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_002913372.1|714692_715907_-	alanine transaminase	NA	NA	NA	NA	NA
WP_004149230.1|716289_717987_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913374.1|717998_718736_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_002913377.1|718789_719755_-	glucokinase	NA	NA	NA	NA	NA
WP_004154521.1|720018_721254_+	ion channel protein	NA	NA	NA	NA	NA
WP_004159719.1|721250_722912_-	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_002913417.1|723092_724085_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002913419.1|724215_724575_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002913421.1|724632_725874_-	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_002913423.1|726220_727423_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_004151096.1|727471_729643_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913434.1|730264_730618_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913435.1|730621_731014_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913437.1|731065_732484_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP027612	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 chromosome, complete genome	5065840	787707	861988	5065840	transposase,holin,tRNA,protease,tail,terminase,capsid,integrase	Salmonella_phage(54.55%)	74	793349:793366	860977:860994
WP_106475428.1|787707_789711_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|789720_790596_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|790715_791429_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_106475429.1|791644_792679_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|792695_793574_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
793349:793366	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_004145648.1|793661_794294_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|794297_794768_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|794829_795891_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002913807.1|796113_797577_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|797586_797946_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|798073_798985_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|798981_799683_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_104467537.1|799781_801068_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.9	4.1e-65
WP_002913827.1|801163_801790_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|802007_803441_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|803450_804344_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|804607_805645_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|805641_806283_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|806463_808524_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|808527_810060_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|810113_812342_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913843.1|812694_812886_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
WP_002913846.1|812982_813870_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|813967_815200_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|816270_817449_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|817432_819301_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_101984573.1|819487_820003_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	88.8	1.4e-69
WP_101984574.1|819999_820629_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.4	7.4e-92
WP_101984575.1|820618_820924_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	80.4	6.0e-39
WP_004146394.1|820910_821315_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_104467538.1|821567_821789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106475430.1|821790_822534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104467519.1|824535_824832_+	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.1e-25
WP_004141317.1|825219_825765_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_104467520.1|826043_826373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104467521.1|826369_829144_-	hypothetical protein	NA	Q858F8	Salmonella_phage	78.2	0.0e+00
WP_104467522.1|829143_831021_-	hypothetical protein	NA	Q858F9	Salmonella_phage	58.0	9.0e-194
WP_101867336.1|831020_833537_-	hypothetical protein	NA	Q858G0	Salmonella_phage	53.0	1.2e-246
WP_004152461.1|833549_834047_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_049139501.1|834039_834510_-	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_104467523.1|834511_836989_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.6	6.2e-267
WP_004197381.1|836988_837600_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_024622837.1|837648_837927_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004152466.1|837919_838312_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_087652941.1|838321_839329_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	4.7e-181
WP_004152468.1|839341_839740_-	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_086556463.1|840021_840327_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	8.4e-17
WP_004149313.1|840323_842003_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152472.1|842006_842210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065804104.1|843010_843802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104467524.1|843798_845274_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.4	5.4e-279
WP_104467525.1|845270_845855_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_065928331.1|845932_846190_-	lF-82	NA	NA	NA	NA	NA
WP_023339258.1|846264_846603_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_104467526.1|847465_847657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104467527.1|847656_848160_-	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	34.3	6.9e-08
WP_104467528.1|848156_848561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104467529.1|848557_848953_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.2	2.2e-09
WP_004200565.1|849617_850388_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	91.7	5.5e-57
WP_104467530.1|850377_851463_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	65.7	2.8e-139
WP_004152538.1|851809_852043_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004144290.1|852197_852779_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_032441408.1|853143_853443_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	52.5	8.8e-19
WP_032441409.1|853439_854261_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	81.3	9.5e-132
WP_032441410.1|854257_855139_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.6	4.0e-136
WP_004144294.1|855187_855436_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_009485475.1|855545_855839_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_032441412.1|855831_855990_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	75.0	5.6e-17
WP_032441413.1|855986_856640_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	64.2	4.8e-70
WP_032441414.1|856636_857230_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	1.6e-109
WP_032441415.1|857226_857418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441416.1|857434_858685_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.8e-206
WP_004151979.1|858876_860454_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|860521_861988_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
860977:860994	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 4
NZ_CP027612	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 chromosome, complete genome	5065840	3773756	3783219	5065840	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_004191152.1|3773756_3774872_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004191149.1|3774868_3776809_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
WP_002896516.1|3776885_3777107_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3777432_3777750_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3777780_3780060_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3780179_3780398_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|3780751_3781453_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004191145.1|3781497_3783219_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.2e-14
>prophage 5
NZ_CP027612	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 chromosome, complete genome	5065840	4009443	4090147	5065840	transposase,tRNA,holin,head,protease,tail,terminase,portal,capsid,integrase	Enterobacteria_phage(15.22%)	98	4001395:4001412	4097601:4097618
4001395:4001412	attL	GACGGTGGGGTTTGGCGT	NA	NA	NA	NA
WP_004190938.1|4009443_4009935_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004190935.1|4010072_4011194_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004147969.1|4011279_4012746_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004150807.1|4012745_4013417_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_004179353.1|4013699_4014506_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023279125.1|4014589_4014952_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004190926.1|4015006_4016377_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	4.7e-107
WP_004190923.1|4016380_4017022_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004190921.1|4017076_4018183_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|4018239_4018698_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|4018714_4019365_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|4019605_4020856_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_000741346.1|4020968_4022111_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_000089156.1|4022100_4022337_-	excisionase	NA	NA	NA	NA	NA
WP_100757129.1|4022637_4022856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100757128.1|4022848_4023427_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	37.4	2.1e-21
WP_100757127.1|4023697_4024150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085876930.1|4024797_4025583_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	3.1e-63
WP_073553808.1|4025582_4025882_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	1.2e-12
WP_004184742.1|4026354_4027509_-	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
WP_074075472.1|4027680_4028157_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	1.1e-12
WP_004197463.1|4028258_4028522_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	47.9	3.7e-13
WP_004184739.1|4028550_4029003_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	1.5e-67
WP_001208720.1|4029240_4029420_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_100757126.1|4029409_4030378_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	71.3	2.4e-97
WP_064171954.1|4030374_4031184_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	1.2e-110
WP_100757125.1|4031193_4031571_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	1.9e-47
WP_100757124.1|4031583_4032564_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	4.2e-134
WP_100757123.1|4032582_4032924_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	87.6	3.5e-56
WP_004886665.1|4032972_4033458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100757122.1|4033482_4034304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129307065.1|4034571_4034898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012542609.1|4035484_4035754_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_032425642.1|4035731_4036229_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	83.6	9.6e-79
WP_072310888.1|4036225_4036615_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.5e-23
WP_072310889.1|4036502_4036757_+	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	65.4	6.1e-21
WP_072310890.1|4036880_4037201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072310891.1|4037203_4037554_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	1.2e-51
WP_023316719.1|4037711_4038209_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	1.9e-63
WP_004206689.1|4038212_4039964_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	5.2e-252
WP_100757142.1|4040111_4041338_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.0	7.1e-208
WP_000999827.1|4041330_4041930_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_100757143.1|4041939_4043178_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.4	5.2e-158
WP_019705272.1|4043255_4043573_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	7.4e-24
WP_100757144.1|4043581_4043920_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	5.1e-39
WP_086618521.1|4043916_4044366_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	1.5e-62
WP_016530186.1|4044362_4044710_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_023313062.1|4044766_4045471_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
WP_021313622.1|4045501_4045906_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_004177139.1|4045908_4046214_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_100757145.1|4046287_4046521_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.4e-08
WP_100757146.1|4046581_4049968_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	58.2	1.6e-305
WP_021313619.1|4049988_4050462_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.6e-54
WP_021313618.1|4050448_4050934_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
WP_021313617.1|4050943_4051324_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
WP_104467613.1|4051320_4054404_+	kinase	NA	A0A286S259	Klebsiella_phage	71.9	0.0e+00
WP_100757147.1|4054464_4056684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029504539.1|4056693_4056915_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_029504537.1|4056952_4057174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032442778.1|4057175_4058957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023287539.1|4059149_4059698_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	91.7	1.5e-88
WP_001333465.1|4059775_4060198_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
WP_080786411.1|4060805_4061177_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.4e-26
WP_004892953.1|4061355_4061508_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_104467571.1|4061780_4062494_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004190914.1|4062490_4062883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150797.1|4062875_4063199_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004140530.1|4063648_4063876_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004190910.1|4063988_4065182_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004150795.1|4065804_4065990_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|4066080_4066575_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004190904.1|4066601_4067108_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_071570773.1|4067124_4068000_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|4068055_4069462_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004183659.1|4069458_4070469_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|4070584_4070782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190902.1|4071348_4071981_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_153831089.1|4071959_4072139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|4072589_4073276_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140497.1|4073586_4075095_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|4075215_4076106_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190899.1|4076112_4077897_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004190896.1|4077969_4079178_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004148038.1|4081185_4082100_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|4082189_4082828_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004190891.1|4082958_4083222_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|4083281_4083407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|4083524_4083599_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|4083598_4083700_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|4083757_4084771_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004190888.1|4085071_4085311_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_023279122.1|4085300_4085657_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004190885.1|4085643_4086153_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|4086298_4086991_+	CTP synthase	NA	NA	NA	NA	NA
WP_004190880.1|4087022_4088207_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002901073.1|4088308_4089100_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|4089083_4089530_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|4089646_4090147_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
4097601:4097618	attR	GACGGTGGGGTTTGGCGT	NA	NA	NA	NA
>prophage 6
NZ_CP027612	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 chromosome, complete genome	5065840	4401126	4499402	5065840	transposase,holin,protease,head,tail,terminase,portal,capsid,integrase	Klebsiella_phage(63.46%)	109	4395217:4395233	4461831:4461847
4395217:4395233	attL	GCGCTGGCTGCCGGCGT	NA	NA	NA	NA
WP_087529040.1|4401126_4402489_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
WP_002903315.1|4402708_4404109_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_004183886.1|4404098_4405031_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_004151564.1|4405106_4406408_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
WP_002903374.1|4406664_4407027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903377.1|4407269_4407989_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_002903379.1|4408117_4408453_+	GlpM family protein	NA	NA	NA	NA	NA
WP_004179681.1|4408449_4409172_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_004183892.1|4409208_4410591_-	amino acid permease	NA	NA	NA	NA	NA
WP_002903384.1|4410768_4411719_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004148265.1|4412240_4413770_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_002903386.1|4413780_4415169_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_004887037.1|4415317_4415506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903391.1|4415615_4416566_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_002903394.1|4416704_4417457_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_004224598.1|4417651_4418167_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
WP_002903398.1|4418459_4418618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313034.1|4419228_4419489_-	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_023313036.1|4420002_4420227_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	2.0e-28
WP_104467582.1|4420223_4420787_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.2	3.7e-26
WP_104467583.1|4420783_4421500_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	83.9	5.1e-105
WP_104467584.1|4421505_4422024_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.3	1.1e-93
WP_004152154.1|4422128_4422956_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|4422952_4423147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|4423143_4423569_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|4423565_4423784_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_023304721.1|4424001_4424367_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_004177202.1|4424367_4424592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032433003.1|4424763_4424958_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	50.0	2.6e-08
WP_104467585.1|4424947_4425256_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	59.6	3.5e-23
WP_104467586.1|4425414_4426122_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	50.6	4.0e-54
WP_072025957.1|4426246_4426474_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	60.0	9.0e-16
WP_046623879.1|4426549_4426738_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_104467587.1|4426734_4427565_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	67.9	1.8e-85
WP_064165388.1|4427576_4428455_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	62.7	1.9e-82
WP_064165387.1|4428451_4429831_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	65.0	1.6e-160
WP_031592532.1|4429817_4430186_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.3	2.1e-38
WP_032433014.1|4430182_4430965_+	antitermination protein	NA	F1C595	Cronobacter_phage	78.3	8.5e-114
WP_024176410.1|4431253_4431553_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_023313048.1|4431549_4432089_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
WP_023313049.1|4432085_4432433_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	1.2e-40
WP_104467588.1|4432429_4432705_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.7	4.4e-09
WP_104467589.1|4432655_4432850_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.9	6.9e-25
WP_019705417.1|4432846_4433140_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	1.3e-30
WP_004143908.1|4433244_4433490_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	51.3	5.9e-13
WP_004143907.1|4433651_4433966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004143906.1|4433974_4434265_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	91.7	2.5e-50
WP_004143905.1|4434477_4434912_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_004143904.1|4434921_4436454_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_104467590.1|4436456_4437734_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.5	1.8e-246
WP_004216821.1|4437739_4438420_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_040174769.1|4438431_4439595_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	100.0	2.7e-212
WP_142989818.1|4439631_4439874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880223.1|4439821_4440148_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_004143899.1|4440208_4440406_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_004184710.1|4440407_4440740_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_000763233.1|4440732_4441272_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_000561415.1|4441268_4441634_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000115125.1|4441690_4442182_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_040174785.1|4442225_4442579_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	80.3	1.3e-48
WP_001333686.1|4442611_4442875_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
WP_042346245.1|4442938_4443331_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.2	3.6e-20
WP_106475459.1|4443400_4445836_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	88.5	0.0e+00
WP_004899614.1|4445835_4446315_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_032433045.1|4446301_4446784_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	97.5	4.3e-84
WP_017880229.1|4446793_4447174_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_106475460.1|4447170_4450239_+	kinase	NA	A0A286S259	Klebsiella_phage	97.8	0.0e+00
WP_106475461.1|4450316_4453106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955508.1|4453347_4454468_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_104467563.1|4454791_4455325_+	acyltransferase	NA	NA	NA	NA	NA
WP_142989815.1|4455638_4455911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104467565.1|4456874_4457975_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	2.2e-115
WP_017879817.1|4458103_4459222_-	transporter	NA	NA	NA	NA	NA
WP_004190329.1|4459345_4460791_-	amidohydrolase	NA	NA	NA	NA	NA
WP_009760675.1|4460790_4462101_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
4461831:4461847	attR	ACGCCGGCAGCCAGCGC	NA	NA	NA	NA
WP_004148273.1|4462267_4463176_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004143055.1|4463277_4463841_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004151560.1|4463837_4464644_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002903522.1|4464813_4465500_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004190326.1|4465510_4466167_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_004179693.1|4466176_4467379_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004190325.1|4467388_4468741_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004151556.1|4468730_4469495_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_004143067.1|4469487_4469877_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_023279012.1|4470481_4472098_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004152246.1|4472260_4473913_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_104467566.1|4473967_4475479_-	anion permease	NA	NA	NA	NA	NA
WP_004190319.1|4476121_4478899_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	1.1e-65
WP_004190314.1|4478966_4479917_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004176303.1|4479897_4480617_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_004183910.1|4480613_4482230_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004190311.1|4482385_4482742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179719.1|4482905_4483826_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004190310.1|4484090_4485746_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_015958364.1|4485906_4486302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279010.1|4486304_4487483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071570807.1|4488136_4489063_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023279009.1|4489052_4489955_-	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_004148291.1|4490574_4491534_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004190301.1|4491670_4492471_-	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_015958369.1|4492470_4493304_-	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_008805033.1|4493296_4493596_-	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004190298.1|4493613_4494456_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_004190296.1|4494455_4496111_-	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_002903679.1|4496335_4497370_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002903681.1|4497812_4498175_+	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903683.1|4498161_4498491_+	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903685.1|4498534_4498651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032429517.1|4498664_4499402_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP027612	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 chromosome, complete genome	5065840	4534693	4545580	5065840		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|4534693_4535314_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004190239.1|4535306_4536572_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002903955.1|4536583_4537486_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4537746_4538508_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|4538528_4539389_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|4539686_4539947_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|4540033_4541122_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|4541152_4542418_-	MFS transporter	NA	NA	NA	NA	NA
WP_106475462.1|4542472_4545580_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.4	0.0e+00
>prophage 1
NZ_CP027613	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence	191856	7070	104965	191856	transposase,protease,bacteriocin,head,portal,tail,capsid,terminase,holin,integrase	Klebsiella_phage(35.29%)	107	24346:24405	47702:48522
WP_001118615.1|7070_7994_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
WP_000025662.1|8611_8992_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|8996_9926_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|9980_10661_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_002436614.1|10657_12058_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_065520246.1|12273_12708_+	copper-binding protein	NA	NA	NA	NA	NA
WP_106475471.1|12840_14430_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	8.1e-188
WP_032414478.1|14459_14810_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.1e-39
WP_015632445.1|14806_15214_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_009654306.1|15587_15707_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_065520248.1|15672_15852_-	antitoxin	NA	NA	NA	NA	NA
WP_064177598.1|16164_16410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064177597.1|16414_16987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064177596.1|17017_17512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213596.1|17572_17776_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_049118762.1|17789_18020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106475472.1|18152_19381_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
WP_044246670.1|19472_19727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|19929_21333_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|21361_21994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077267029.1|22219_23566_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_064145647.1|23614_24019_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
24346:24405	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_004217321.1|24408_25113_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000215515.1|25216_25573_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|25562_25964_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|25960_26251_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|27389_28394_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_040251959.1|29829_30045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831235.1|30267_31350_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.1	4.4e-185
WP_004182121.1|31471_34546_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_106475473.1|34597_35851_+	lactose permease	NA	NA	NA	NA	NA
WP_071527922.1|35907_36078_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_023313931.1|36956_37217_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_032435791.1|37273_39337_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_015065566.1|39419_39839_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|40199_41204_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004883563.1|41385_41658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|41785_42625_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|42618_42966_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|43129_43921_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|43926_44217_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|44328_44826_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|44970_45984_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|46186_46537_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_004217321.1|46993_47698_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001620097.1|48670_49759_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
47702:48522	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTGGAAGCTTATATCGAACGCGTCAGCCGGGCCAACCGCTTTGAATATGGCAAAGTGCGGGTCGCAGGCTGCGTCGGCTGGGCGCTATGCGCCTCGATAACCGGCGTGCTGTTCGGCATCGATCCCAATATCACCTTCTGGATCGCCTCCGGCTTTGCGCTGGTGCTCGGTCTGCTGCTCTGGCTGTCGCGGCCGGAAAGCAGCAACAGCGCCCAGGTTATCGAGGCGCTGGGCGCCAATCGCCAGGCCTTTTCGCTGCGTACGGCGGCAGAGCTGCTGCGTATGCCGCGCTTCTGGGGCTTTATCGTCTATGTGGTGGGTGTCGCCAGCGTCTACGACGTGTTTGACCAGCAGTTCGCCAACTTTTTCAAAAGCTTTTTCGCCAGTCCGCAGCGCGGTACCGAAGTGTTTGGCTTCGTCACCACCGGCGGCGAGTTGCTCAACGCGCTGATCATGTTCTGCGCGCCGGCCATCGTTAACCGCATCGGCGCCAAAAACGCCCTGCTGACCGCGGGGATGATCATGTCGGTGCGTATTCTCGGGTCGTCCTTCGCCTCATCGGCAGTCGAGGTGGTGATCCTCAAGATGCTGCATATGTTTGAGATCCCCTTCCTGCTGGTGGGAACTTTTAAATATATCTCTTCCGCCTTTAACCCGCGCCTCTCGGCCACCCTGTTCCTGATCGGTTTTAATCTGTCAAAACAGCTGTCCGGGGTGGTGCTTTCCGCCTGGGTGGGCCGGATGTACGACACCGTCGGCTT	NA	NA	NA	NA
WP_001620096.1|49845_50106_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620095.1|50403_51264_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|51284_52046_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_106475474.1|52306_53209_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	1.3e-158
WP_002210515.1|53220_54486_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
WP_002210516.1|54478_55099_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_001067855.1|55810_56515_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|57267_57972_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_017880229.1|60790_61171_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_048328245.1|61180_61663_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	91.2	3.2e-79
WP_004207036.1|61659_62130_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
WP_048328247.1|62129_64562_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	93.1	0.0e+00
WP_052433481.1|64625_65057_-	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	99.2	9.6e-67
WP_001333686.1|65053_65317_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
WP_001177591.1|65349_65703_-|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|65746_66238_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_000561415.1|66294_66660_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000763233.1|66656_67196_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_004184710.1|67188_67521_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_004143899.1|67522_67720_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_017880223.1|67780_68107_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_044067369.1|68054_68297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106475475.1|68333_69497_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.5	3.8e-211
WP_004216821.1|69508_70189_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_017880221.1|70194_71472_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_048328250.1|71474_73007_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.8	1.1e-295
WP_004143905.1|73016_73451_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_040213586.1|73572_73782_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	88.4	1.2e-25
WP_046623875.1|73794_74085_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	96.9	2.6e-52
WP_071887731.1|74156_74363_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	100.0	2.7e-35
WP_022065473.1|74434_74680_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
WP_032448071.1|75638_75914_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	37.1	6.0e-06
WP_040150252.1|75916_76546_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	7.1e-87
WP_000243811.1|76545_76827_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_001294159.1|76813_77200_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_048328256.1|77409_77814_-	antitermination protein	NA	S5M7R9	Escherichia_phage	53.2	9.4e-32
WP_048328258.1|77803_78448_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.7	5.2e-85
WP_048328260.1|78444_78687_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	68.8	9.2e-27
WP_050486031.1|78683_79328_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.5e-39
WP_029498819.1|79297_80269_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.7	7.8e-109
WP_060591468.1|80265_81795_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	6.6e-203
WP_004104272.1|81787_82063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029498814.1|82542_83058_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	63.4	1.5e-58
WP_029497185.1|83101_83302_-	transcriptional regulator	NA	U5P445	Shigella_phage	76.9	2.8e-21
WP_032422885.1|83392_84067_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	86.8	3.3e-114
WP_029498810.1|84669_85152_-	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	60.6	6.3e-51
WP_004104278.1|85623_85983_+	hypothetical protein	NA	A0A1P8D5Q7	Corynebacterium_phage	30.4	1.3e-05
WP_048328265.1|86026_86839_+	DUF2303 family protein	NA	I6NVL7	Burkholderia_virus	30.5	4.4e-28
WP_048328287.1|86920_87781_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	58.7	1.0e-72
WP_077254344.1|88095_88320_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	53.8	1.3e-14
WP_048328266.1|88312_88567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077258390.1|88813_89404_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	55.7	4.7e-32
WP_017880204.1|89405_89969_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	64.1	1.5e-67
WP_017880203.1|89976_90240_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	51.8	4.2e-17
WP_106475461.1|91040_93830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|94266_94971_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|95723_96428_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023307528.1|99792_100650_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|100642_100720_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|100936_101215_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_106475476.1|102634_104965_-|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP027614	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence	100759	0	6163	100759		Salmonella_phage(50.0%)	5	NA	NA
WP_001161490.1|2127_2688_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_004099016.1|2863_3853_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_004099015.1|3849_4086_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_004099009.1|4082_4448_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_004099008.1|4465_6163_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	5.1e-39
>prophage 2
NZ_CP027614	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence	100759	11267	25641	100759	transposase	Aeromonas_phage(20.0%)	20	NA	NA
WP_020314639.1|11267_12221_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_022644719.1|12341_12608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314642.1|12627_13248_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_022644718.1|13845_14472_+	ParA family protein	NA	A0A2H4EW66	Aeromonas_phage	34.4	4.5e-25
WP_020314634.1|14516_14744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314652.1|14918_16193_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	1.3e-148
WP_046960466.1|16204_16654_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	2.3e-31
WP_020314635.1|16650_16896_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.1e-08
WP_020314631.1|17099_17330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314651.1|17764_18466_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.7	6.2e-23
WP_020314641.1|18465_18687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314645.1|18732_19143_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_020314640.1|19189_19957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314632.1|20381_20810_+	antirestriction protein	NA	NA	NA	NA	NA
WP_020314633.1|20855_21362_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.3	2.6e-07
WP_020314643.1|21404_21596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071994544.1|21755_22166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426805.1|22716_23274_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	73.2	1.8e-49
WP_032426804.1|23322_23571_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032426803.1|23640_25641_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.9	6.7e-22
>prophage 3
NZ_CP027614	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence	100759	30272	30611	100759		Klebsiella_phage(100.0%)	1	NA	NA
WP_032426799.1|30272_30611_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	53.5	1.9e-22
>prophage 4
NZ_CP027614	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence	100759	61183	71036	100759		Virus_Rctr197k(25.0%)	8	NA	NA
WP_032426769.1|61183_66442_+	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.8	1.0e-05
WP_015344943.1|66522_67248_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	5.5e-06
WP_004152380.1|67319_67913_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_099743444.1|68079_68676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153014.1|68725_69370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343480.1|69425_70076_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004152383.1|70072_70381_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_015344941.1|70484_71036_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
>prophage 5
NZ_CP027614	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence	100759	74619	75615	100759	transposase	Thermus_phage(100.0%)	1	NA	NA
WP_020326536.1|74619_75615_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
>prophage 1
NZ_CP027615	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed3, complete sequence	108623	0	108201	108623	tail,terminase,integrase,capsid	Salmonella_phage(82.56%)	116	48538:48558	72588:72608
WP_009484941.1|1196_2453_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	90.0	4.7e-231
WP_009484942.1|2452_3040_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	57.5	2.0e-54
WP_009484943.1|3210_3477_-	hypothetical protein	NA	J9Q757	Salmonella_phage	74.7	6.8e-31
WP_009484944.1|3486_4377_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	79.8	1.1e-138
WP_040211677.1|4373_4931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009484946.1|4920_5562_-	AAA family ATPase	NA	J9Q807	Salmonella_phage	87.2	2.0e-97
WP_009484947.1|5554_6229_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	67.3	1.8e-72
WP_104467761.1|6212_6926_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	68.3	2.2e-84
WP_009484949.1|6991_8569_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	71.5	9.8e-210
WP_032410409.1|8611_8962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049127994.1|9025_9574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048255527.1|9874_10528_+	hypothetical protein	NA	J9Q754	Salmonella_phage	50.2	3.5e-52
WP_032410414.1|11138_11621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032410415.1|11852_12299_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	44.4	3.6e-24
WP_032410481.1|12424_12754_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	55.6	4.5e-16
WP_009484831.1|12922_13285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104467762.1|13445_13814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048255584.1|13813_14026_-	hypothetical protein	NA	J9Q804	Salmonella_phage	50.0	1.6e-11
WP_104467763.1|14046_14265_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	35.7	8.1e-06
WP_048976453.1|15797_16109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142989825.1|16120_16312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032410420.1|16299_16620_-	hypothetical protein	NA	J9Q750	Salmonella_phage	70.8	4.6e-42
WP_048255521.1|16690_16918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048335725.1|16991_17603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009484839.1|17644_17824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104467764.1|17832_19497_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	65.2	1.6e-210
WP_087786290.1|19619_20258_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	53.1	4.9e-51
WP_032410430.1|20254_20449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009484843.1|20445_20706_-	hypothetical protein	NA	I6WB67	Aeromonas_phage	35.7	4.8e-05
WP_040211652.1|20837_21134_+	hypothetical protein	NA	G8C7R5	Escherichia_phage	39.6	4.5e-07
WP_009484844.1|21143_21794_+	hypothetical protein	NA	G8C7R6	Escherichia_phage	50.5	5.2e-56
WP_104467765.1|22406_22724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048976458.1|22768_23203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032410442.1|23288_24077_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	64.9	1.3e-82
WP_158699307.1|24110_24266_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_009484850.1|24265_24691_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	77.3	4.1e-54
WP_032410487.1|25409_25910_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.1	8.3e-46
WP_009484852.1|26560_26785_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	51.4	5.4e-13
WP_040211644.1|26964_27579_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	71.3	3.5e-78
WP_009484854.1|27748_28102_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	42.9	1.8e-15
WP_104467748.1|28101_28920_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	44.1	4.1e-26
WP_032410445.1|29056_29599_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	59.8	6.2e-55
WP_032410447.1|29595_30003_-	hypothetical protein	NA	J9Q743	Salmonella_phage	33.3	9.2e-11
WP_009484858.1|30057_30708_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	46.2	5.9e-28
WP_009484859.1|30704_31187_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	52.5	2.8e-43
WP_032410453.1|31183_31597_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	37.6	1.1e-14
WP_009484861.1|31598_32690_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	60.9	8.2e-131
WP_104467750.1|32885_33752_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	47.1	9.9e-63
WP_009484863.1|33825_34968_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	82.4	2.5e-183
WP_048255594.1|35087_37415_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	71.6	0.0e+00
WP_064174809.1|37495_38068_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	58.1	4.8e-58
WP_009484866.1|38084_38783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104467751.1|38772_40689_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	55.3	1.6e-185
WP_104467752.1|40685_41771_-	exonuclease	NA	J9Q7S9	Salmonella_phage	72.0	1.5e-148
WP_080842476.1|42006_42654_-	hypothetical protein	NA	J9Q739	Salmonella_phage	51.6	1.8e-61
WP_048255574.1|42970_44083_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.5	4.1e-77
WP_009484873.1|44447_44663_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	42.9	8.8e-05
WP_040211623.1|44662_45001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052454930.1|45190_45397_-	hypothetical protein	NA	J9Q738	Salmonella_phage	52.2	2.0e-14
WP_040211619.1|45952_46264_-	hypothetical protein	NA	A0A2H4FWM4	Salmonella_phage	69.8	1.0e-09
WP_052454927.1|46253_46994_-	hypothetical protein	NA	G4KK93	Yersinia_phage	32.7	1.4e-25
WP_040211617.1|47129_47387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009484879.1|47476_48304_-	SPFH/Band 7/PHB domain protein	NA	G0YQD7	Erwinia_phage	67.9	1.9e-103
WP_142243032.1|48300_48504_-	hypothetical protein	NA	NA	NA	NA	NA
48538:48558	attL	AGATAAGCACTTACTTATCAT	NA	NA	NA	NA
WP_094354812.1|48626_49352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032410457.1|49369_50410_-	recombinase	NA	J9Q736	Salmonella_phage	72.6	5.4e-148
WP_009484883.1|50453_50714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087785424.1|50710_51688_-	exonuclease	NA	J9Q7S6	Salmonella_phage	65.4	1.4e-121
WP_009484885.1|51733_52711_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	45.6	3.6e-61
WP_009484886.1|52777_53218_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	48.3	3.5e-32
WP_158699306.1|53217_53382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032410363.1|53427_53850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104467754.1|53846_55007_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	62.6	3.0e-139
WP_104467755.1|55077_57450_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	66.7	8.7e-311
WP_087761705.1|57627_58878_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	62.6	1.5e-144
WP_058688433.1|58976_60989_-	hypothetical protein	NA	J9Q7G6	Salmonella_phage	45.7	3.3e-125
WP_050597402.1|61599_61905_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058688400.1|61894_62941_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	2.1e-19
WP_100248991.1|63112_63697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049129099.1|63677_63971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009484898.1|64001_64325_-	hypothetical protein	NA	A0A2H4IBK3	Erwinia_phage	48.6	8.3e-23
WP_009484899.1|64414_64660_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.6	1.9e-11
WP_009484901.1|64885_65131_-	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	58.0	7.9e-18
WP_087785450.1|65127_65568_-	DUF2829 domain-containing protein	NA	K4N0H8	Escherichia_phage	43.8	3.9e-23
WP_106475484.1|65659_66490_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	64.8	2.0e-89
WP_057201093.1|66656_67268_-	hypothetical protein	NA	S4TP42	Salmonella_phage	33.7	1.7e-16
WP_071561692.1|68912_69128_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	62.9	3.1e-18
WP_009484907.1|69111_69312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057201087.1|69308_70637_-	hypothetical protein	NA	J9Q7G5	Salmonella_phage	70.6	1.5e-182
WP_040211699.1|70636_71107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104467756.1|71643_72555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104467757.1|72617_73733_-	DNA primase	NA	J9Q720	Salmonella_phage	66.6	2.0e-148
72588:72608	attR	ATGATAAGTAAGTGCTTATCT	NA	NA	NA	NA
WP_009484913.1|73867_75229_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	70.1	4.5e-179
WP_009484914.1|75273_76014_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	53.0	3.1e-73
WP_009484915.1|76342_76714_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	52.6	6.4e-19
WP_009484916.1|76715_77384_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	70.5	1.8e-88
WP_009484917.1|77701_77953_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	47.0	1.3e-12
WP_032410393.1|77949_78642_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	78.0	1.1e-99
WP_009484919.1|78652_78967_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	69.8	2.3e-33
WP_104467758.1|79048_80590_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	43.1	6.1e-47
WP_104467759.1|80636_94121_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	55.2	1.2e-37
WP_032410395.1|94132_94744_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	62.6	6.5e-69
WP_040211688.1|94731_95535_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	76.4	2.2e-117
WP_032410397.1|95524_96223_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	76.1	2.3e-102
WP_009484925.1|96279_96615_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	73.6	2.7e-45
WP_104467760.1|96663_101220_-	tape measure protein	NA	J9Q712	Salmonella_phage	36.1	2.3e-174
WP_048255536.1|101580_101898_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	64.8	3.1e-30
WP_009484931.1|102847_103297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009484932.1|103386_103770_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	46.8	2.2e-30
WP_009484933.1|103766_104261_-	hypothetical protein	NA	J9Q711	Salmonella_phage	51.2	7.2e-34
WP_009484934.1|104251_104596_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	57.9	1.1e-33
WP_032410405.1|104606_105440_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	49.3	9.2e-74
WP_009484936.1|105439_105865_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	64.3	9.5e-43
WP_065807833.1|105906_106341_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	43.4	4.7e-21
WP_009484938.1|106414_107287_-|capsid	phage capsid protein	capsid	J9Q710	Salmonella_phage	81.4	1.0e-131
WP_009484939.1|107316_108201_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	59.1	1.7e-81
>prophage 1
NZ_CP027616	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence	129985	20558	91637	129985	transposase,integrase	Escherichia_phage(23.53%)	70	44849:44908	93467:93483
WP_001118615.1|20558_21482_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
WP_020314938.1|23337_23586_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020314935.1|23635_24193_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	72.4	1.8e-49
WP_022644875.1|24993_25314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644876.1|25338_25602_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.4e-12
WP_001568047.1|25789_25981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|26023_26530_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_022644877.1|26572_27001_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.2e-10
WP_022644878.1|27681_28449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644879.1|28502_28922_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|28931_29153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|29152_29854_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568040.1|30290_30521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644880.1|30582_31254_-	plasmid stability mediator StbB	NA	NA	NA	NA	NA
WP_001568038.1|31256_32228_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_020805749.1|32460_32892_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_022644881.1|32891_34163_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
WP_086556813.1|34244_35222_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
WP_015632469.1|35218_36424_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_007372134.1|37205_37610_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_000612626.1|37606_37954_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_022644883.1|38002_39541_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_012539983.1|39628_40384_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_032416556.1|41571_42348_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	1.9e-52
WP_022644887.1|42359_42998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072060.1|43046_43367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|43911_44142_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|44138_44555_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001348075.1|44628_44865_+	AAA family ATPase	NA	NA	NA	NA	NA
44849:44908	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|44911_45616_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
44849:44908	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_022644888.1|45506_46436_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.1	1.5e-45
WP_004201280.1|46591_47065_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|47285_47552_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|47694_48459_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|48719_49934_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|49967_51401_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|51782_51989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|51993_52482_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001452736.1|52690_53002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404032.1|53037_53343_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_001067855.1|53378_54083_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
53316:53972	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACC	NA	NA	NA	NA
WP_000427619.1|55979_56984_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
53316:53972	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACC	NA	NA	NA	NA
WP_000954592.1|57165_57342_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|57671_58487_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|58547_59351_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|59350_60187_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|60158_60698_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|60907_61768_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000722315.1|62467_63292_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_001206315.1|63351_64140_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_065187201.1|64209_64764_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|64997_65555_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_004152391.1|66669_68385_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|68494_71524_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|71630_72656_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|72652_73432_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|73750_74632_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|74881_76201_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004196359.1|77112_77484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|77546_78467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196325.1|78520_79279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196314.1|79512_80811_+	MFS transporter	NA	NA	NA	NA	NA
WP_004196355.1|80916_81186_+	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196366.1|81198_82329_+	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_032072095.1|82490_82913_+	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196353.1|83168_84509_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_015065592.1|84597_86130_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_077253291.1|86563_88687_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_022644891.1|89051_90092_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_087439983.1|90261_91637_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
93467:93483	attR	TTCAGCATGGCTGGCAG	NA	NA	NA	NA
>prophage 2
NZ_CP027616	Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence	129985	104590	111017	129985	transposase	Yersinia_phage(16.67%)	9	NA	NA
WP_022644908.1|104590_104836_+	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.5e-08
WP_044596206.1|104832_105282_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	5.2e-31
WP_022644910.1|105293_106565_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	7.3e-147
WP_022644911.1|106666_106867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072061.1|107067_107343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644912.1|107333_107981_-	P-loop NTPase	NA	A0A222YXS3	Escherichia_phage	43.5	9.7e-39
WP_022644913.1|108310_108829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644914.1|109368_109956_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	36.5	2.6e-22
WP_022644915.1|110063_111017_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.4	1.4e-62
