The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	0	38459	4233827	tail,integrase,capsid,head,protease,terminase,portal	Acinetobacter_phage(35.9%)	65	31557:31571	37738:37752
WP_000216836.1|403_760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000054769.1|818_1163_-|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	41.3	2.0e-11
WP_000823042.1|1266_1440_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PGU2	Moraxella_phage	66.7	7.1e-13
WP_001199908.1|1483_1903_+	antitoxin	NA	A0A0R6PH90	Moraxella_phage	57.6	1.2e-34
WP_000224728.1|2032_5617_-	transglycosylase SLT domain-containing protein	NA	A0A0U4JEA4	Pseudomonas_phage	41.8	3.3e-51
WP_001226538.1|5676_6186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002023327.1|6260_6401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000811700.1|6427_6889_-|tail	phage tail assembly chaperone family protein, TAC	tail	A0A2H4J6R8	uncultured_Caudovirales_phage	55.6	1.4e-34
WP_000538632.1|6943_7411_-	hypothetical protein	NA	A0A2H4J511	uncultured_Caudovirales_phage	38.7	9.8e-25
WP_001280225.1|7541_7910_-	DUF3168 domain-containing protein	NA	A0A2H4J359	uncultured_Caudovirales_phage	48.0	3.8e-24
WP_000110203.1|7906_8365_-	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	61.2	7.6e-46
WP_031974912.1|8377_8722_-|head	phage head closure protein	head	G3ENA2	Psychrobacter_phage	44.8	1.2e-19
WP_000115106.1|8723_9182_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_000048864.1|9185_9494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130408.1|9557_10736_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.3	4.3e-117
WP_002127558.1|10732_11617_-|protease	Clp protease ClpP	protease	A0A0U4B0J0	Pseudomonas_phage	53.7	1.9e-69
WP_001065557.1|11686_12100_-	hypothetical protein	NA	A0A2I6UHP8	Bacillus_phage	46.1	1.1e-11
WP_000854567.1|12123_13365_-|portal	phage portal protein	portal	A0A0U4IIV7	Pseudomonas_phage	56.1	1.1e-118
WP_000056903.1|13365_13524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920223.1|13609_13846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031974913.1|13854_15597_-|terminase	terminase large subunit	terminase	A0A2H4J6B3	uncultured_Caudovirales_phage	65.9	6.6e-215
WP_031974914.1|15682_15919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031974915.1|15911_16250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009895.1|16288_16630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963932.1|16626_16845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031974916.1|16869_17349_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	2.0e-25
WP_000113205.1|17496_17832_-	HNH endonuclease	NA	C4ML58	Xanthomonas_virus	53.8	4.6e-24
WP_000095427.1|17844_18078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002023317.1|18228_18405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000837654.1|18421_19192_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	64.4	3.0e-87
WP_031974917.1|19429_19672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537948.1|19798_20359_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	53.8	5.8e-56
WP_001289516.1|20369_20798_-	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	60.8	4.4e-40
WP_000356485.1|20928_21498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000578526.1|21669_21978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031974920.1|22476_22842_-	HNH endonuclease	NA	Q3HQV7	Burkholderia_phage	44.2	5.3e-26
WP_031974921.1|22828_23209_-	hypothetical protein	NA	A0A0P0IKT4	Acinetobacter_phage	86.0	3.3e-18
WP_162830745.1|23201_23351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031974922.1|23343_23649_-	hypothetical protein	NA	A0A0A0RTI7	Acinetobacter_phage	57.9	1.8e-27
WP_162830744.1|23645_23822_-	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	91.1	1.6e-20
WP_031974923.1|23818_24061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031974925.1|24057_24804_-	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	67.4	1.2e-85
WP_031974927.1|24815_26141_-	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	91.4	2.9e-231
WP_000061204.1|26140_27034_-	GntR family transcriptional regulator	NA	A0A068C8G6	Acinetobacter_phage	46.8	3.5e-47
WP_000047869.1|27030_27198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049342.1|27283_27658_-	helix-turn-helix domain-containing protein	NA	A0A0N7IRF8	Acinetobacter_phage	61.7	6.0e-33
WP_001077694.1|27668_27869_-	helix-turn-helix domain-containing protein	NA	A0A0P0IKT3	Acinetobacter_phage	95.5	1.1e-30
WP_000357168.1|27970_28645_+	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	100.0	6.6e-123
WP_000370476.1|28665_28869_+	hypothetical protein	NA	A0A1B1P9G7	Acinetobacter_phage	98.5	2.4e-28
WP_000466648.1|28998_29328_+	hypothetical protein	NA	A0A1B1P9G6	Acinetobacter_phage	65.7	8.2e-18
WP_000742020.1|29445_29724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000508120.1|30136_30484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991219.1|30503_30770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031974711.1|30769_30985_+	hypothetical protein	NA	A0A068CDE4	Acinetobacter_phage	40.0	1.9e-07
WP_031974712.1|30994_32056_+	hypothetical protein	NA	A0A076G8D7	Sinorhizobium_phage	35.4	1.5e-23
31557:31571	attL	CTCGTGAAAAATATG	NA	NA	NA	NA
WP_000065871.1|32066_32825_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	59.6	8.7e-55
WP_031974714.1|32805_33414_+	YqaJ viral recombinase family protein	NA	A0A2H4J882	uncultured_Caudovirales_phage	76.3	2.2e-85
WP_031974716.1|33410_33851_+	hypothetical protein	NA	A0A0D4DBH6	Acinetobacter_phage	96.2	2.8e-37
WP_031979451.1|33847_34060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106451079.1|34056_34281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031974720.1|34281_34458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031974721.1|34469_35720_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.0	9.2e-70
WP_000128669.1|35944_36880_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_001010536.1|36876_37650_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000110163.1|37646_38459_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	36.8	4.2e-39
37738:37752	attR	CTCGTGAAAAATATG	NA	NA	NA	NA
>prophage 2
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	41763	42333	4233827		Synechococcus_phage(100.0%)	1	NA	NA
WP_002000723.1|41763_42333_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	45.5	1.9e-22
>prophage 3
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	60111	61494	4233827		Pandoravirus(100.0%)	1	NA	NA
WP_000994842.1|60111_61494_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.6	2.0e-41
>prophage 4
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	68725	71189	4233827		Sinorhizobium_phage(50.0%)	2	NA	NA
WP_001198540.1|68725_69964_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.3	1.6e-90
WP_001254962.1|70013_71189_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.6	8.0e-07
>prophage 5
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	79369	98699	4233827	transposase	Acinetobacter_phage(100.0%)	13	NA	NA
WP_000872625.1|79369_80911_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	99.8	8.8e-288
WP_024437196.1|80907_82710_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	97.2	0.0e+00
WP_000566784.1|83016_83592_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
WP_001189797.1|83687_86453_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	98.6	0.0e+00
WP_057077814.1|86466_89184_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.7	0.0e+00
WP_076611894.1|89214_90037_-|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_001982145.1|90440_91490_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608310.1|91499_92306_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.3	3.9e-146
WP_000066126.1|92315_93011_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164166.1|93021_94005_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	93.3	5.6e-179
WP_031974722.1|94011_96387_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.7	0.0e+00
WP_031974724.1|96388_97888_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.6	2.5e-279
WP_001187844.1|98150_98699_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 6
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	110247	113423	4233827		Bacillus_phage(50.0%)	2	NA	NA
WP_001090099.1|110247_111843_-	acinetobactin export ABC transporter permease/ATP-binding subunit BarB	NA	W8CYL7	Bacillus_phage	45.5	5.2e-25
WP_086242035.1|111839_113423_-	acinetobactin export ABC transporter permease/ATP-binding subunit BarA	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-12
>prophage 7
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	125350	132586	4233827		Brazilian_cedratvirus(33.33%)	5	NA	NA
WP_024437075.1|125350_126121_-	ferric acinetobactin ABC transporter ATP-binding protein BauE	NA	A0A2R8FG22	Brazilian_cedratvirus	32.0	8.6e-18
WP_024437076.1|126117_127065_-	ferric acinetobactin ABC transporter permease subunit BauC	NA	NA	NA	NA	NA
WP_086242033.1|127064_128015_-	ferric acinetobactin ABC transporter permease subunit BauD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	41.2	1.9e-62
WP_079746264.1|128637_130668_+	acinetobactin non-ribosomal peptide synthetase subunit BasB	NA	NA	NA	NA	NA
WP_024437077.1|130738_132586_-	acinetobactin non-ribosomal peptide synthetase subunit BasA	NA	A0A2K9KZV5	Tupanvirus	24.5	1.2e-36
>prophage 8
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	156369	160401	4233827		Xanthomonas_phage(33.33%)	5	NA	NA
WP_000550750.1|156369_157200_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	7.6e-12
WP_001023216.1|157314_158082_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	2.0e-54
WP_000846419.1|158184_158556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480886.1|158703_159126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197255.1|159252_160401_+	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	36.8	1.0e-62
>prophage 9
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	163594	164983	4233827		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000993080.1|163594_164983_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.2	9.5e-100
>prophage 10
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	168218	177847	4233827	protease	Bodo_saltans_virus(25.0%)	7	NA	NA
WP_000897185.1|168218_169181_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.8	5.9e-24
WP_002000060.1|169328_170186_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	7.6e-15
WP_000372632.1|170244_171615_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_024437079.1|171638_173018_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_001238909.1|173118_174150_-	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	39.2	5.0e-61
WP_000339843.1|174605_175985_-	amino acid permease	NA	NA	NA	NA	NA
WP_000469459.1|176125_177847_-	alpha-keto acid decarboxylase family protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.1	3.5e-27
>prophage 11
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	181780	183154	4233827		Klosneuvirus(100.0%)	1	NA	NA
WP_000117540.1|181780_183154_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.2e-24
>prophage 12
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	189881	192719	4233827		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000413591.1|189881_192719_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	4.3e-22
>prophage 13
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	199694	202457	4233827		Tupanvirus(100.0%)	1	NA	NA
WP_000480983.1|199694_202457_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.3	3.7e-18
>prophage 14
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	208643	209900	4233827		Phage_21(100.0%)	1	NA	NA
WP_000542119.1|208643_209900_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	2.4e-17
>prophage 15
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	215520	220389	4233827		Stx2-converting_phage(50.0%)	4	NA	NA
WP_000667905.1|215520_216840_+	D-alanyl-D-alanine carboxypeptidase PBP6B	NA	B6DZZ7	Stx2-converting_phage	39.1	1.7e-37
WP_000193148.1|216938_218225_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000123995.1|218360_218843_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000063718.1|218946_220389_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	32.7	1.9e-58
>prophage 16
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	226192	227329	4233827		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000718053.1|226192_227329_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.1	3.7e-25
>prophage 17
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	233674	234808	4233827		Streptococcus_phage(100.0%)	1	NA	NA
WP_000573841.1|233674_234808_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.1	1.6e-68
>prophage 18
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	240491	244165	4233827		Tupanvirus(50.0%)	3	NA	NA
WP_000885644.1|240491_241079_-	lipocalin family protein	NA	A0A2K9L4H1	Tupanvirus	33.5	2.5e-17
WP_001004983.1|241172_243194_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_000222202.1|243373_244165_+	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	48.7	8.8e-26
>prophage 19
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	253867	262853	4233827		Streptococcus_phage(50.0%)	9	NA	NA
WP_000160699.1|253867_254560_-	ribonuclease III	NA	M1H9B8	Acanthocystis_turfacea_Chlorella_virus	37.0	2.6e-21
WP_001224037.1|254531_254906_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_024437344.1|254930_255758_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000035781.1|255828_257646_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	1.7e-19
WP_000094834.1|257820_258273_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_085940499.1|258393_259785_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	4.7e-22
WP_000367530.1|260000_261644_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000842534.1|261698_262115_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000470765.1|262253_262853_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.1	1.5e-33
>prophage 20
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	268463	269525	4233827		Bacillus_virus(100.0%)	1	NA	NA
WP_000027499.1|268463_269525_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	9.7e-28
>prophage 21
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	272554	283755	4233827		Bacillus_phage(16.67%)	11	NA	NA
WP_000157724.1|272554_273265_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.7	5.7e-40
WP_001984660.1|273293_273977_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	38.4	6.7e-30
WP_000771346.1|273990_274407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157855.1|274497_275184_+	diphthine--ammonia ligase	NA	NA	NA	NA	NA
WP_001293529.1|275201_275663_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_001050700.1|275785_276355_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_001991184.1|276425_277016_-	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	A0A292GDD2	Xanthomonas_phage	36.3	1.3e-21
WP_000175549.1|277125_277926_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_000916030.1|277922_278240_-	NIF3-like protein 1	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	28.4	1.1e-11
WP_050674945.1|278633_279800_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	28.8	3.1e-27
WP_024437347.1|279921_283755_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.5	4.1e-108
>prophage 22
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	294237	295209	4233827		Klosneuvirus(100.0%)	1	NA	NA
WP_002036892.1|294237_295209_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	5.5e-46
>prophage 23
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	304261	312142	4233827		Prochlorococcus_phage(20.0%)	7	NA	NA
WP_000071984.1|304261_305332_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.9	6.5e-80
WP_000975533.1|305328_305958_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.4e-26
WP_000114071.1|306021_306831_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001286612.1|306849_307866_-	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	26.5	5.5e-12
WP_001984639.1|308002_308986_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_000472709.1|308938_311371_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	31.4	5.9e-28
WP_000049406.1|311455_312142_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	36.2	3.4e-34
>prophage 24
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	316457	317537	4233827		Streptococcus_phage(100.0%)	1	NA	NA
WP_001203177.1|316457_317537_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	50.3	4.8e-91
>prophage 25
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	323815	332987	4233827		Shigella_phage(33.33%)	7	NA	NA
WP_001022408.1|323815_324796_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	45.9	1.2e-67
WP_000494034.1|324795_325176_+	GtrA family protein	NA	NA	NA	NA	NA
WP_001188095.1|325185_326832_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_000116444.1|326882_329597_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.4	8.7e-97
WP_000025985.1|329963_330896_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_000646179.1|330913_331663_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_070148719.1|332099_332987_-	tyrosine recombinase XerC	NA	A0A2L1IV36	Escherichia_phage	32.4	2.7e-15
>prophage 26
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	340750	342789	4233827		Tupanvirus(50.0%)	2	NA	NA
WP_000059551.1|340750_341725_-	EF-P lysine aminoacylase GenX	NA	A0A2K9KZX5	Tupanvirus	29.0	5.8e-27
WP_000706070.1|341721_342789_-	4-phosphoerythronate dehydrogenase	NA	M1NSB9	Streptococcus_phage	29.2	2.0e-17
>prophage 27
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	347079	348246	4233827		Streptococcus_phage(100.0%)	1	NA	NA
WP_000869492.1|347079_348246_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.6	1.8e-38
>prophage 28
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	357295	361294	4233827		Tupanvirus(100.0%)	1	NA	NA
WP_001071466.1|357295_361294_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	33.3	1.5e-68
>prophage 29
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	365351	367624	4233827	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_000271249.1|365351_366257_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.6	6.2e-92
WP_002010827.1|366847_367624_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	53.6	2.4e-36
>prophage 30
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	375649	377633	4233827		uncultured_virus(100.0%)	2	NA	NA
WP_001274623.1|375649_377284_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.9	8.1e-175
WP_000065579.1|377342_377633_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	2.3e-16
>prophage 31
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	395505	399153	4233827		Burkholderia_virus(50.0%)	4	NA	NA
WP_001984607.1|395505_396837_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.8	3.1e-39
WP_001043188.1|396953_397376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278002.1|397395_398064_-	methyltransferase	NA	NA	NA	NA	NA
WP_001229846.1|398304_399153_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.4	1.6e-25
>prophage 32
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	403473	406154	4233827		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001286662.1|403473_405369_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	46.4	1.4e-106
WP_000235573.1|405503_406154_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	A0A140HEP8	Marsac_virus	25.1	4.1e-05
>prophage 33
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	413215	413848	4233827		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000380745.1|413215_413848_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	35.5	3.5e-17
>prophage 34
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	435917	437420	4233827		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000526259.1|435917_437420_-	cation:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	32.2	2.6e-18
>prophage 35
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	441142	444795	4233827		Tupanvirus(50.0%)	3	NA	NA
WP_000114637.1|441142_442033_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	2.9e-17
WP_001048573.1|442047_443214_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000082616.1|443361_444795_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	1.2e-41
>prophage 36
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	457919	459806	4233827		Vibrio_phage(100.0%)	1	NA	NA
WP_001281941.1|457919_459806_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.3e-38
>prophage 37
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	467615	468887	4233827	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000566834.1|467615_468887_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.9	2.0e-96
>prophage 38
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	484763	487643	4233827	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_000128724.1|484763_487643_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	2.8e-146
>prophage 39
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	491939	493127	4233827		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_024437369.1|491939_493127_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.0	3.1e-43
>prophage 40
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	503290	504145	4233827		Pandoravirus(100.0%)	1	NA	NA
WP_001143941.1|503290_504145_+	SPFH/Band 7/PHB domain protein	NA	S4VVY8	Pandoravirus	29.3	4.0e-08
>prophage 41
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	508952	511066	4233827	integrase	Stenotrophomonas_phage(50.0%)	2	504000:504017	514925:514942
504000:504017	attL	ATAAAGAAATTCCTGTTG	NA	NA	NA	NA
WP_001127116.1|508952_510197_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.5	3.6e-82
WP_024437372.1|510511_511066_-	lysozyme	NA	A0A068CDE9	Acinetobacter_phage	79.9	2.2e-79
514925:514942	attR	CAACAGGAATTTCTTTAT	NA	NA	NA	NA
>prophage 42
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	515063	521375	4233827	terminase	uncultured_Caudovirales_phage(50.0%)	8	NA	NA
WP_078216180.1|515063_516722_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	44.3	2.6e-128
WP_017724836.1|516724_517039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165381259.1|517184_517328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437259.1|517364_517565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437260.1|517694_518123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437261.1|518133_518325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437262.1|518392_518695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437263.1|518849_521375_-	hypothetical protein	NA	A0A0F7L5T6	uncultured_marine_virus	24.6	2.6e-47
>prophage 43
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	526855	544541	4233827	tail,head	Acinetobacter_phage(72.22%)	30	NA	NA
WP_024437267.1|526855_528934_-	carbohydrate-binding protein	NA	A0A1B1IW99	uncultured_Mediterranean_phage	27.0	4.0e-33
WP_005134913.1|528933_529494_-	hypothetical protein	NA	A0A1B1IRI7	uncultured_Mediterranean_phage	36.3	1.5e-24
WP_024437268.1|529598_530498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437269.1|530509_531133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437270.1|531125_531611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437271.1|531607_533251_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	45.2	1.3e-124
WP_024437272.1|533252_533483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437273.1|533482_533806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437274.1|533872_534076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437275.1|534166_534370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437276.1|534366_534789_-	hypothetical protein	NA	A0A068CBJ8	Acinetobacter_phage	47.9	1.2e-08
WP_024437277.1|534790_535063_-	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	53.8	4.1e-15
WP_024437278.1|535224_535566_-	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	72.6	1.1e-38
WP_031971942.1|535562_535967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437280.1|535976_536483_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1X9SFE9	Acinetobacter_phage	55.2	5.1e-27
WP_024437281.1|536457_536853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437072.1|537034_538360_-	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	99.1	4.0e-249
WP_024437071.1|538359_539103_-	replication protein	NA	A0A0P0HSN8	Acinetobacter_phage	89.5	3.2e-46
WP_162899104.1|539099_539273_-	hypothetical protein	NA	A0A0P0J0G1	Acinetobacter_phage	98.2	1.2e-25
WP_024437070.1|539473_539740_-	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	74.1	8.3e-29
WP_024437069.1|539750_539936_-	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	59.3	2.1e-10
WP_031971876.1|540035_540779_+	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	61.5	5.3e-81
WP_171068622.1|541012_541360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991219.1|541379_541646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993558.1|541903_542842_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	82.3	7.5e-141
WP_024437066.1|542838_543498_+	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	58.6	3.1e-77
WP_024437065.1|543494_543758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437064.1|543769_544147_+	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	94.7	6.5e-35
WP_000028947.1|544143_544353_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
WP_001288762.1|544349_544541_+	hypothetical protein	NA	A0A0D4DCB1	Acinetobacter_phage	95.2	3.9e-28
>prophage 44
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	569973	572022	4233827		Klosneuvirus(100.0%)	1	NA	NA
WP_000836154.1|569973_572022_-	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	29.5	7.5e-93
>prophage 45
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	575154	576090	4233827		Klosneuvirus(100.0%)	1	NA	NA
WP_002027092.1|575154_576090_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	29.4	1.5e-08
>prophage 46
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	579638	580853	4233827		Salmonella_phage(100.0%)	1	NA	NA
WP_000003698.1|579638_580853_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.9	1.0e-28
>prophage 47
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	592569	605941	4233827		Bacillus_phage(20.0%)	8	NA	NA
WP_000658906.1|592569_597090_-	Hpt domain-containing protein	NA	W8CYM9	Bacillus_phage	39.5	1.1e-16
WP_000505936.1|597236_599315_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.0	1.6e-18
WP_000729759.1|599361_599898_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_000101096.1|599958_600321_-	response regulator	NA	A0A220YL79	Alteromonas_virus	31.3	8.7e-13
WP_000389061.1|600344_600728_-	response regulator	NA	Q8QKV4	Ectocarpus_siliculosus_virus	27.9	5.4e-05
WP_001981151.1|601049_601649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260821.1|601708_602827_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024437249.1|602842_605941_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	27.5	1.1e-95
>prophage 48
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	614649	627293	4233827		Salmonella_phage(20.0%)	11	NA	NA
WP_086242031.1|614649_616737_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	49.3	3.8e-92
WP_001280163.1|616911_617478_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_001114564.1|617553_618378_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	29.7	3.2e-26
WP_001192454.1|618397_618688_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_001984816.1|618698_619052_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000022555.1|619193_619625_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_001280092.1|619880_621716_-	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	39.4	2.3e-21
WP_000070856.1|621894_623253_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.0	2.2e-24
WP_000371525.1|623315_624329_+	methyltransferase	NA	NA	NA	NA	NA
WP_060454631.1|624350_625811_+	amino acid permease	NA	NA	NA	NA	NA
WP_000354412.1|626087_627293_+	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	58.4	6.1e-127
>prophage 49
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	631443	631797	4233827		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000457786.1|631443_631797_-	quaternary ammonium compound resistance protein	NA	I3WVW1	Acinetobacter_phage	59.8	1.0e-26
>prophage 50
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	669548	673027	4233827		Diadromus_pulchellus_ascovirus(33.33%)	3	NA	NA
WP_000199593.1|669548_670721_+	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	32.3	2.5e-32
WP_024437253.1|670834_672277_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.6	7.7e-44
WP_000680577.1|672340_673027_-	response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
>prophage 51
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	685769	690219	4233827	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_000986451.1|685769_687548_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
WP_086242028.1|687600_688608_-	stealth conserved region 3 domain-containing protein	NA	NA	NA	NA	NA
WP_001251490.1|688831_689047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000670279.1|689097_690219_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	43.2	1.5e-79
>prophage 52
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	711847	717653	4233827	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_000667231.1|711847_712981_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
WP_000051669.1|713079_713409_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_001270222.1|713460_715362_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_001984787.1|715370_716336_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_000006958.1|716399_717653_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
>prophage 53
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	725619	726954	4233827		Indivirus(50.0%)	2	NA	NA
WP_000587649.1|725619_726057_-	thioredoxin TrxC	NA	A0A1V0SD63	Indivirus	39.0	9.9e-11
WP_000543478.1|726057_726954_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	28.8	6.7e-22
>prophage 54
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	737488	738589	4233827		Bacillus_phage(100.0%)	1	NA	NA
WP_000451187.1|737488_738589_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.4	1.8e-13
>prophage 55
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	750380	750809	4233827	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000003705.1|750380_750809_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.3	3.8e-31
>prophage 56
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	757217	758144	4233827		Mollivirus(100.0%)	1	NA	NA
WP_086242021.1|757217_758144_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	22.3	4.1e-06
>prophage 57
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	775507	780317	4233827	tRNA	Bacillus_phage(50.0%)	3	NA	NA
WP_000792526.1|775507_777451_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	39.7	7.5e-10
WP_000218141.1|777739_779191_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_001986628.1|779273_780317_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.9	1.1e-47
>prophage 58
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	794507	799128	4233827		Lactococcus_phage(50.0%)	2	NA	NA
WP_086241958.1|794507_796940_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.7	3.3e-71
WP_024437244.1|797073_799128_+	M3 family metallopeptidase	NA	A0A1V0SIU1	Klosneuvirus	20.5	1.1e-30
>prophage 59
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	824522	826070	4233827		Klebsiella_phage(100.0%)	1	NA	NA
WP_000537117.1|824522_826070_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	40.9	1.2e-74
>prophage 60
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	839636	840218	4233827		Orpheovirus(100.0%)	1	NA	NA
WP_001084311.1|839636_840218_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.2	9.1e-12
>prophage 61
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	843878	846948	4233827		Planktothrix_phage(50.0%)	3	NA	NA
WP_002019647.1|843878_844697_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.5e-23
WP_000471151.1|844823_845009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000047395.1|845100_846948_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	27.6	8.9e-45
>prophage 62
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	850519	851122	4233827		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001121174.1|850519_851122_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.4	8.7e-42
>prophage 63
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	879606	880821	4233827		Klosneuvirus(100.0%)	1	NA	NA
WP_000437499.1|879606_880821_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.4	3.0e-25
>prophage 64
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	891247	895434	4233827		Salmonella_phage(100.0%)	3	NA	NA
WP_001143885.1|891247_891823_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.1	7.1e-41
WP_001061810.1|892017_894168_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000790118.1|894204_895434_-	MFS transporter	NA	S4TR35	Salmonella_phage	22.3	4.6e-13
>prophage 65
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	901197	902430	4233827		Catovirus(100.0%)	1	NA	NA
WP_000077814.1|901197_902430_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	6.3e-103
>prophage 66
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	920220	923515	4233827		Liberibacter_phage(50.0%)	3	NA	NA
WP_000015937.1|920220_920850_+	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	30.6	6.8e-13
WP_000135049.1|920922_921201_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001117590.1|921409_923515_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.3	5.3e-09
>prophage 67
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	929505	930096	4233827		Lactococcus_phage(100.0%)	1	NA	NA
WP_000846931.1|929505_930096_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.7	8.9e-15
>prophage 68
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	965992	969151	4233827		Leptospira_phage(100.0%)	1	NA	NA
WP_000353977.1|965992_969151_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VL66	Leptospira_phage	21.0	2.7e-25
>prophage 69
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	975586	978824	4233827		Streptococcus_phage(50.0%)	2	NA	NA
WP_000090021.1|975586_977248_-	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	27.4	5.8e-43
WP_000221160.1|977546_978824_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	26.3	5.3e-12
>prophage 70
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	985551	987791	4233827		Bacillus_phage(100.0%)	2	NA	NA
WP_000060753.1|985551_986316_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.2	2.8e-29
WP_000051217.1|986333_987791_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.4	2.0e-15
>prophage 71
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1003198	1027102	4233827	transposase	Escherichia_phage(25.0%)	21	NA	NA
WP_086242037.1|1003198_1004302_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	37.0	5.0e-27
WP_000581860.1|1004533_1004977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001181667.1|1005032_1006910_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	32.9	8.7e-72
WP_001017479.1|1007181_1007523_-	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_106451081.1|1007719_1008810_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001043260.1|1008899_1009715_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|1009801_1010104_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|1009997_1010249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|1011173_1011878_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_000960976.1|1012100_1012673_+	aminoglycoside N-acetyltransferase AAC(6')-Ian	NA	A0A0N9SKF6	Staphylococcus_phage	40.1	8.0e-37
WP_000093022.1|1013329_1014859_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067784.1|1015004_1015709_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_031944396.1|1015935_1017141_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	58.9	1.5e-112
WP_031944395.1|1017133_1018399_-	CmlA/FloR family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	29.0	4.1e-25
WP_005119228.1|1018946_1021865_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000963725.1|1022318_1022849_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_001057867.1|1023081_1023492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000656635.1|1023707_1024130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|1024271_1025108_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|1025107_1025911_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_085940648.1|1026012_1027102_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 72
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1052017	1053043	4233827	transposase	Faecalibacterium_phage(100.0%)	1	NA	NA
WP_010326927.1|1052017_1053043_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
>prophage 73
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1058329	1061278	4233827		Klosneuvirus(50.0%)	2	NA	NA
WP_000380899.1|1058329_1059622_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.2e-25
WP_000179711.1|1059733_1061278_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.7	6.6e-17
>prophage 74
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1064757	1067984	4233827		Salmonella_phage(50.0%)	3	NA	NA
WP_001215080.1|1064757_1065339_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	57.6	9.6e-38
WP_000980460.1|1065390_1066755_-	MFS transporter	NA	NA	NA	NA	NA
WP_000680213.1|1066901_1067984_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	52.3	2.4e-90
>prophage 75
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1071663	1080157	4233827	holin	uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_000083357.1|1071663_1074498_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.5	0.0e+00
WP_000016109.1|1074531_1076238_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.9	2.9e-13
WP_000733005.1|1077230_1078130_+	porin Omp33-36	NA	NA	NA	NA	NA
WP_001139475.1|1078189_1080157_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	1.7e-25
>prophage 76
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1083415	1086913	4233827		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_001089746.1|1083415_1086913_+	hybrid sensor histidine kinase/response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	24.0	1.0e-12
>prophage 77
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1092239	1094189	4233827		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001002965.1|1092239_1094189_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.7	1.9e-93
>prophage 78
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1099885	1107506	4233827		Pseudomonas_phage(33.33%)	6	NA	NA
WP_096640204.1|1099885_1100981_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	4.4e-07
WP_000731729.1|1101373_1102141_+	putative porin	NA	NA	NA	NA	NA
WP_000161620.1|1102184_1103885_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	3.5e-64
WP_002000775.1|1103885_1104551_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_000119865.1|1104552_1105890_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_000956023.1|1106039_1107506_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	1.9e-90
>prophage 79
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1117545	1118238	4233827		Bacillus_virus(100.0%)	1	NA	NA
WP_000557460.1|1117545_1118238_-	M23 family metallopeptidase	NA	G3MBP9	Bacillus_virus	39.3	4.5e-18
>prophage 80
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1132510	1134055	4233827		Burkholderia_phage(100.0%)	1	NA	NA
WP_000429584.1|1132510_1134055_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	25.0	8.6e-09
>prophage 81
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1137907	1140188	4233827		Tupanvirus(50.0%)	2	NA	NA
WP_001025108.1|1137907_1138819_+	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	28.2	1.9e-08
WP_161631889.1|1139105_1140188_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.3	3.6e-22
>prophage 82
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1151281	1153165	4233827		Bacillus_virus(100.0%)	1	NA	NA
WP_000195970.1|1151281_1153165_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.4	4.9e-99
>prophage 83
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1160244	1163628	4233827		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000898334.1|1160244_1163628_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	71.9	0.0e+00
>prophage 84
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1173224	1175303	4233827		Bacillus_phage(100.0%)	2	NA	NA
WP_000650776.1|1173224_1173935_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	36.2	3.0e-33
WP_000273191.1|1173944_1175303_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.1	2.7e-30
>prophage 85
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1178635	1179850	4233827		Agrobacterium_phage(100.0%)	1	NA	NA
WP_000074557.1|1178635_1179850_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	4.3e-48
>prophage 86
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1184808	1191523	4233827		Staphylococcus_phage(50.0%)	7	NA	NA
WP_001131392.1|1184808_1185930_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	34.9	1.9e-53
WP_001007829.1|1185941_1186412_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.3	5.2e-34
WP_000084188.1|1186415_1186865_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_000807411.1|1186880_1187798_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_000380675.1|1187775_1188291_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_000108581.1|1188307_1189672_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.6	5.8e-33
WP_000334175.1|1189684_1191523_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.0	3.8e-128
>prophage 87
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1198917	1200456	4233827		Catovirus(100.0%)	1	NA	NA
WP_024437650.1|1198917_1200456_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	7.1e-88
>prophage 88
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1204148	1205261	4233827		Gordonia_phage(100.0%)	1	NA	NA
WP_001246961.1|1204148_1205261_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	25.6	9.6e-10
>prophage 89
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1217516	1225759	4233827		Tupanvirus(20.0%)	10	NA	NA
WP_024437648.1|1217516_1218161_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	40.2	2.5e-26
WP_000193598.1|1218490_1219384_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_001177091.1|1219399_1220002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917863.1|1220039_1220759_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	35.8	3.1e-38
WP_000418560.1|1220951_1221155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349492.1|1221440_1222280_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	36.7	1.3e-40
WP_001285409.1|1222294_1223560_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	4.5e-80
WP_161631890.1|1223665_1224787_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_000102817.1|1224947_1225406_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000490267.1|1225600_1225759_+	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	60.8	6.2e-08
>prophage 90
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1229859	1234590	4233827		Tupanvirus(50.0%)	6	NA	NA
WP_000069845.1|1229859_1230888_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	30.7	6.5e-45
WP_000143941.1|1230890_1232315_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002009488.1|1232275_1232398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770092.1|1232405_1232780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843075.1|1232763_1233666_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001025224.1|1233786_1234590_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.3	6.0e-38
>prophage 91
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1238000	1239113	4233827		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_001119029.1|1238000_1239113_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.3	1.9e-29
>prophage 92
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1247891	1249187	4233827		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002057504.1|1247891_1249187_+	pyrimidine permease RutG	NA	Q9KX94	Enterobacteria_phage	65.1	3.2e-150
>prophage 93
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1254756	1255719	4233827	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000691201.1|1254756_1255719_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.1	2.9e-07
>prophage 94
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1270354	1270690	4233827		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_000993572.1|1270354_1270690_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
>prophage 95
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1274684	1285760	4233827		Tupanvirus(20.0%)	10	NA	NA
WP_000613987.1|1274684_1276616_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	1.6e-65
WP_001009202.1|1276867_1277425_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_000987638.1|1277510_1277903_-	cytochrome b562	NA	NA	NA	NA	NA
WP_000093726.1|1277940_1280409_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	7.6e-116
WP_000550811.1|1280461_1281544_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_170318963.1|1281558_1282308_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	31.9	1.1e-30
WP_000964768.1|1282804_1284202_-	chromosomal replication initiator protein DnaA	NA	A0A1B1IPE6	uncultured_Mediterranean_phage	31.0	5.2e-05
WP_000831329.1|1284872_1285007_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_001240377.1|1285036_1285429_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000251652.1|1285439_1285760_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	49.4	6.3e-15
>prophage 96
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1291590	1297753	4233827		uncultured_virus(33.33%)	6	NA	NA
WP_000214980.1|1291590_1292118_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.5	3.6e-15
WP_000052276.1|1292332_1293658_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001100889.1|1293714_1294770_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_000823194.1|1295060_1296221_-	glutathionylspermidine synthase family protein	NA	E5E3Y5	Acinetobacter_phage	44.5	1.2e-95
WP_001256723.1|1296242_1296608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000447698.1|1296796_1297753_-	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	32.8	1.3e-31
>prophage 97
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1302284	1302797	4233827		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000994663.1|1302284_1302797_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.0e-19
>prophage 98
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1308787	1310728	4233827		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001062605.1|1308787_1310728_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.3	2.2e-147
>prophage 99
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1314799	1316571	4233827		Tupanvirus(50.0%)	2	NA	NA
WP_000123590.1|1314799_1315870_+	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	27.3	9.8e-12
WP_161605669.1|1316085_1316571_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	37.0	9.6e-15
>prophage 100
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1324501	1327339	4233827	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_024437463.1|1324501_1327339_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.0	7.2e-78
>prophage 101
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1331306	1332107	4233827		Bacillus_virus(100.0%)	1	NA	NA
WP_000183288.1|1331306_1332107_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.9	4.3e-28
>prophage 102
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1354869	1357056	4233827		Streptococcus_phage(100.0%)	1	NA	NA
WP_031975052.1|1354869_1357056_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	34.2	1.8e-20
>prophage 103
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1362734	1369932	4233827		uncultured_marine_virus(25.0%)	7	NA	NA
WP_050591082.1|1362734_1363703_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	41.1	2.1e-13
WP_031975045.1|1363699_1364890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031975044.1|1364886_1365966_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_060454593.1|1365966_1366743_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.0	8.4e-13
WP_031975042.1|1366771_1367938_+	nucleotide sugar dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	53.6	2.7e-108
WP_031974854.1|1368411_1369032_+	sugar transferase	NA	NA	NA	NA	NA
WP_031974853.1|1369056_1369932_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.5	4.2e-61
>prophage 104
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1372969	1373989	4233827		Tupanvirus(100.0%)	1	NA	NA
WP_024437046.1|1372969_1373989_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	45.2	6.8e-79
>prophage 105
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1416354	1418004	4233827		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002080114.1|1416354_1418004_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	39.6	5.3e-81
>prophage 106
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1421095	1433578	4233827		Burkholderia_virus(25.0%)	8	NA	NA
WP_001193289.1|1421095_1422448_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	2.9e-53
WP_000387874.1|1422503_1423070_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060454585.1|1423133_1423550_-	DUF4902 domain-containing protein	NA	NA	NA	NA	NA
WP_000446782.1|1424310_1425027_+	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	28.2	7.3e-19
WP_024437318.1|1425649_1427539_+	fatty acyl-AMP ligase	NA	A0A1V0SBX8	Catovirus	22.5	3.0e-11
WP_085947910.1|1427589_1429365_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001030690.1|1429361_1429622_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_001060979.1|1429618_1433578_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.5	2.4e-111
>prophage 107
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1442511	1443354	4233827		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000957990.1|1442511_1443354_+	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.5	1.0e-11
>prophage 108
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1447501	1449070	4233827		Hokovirus(100.0%)	1	NA	NA
WP_000210750.1|1447501_1449070_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	4.3e-24
>prophage 109
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1454150	1455941	4233827	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_001090281.1|1454150_1455941_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	21.2	1.9e-15
>prophage 110
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1460689	1461478	4233827		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001112013.1|1460689_1461478_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	2.8e-16
>prophage 111
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1475929	1479508	4233827		Pandoravirus(33.33%)	4	NA	NA
WP_000633612.1|1475929_1476499_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	26.4	5.1e-07
WP_031971973.1|1476549_1477680_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.0	1.1e-24
WP_000755271.1|1477700_1478855_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001196539.1|1478977_1479508_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.6	3.8e-17
>prophage 112
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1491191	1492118	4233827		Lactococcus_phage(100.0%)	1	NA	NA
WP_165381589.1|1491191_1492118_+	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	52.1	1.2e-71
>prophage 113
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1496264	1498643	4233827		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000102049.1|1496264_1498643_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	79.2	2.8e-115
>prophage 114
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1503770	1514876	4233827		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_001986939.1|1503770_1504376_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.8	2.5e-12
WP_000575778.1|1504720_1506313_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	8.8e-41
WP_000194004.1|1506384_1506852_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000927792.1|1506897_1507542_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000366687.1|1507624_1508944_+	MFS transporter	NA	NA	NA	NA	NA
WP_000202252.1|1509097_1511317_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.9	3.2e-81
WP_000411994.1|1511614_1513294_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.2e-34
WP_001187001.1|1513332_1513716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001985514.1|1513810_1514221_+	MAPEG family protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	43.8	2.4e-14
WP_000122443.1|1514348_1514876_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	9.6e-61
>prophage 115
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1523764	1531804	4233827		Staphylococcus_phage(40.0%)	9	NA	NA
WP_000738520.1|1523764_1525162_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
WP_000543541.1|1525320_1525779_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_001292504.1|1525794_1526880_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	1.9e-47
WP_001083669.1|1526876_1528169_+	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_000493866.1|1528211_1528871_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_000354154.1|1528929_1529148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002041864.1|1529278_1529917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151592.1|1529955_1530363_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000673455.1|1530355_1531804_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
>prophage 116
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1535806	1536991	4233827		Moraxella_phage(100.0%)	1	NA	NA
WP_000939105.1|1535806_1536991_+	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
>prophage 117
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1545723	1546644	4233827		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000608735.1|1545723_1546644_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	2.3e-33
>prophage 118
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1574710	1581855	4233827		Vibrio_phage(33.33%)	5	NA	NA
WP_024437337.1|1574710_1576981_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	34.9	9.0e-31
WP_024437338.1|1577021_1577651_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_000109463.1|1577716_1578385_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_000209090.1|1578493_1579987_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	30.4	3.0e-35
WP_001029610.1|1580664_1581855_+	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
>prophage 119
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1585829	1596822	4233827		Tetraselmis_virus(33.33%)	6	NA	NA
WP_000331899.1|1585829_1589918_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.0	3.6e-22
WP_000653927.1|1590004_1594198_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	1.2e-68
WP_000738603.1|1594364_1594730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034851.1|1594943_1595300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996189.1|1595328_1595826_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_001987811.1|1595943_1596822_+	alpha/beta fold hydrolase	NA	A0A218MNI3	uncultured_virus	30.9	7.8e-07
>prophage 120
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1599910	1601830	4233827		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001294945.1|1599910_1601830_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	2.6e-119
>prophage 121
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1611865	1612780	4233827		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000598900.1|1611865_1612780_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.3	4.0e-38
>prophage 122
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1619586	1620441	4233827		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001178158.1|1619586_1620441_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.3	4.7e-17
>prophage 123
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1640874	1643574	4233827		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000130326.1|1640874_1643574_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	7.2e-27
>prophage 124
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1651996	1657493	4233827		Acinetobacter_phage(50.0%)	4	NA	NA
WP_000065138.1|1651996_1653499_-	AAA family ATPase	NA	A0A075DXT4	Acinetobacter_phage	36.0	2.4e-80
WP_001066566.1|1653508_1654282_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000856580.1|1654435_1655749_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_000612212.1|1655873_1657493_-	2-octaprenylphenol hydroxylase	NA	A0A0P0C0S7	Ostreococcus_mediterraneus_virus	25.9	5.4e-30
>prophage 125
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1665972	1671513	4233827		Bacillus_phage(50.0%)	2	NA	NA
WP_086242022.1|1665972_1669653_+	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	22.1	1.3e-10
WP_000369434.1|1669761_1671513_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	23.0	6.8e-18
>prophage 126
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1678238	1679195	4233827		Megavirus(100.0%)	1	NA	NA
WP_001107916.1|1678238_1679195_-	DnaJ domain-containing protein	NA	K7YGN1	Megavirus	50.6	1.4e-12
>prophage 127
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1696933	1703462	4233827		Streptococcus_phage(33.33%)	9	NA	NA
WP_000942274.1|1696933_1697578_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.6	5.3e-21
WP_001138289.1|1697574_1697769_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_161631880.1|1697856_1698495_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000066773.1|1698484_1699690_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_000075982.1|1699767_1700178_+	GFA family protein	NA	NA	NA	NA	NA
WP_000291735.1|1700413_1700794_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.2	1.4e-24
WP_000046495.1|1701222_1701555_-	HopJ type III effector protein	NA	NA	NA	NA	NA
WP_001224256.1|1701807_1702062_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001096917.1|1702163_1703462_-	ABC transporter	NA	G9E4X0	Ostreococcus_lucimarinus_virus	31.1	2.2e-29
>prophage 128
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1727223	1729518	4233827		Hokovirus(100.0%)	1	NA	NA
WP_000069121.1|1727223_1729518_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.2	4.7e-19
>prophage 129
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1750348	1762826	4233827		Morganella_phage(25.0%)	11	NA	NA
WP_000078874.1|1750348_1751284_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	33.0	1.0e-41
WP_000886289.1|1751403_1752036_-	LysE family translocator	NA	NA	NA	NA	NA
WP_060454578.1|1752181_1754092_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.1	8.3e-46
WP_000165735.1|1754124_1754370_+	SlyX family protein	NA	NA	NA	NA	NA
WP_000648650.1|1754417_1755428_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001029768.1|1755527_1755905_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000368721.1|1756052_1756502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024261.1|1756537_1759174_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.5	2.0e-90
WP_000265764.1|1759261_1760020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454577.1|1760157_1760730_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_000050361.1|1760846_1762826_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	28.4	7.0e-64
>prophage 130
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1774108	1775505	4233827		Erwinia_phage(50.0%)	2	NA	NA
WP_000312550.1|1774108_1774618_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.0	3.1e-24
WP_060454576.1|1774662_1775505_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	61.4	3.5e-97
>prophage 131
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1785820	1786444	4233827		Cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_000106722.1|1785820_1786444_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	D2KCJ6	Cassava_brown_streak_virus	30.7	8.8e-13
>prophage 132
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1791189	1791882	4233827		Synechococcus_phage(100.0%)	1	NA	NA
WP_085941346.1|1791189_1791882_-	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	34.2	1.3e-20
>prophage 133
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1796208	1798229	4233827	protease	Agrobacterium_phage(50.0%)	2	NA	NA
WP_000289452.1|1796208_1796814_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.6	1.2e-62
WP_001289250.1|1796915_1798229_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.0e-127
>prophage 134
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1812203	1813469	4233827		Streptococcus_phage(100.0%)	1	NA	NA
WP_001154159.1|1812203_1813469_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.9	3.6e-98
>prophage 135
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1817514	1822556	4233827		Moraxella_phage(50.0%)	5	NA	NA
WP_000776302.1|1817514_1819698_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	48.7	2.0e-184
WP_086242039.1|1819836_1821135_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_000669565.1|1821159_1821711_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000524329.1|1821810_1822011_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000963851.1|1822124_1822556_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.5	6.7e-20
>prophage 136
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1826642	1827935	4233827	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000095264.1|1826642_1827935_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	5.3e-20
>prophage 137
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1832731	1835265	4233827		Salicola_phage(50.0%)	4	NA	NA
WP_000729828.1|1832731_1832989_-	glutaredoxin 3	NA	A0A248SKD6	Salicola_phage	39.7	1.2e-08
WP_000443006.1|1833000_1833417_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001173996.1|1833514_1834573_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000099436.1|1834698_1835265_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	2.0e-27
>prophage 138
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1838578	1852861	4233827	tRNA	Planktothrix_phage(20.0%)	10	NA	NA
WP_000165901.1|1838578_1840573_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.6e-36
WP_001124213.1|1840575_1841913_-	MacA family efflux pump subunit	NA	A0A140XAI1	Dickeya_phage	50.0	9.7e-17
WP_000762833.1|1842020_1843010_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_000549819.1|1843029_1843539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437439.1|1843566_1846191_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.4	1.5e-175
WP_001054469.1|1846377_1846707_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_000422094.1|1847211_1848936_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	5.4e-52
WP_001215920.1|1848935_1849427_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_001165443.1|1849459_1850476_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000510211.1|1850806_1852861_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.9	2.6e-21
>prophage 139
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1856219	1857812	4233827		Tupanvirus(100.0%)	1	NA	NA
WP_000008538.1|1856219_1857812_+	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	32.9	1.5e-11
>prophage 140
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1864164	1864929	4233827	tRNA	Pandoravirus(100.0%)	1	NA	NA
WP_001281713.1|1864164_1864929_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	29.6	1.5e-14
>prophage 141
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1878059	1884196	4233827		Hokovirus(33.33%)	4	NA	NA
WP_000064534.1|1878059_1880867_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	2.2e-50
WP_002000561.1|1881030_1881954_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.3	4.9e-52
WP_001212167.1|1881976_1882795_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_000813059.1|1882804_1884196_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.0	2.0e-28
>prophage 142
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1888802	1890236	4233827		unidentified_phage(100.0%)	1	NA	NA
WP_169518021.1|1888802_1890236_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.0	3.5e-20
>prophage 143
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1894162	1898682	4233827	tRNA	Staphylococcus_phage(33.33%)	3	NA	NA
WP_000253048.1|1894162_1895791_-	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	8.7e-28
WP_001121793.1|1896202_1898125_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.9	2.6e-124
WP_012297364.1|1898130_1898682_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.6	1.9e-11
>prophage 144
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1904794	1911230	4233827	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_000050952.1|1904794_1905775_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.8	1.2e-35
WP_000703082.1|1905807_1908189_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000126166.1|1908185_1908482_+	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	39.3	3.5e-12
WP_000897679.1|1908652_1908898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002127429.1|1908992_1909118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054522.1|1909313_1910582_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_001276875.1|1910903_1911230_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.2	2.0e-16
>prophage 145
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1916669	1919441	4233827		uncultured_virus(100.0%)	1	NA	NA
WP_001134654.1|1916669_1919441_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.5	1.4e-65
>prophage 146
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1943740	1945096	4233827		Pandoravirus(100.0%)	1	NA	NA
WP_031972009.1|1943740_1945096_-	chorismate-binding protein	NA	S4VNU7	Pandoravirus	35.9	1.8e-26
>prophage 147
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1959681	1959954	4233827		uncultured_virus(100.0%)	1	NA	NA
WP_000843452.1|1959681_1959954_-	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	45.3	1.1e-07
>prophage 148
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1966721	1967201	4233827		Streptococcus_phage(100.0%)	1	NA	NA
WP_000927480.1|1966721_1967201_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.9	4.5e-25
>prophage 149
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1983058	1984369	4233827		Burkholderia_virus(100.0%)	1	NA	NA
WP_000383636.1|1983058_1984369_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.9	1.5e-49
>prophage 150
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	1995767	2004502	4233827	transposase	uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_106451084.1|1995767_2001644_+	type I secretion C-terminal target domain-containing protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	33.5	2.3e-17
WP_001138355.1|2001725_2002055_-	darcynin	NA	NA	NA	NA	NA
WP_000005244.1|2002176_2002776_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000787022.1|2002844_2003156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|2003476_2004502_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
>prophage 151
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2010792	2020060	4233827		Bacillus_phage(40.0%)	8	NA	NA
WP_000025827.1|2010792_2012076_-	ribonucleotide-diphosphate reductase subunit beta	NA	M1IA80	Paramecium_bursaria_Chlorella_virus	33.4	5.4e-41
WP_000465010.1|2012213_2012348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111538.1|2012404_2015239_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.4	7.7e-181
WP_000143214.1|2015568_2015775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000076440.1|2015771_2016488_+	response regulator transcription factor BfmR	NA	W8CYM9	Bacillus_phage	37.7	3.1e-38
WP_000226706.1|2016577_2018170_+	sensor histidine kinase BfmS	NA	Q8QKV4	Ectocarpus_siliculosus_virus	23.6	9.2e-06
WP_011858483.1|2018192_2018492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001147029.1|2018638_2020060_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	8.7e-16
>prophage 152
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2055477	2056047	4233827		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000985728.1|2055477_2056047_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.0	3.3e-75
>prophage 153
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2075797	2077834	4233827		Ralstonia_phage(100.0%)	1	NA	NA
WP_001018835.1|2075797_2077834_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.3	4.6e-119
>prophage 154
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2083558	2089015	4233827		Klosneuvirus(33.33%)	6	NA	NA
WP_000131442.1|2083558_2084839_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.4	2.2e-18
WP_106451085.1|2084840_2085998_+	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	25.5	2.1e-31
WP_000055877.1|2085994_2086744_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000016597.1|2086744_2087389_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001291249.1|2087453_2088377_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000093856.1|2088418_2089015_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.2	4.2e-20
>prophage 155
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2093453	2097483	4233827		Trichoplusia_ni_ascovirus(33.33%)	6	NA	NA
WP_000191300.1|2093453_2094188_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	2.2e-18
WP_001279871.1|2094272_2094509_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	1.1e-11
WP_000522216.1|2094698_2095172_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_001247940.1|2095218_2095986_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_000985177.1|2096083_2096758_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_000096537.1|2096823_2097483_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.9	1.6e-41
>prophage 156
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2101807	2102758	4233827		Tupanvirus(100.0%)	1	NA	NA
WP_001133287.1|2101807_2102758_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.9	3.3e-43
>prophage 157
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2107744	2109610	4233827		Caulobacter_phage(100.0%)	1	NA	NA
WP_001007229.1|2107744_2109610_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.1	7.1e-58
>prophage 158
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2113611	2296527	4233827	tail,integrase,transposase,capsid,tRNA,head,protease,terminase,portal	Acinetobacter_phage(44.44%)	205	2155287:2155309	2283858:2283880
WP_001033994.1|2113611_2114085_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.3	4.2e-23
WP_000401871.1|2114186_2114387_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000927773.1|2114387_2114657_-	hypothetical protein	NA	A0A172Q0P4	Acinetobacter_phage	57.3	3.9e-18
WP_000877059.1|2114658_2114994_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	59.1	4.6e-32
WP_060454600.1|2114990_2115215_-	hypothetical protein	NA	I2GUB4	Acinetobacter_phage	94.5	4.1e-37
WP_000130788.1|2115201_2115582_-	hypothetical protein	NA	A0A0D4DBH6	Acinetobacter_phage	90.1	9.4e-42
WP_171059716.1|2115578_2116235_-	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	63.9	1.7e-78
WP_000868481.1|2116332_2116641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993561.1|2116640_2117579_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	84.3	3.8e-145
WP_000454771.1|2117588_2117774_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_001056565.1|2117773_2118154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371052.1|2118150_2118981_-	hypothetical protein	NA	I2GUJ1	Acinetobacter_phage	54.9	1.1e-66
WP_000380111.1|2118973_2119201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076125.1|2119200_2119392_-	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	66.7	1.9e-14
WP_010326927.1|2119822_2120848_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_002047920.1|2121185_2121869_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.2	6.9e-27
WP_001197739.1|2121980_2122163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454644.1|2122171_2122498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454645.1|2122513_2123353_+	replication protein	NA	NA	NA	NA	NA
WP_000065241.1|2123352_2124669_+	AAA family ATPase	NA	A0A2H4J6D5	uncultured_Caudovirales_phage	74.5	3.6e-165
WP_000854669.1|2124665_2124923_+	hypothetical protein	NA	A0A2H4J6Z3	uncultured_Caudovirales_phage	61.5	7.3e-22
WP_171262028.1|2124919_2125096_+	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	84.5	9.7e-18
WP_060454646.1|2125092_2125626_+	hypothetical protein	NA	M4SN77	Psychrobacter_phage	44.0	1.2e-29
WP_106451086.1|2125622_2125964_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	73.5	6.7e-39
WP_024437277.1|2126125_2126398_+	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	53.8	4.1e-15
WP_078207988.1|2126399_2126825_+	hypothetical protein	NA	A0A068CBJ8	Acinetobacter_phage	49.3	6.9e-09
WP_025466342.1|2126917_2127124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454616.1|2127120_2127546_+	VRR-NUC domain-containing protein	NA	A0A0D4DBJ8	Acinetobacter_phage	99.3	7.2e-75
WP_060454617.1|2127555_2128230_+	metallophosphoesterase	NA	A0A0A0RMI8	Acinetobacter_phage	50.9	1.1e-53
WP_000990565.1|2128240_2128702_+	hypothetical protein	NA	A0A2H4J353	uncultured_Caudovirales_phage	75.8	2.6e-62
WP_057690396.1|2129047_2129251_+	hypothetical protein	NA	A0A1B1P9J1	Acinetobacter_phage	94.0	1.2e-27
WP_060454618.1|2129201_2129477_+	hypothetical protein	NA	A0A0D4DC07	Acinetobacter_phage	75.8	3.3e-36
WP_031975119.1|2129479_2129749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057082075.1|2129813_2130299_+	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	56.2	3.4e-44
WP_050675603.1|2130349_2130970_+	hypothetical protein	NA	A0A1B1P9C2	Acinetobacter_phage	32.9	9.1e-10
WP_043053755.1|2130929_2132213_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	99.1	2.1e-250
WP_060454619.1|2132212_2133619_+	DUF4055 domain-containing protein	NA	A0A1B1P9C6	Acinetobacter_phage	95.7	3.3e-265
WP_060454620.1|2133635_2134721_+|capsid	minor capsid protein	capsid	A0A1B1P9B7	Acinetobacter_phage	97.8	1.1e-196
WP_002016231.1|2134717_2134930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454621.1|2135015_2135741_+	hypothetical protein	NA	A0A1B1P9C7	Acinetobacter_phage	91.7	6.5e-76
WP_060454622.1|2135758_2136775_+	hypothetical protein	NA	A0A1B1P9D0	Acinetobacter_phage	87.3	3.3e-166
WP_017725153.1|2136786_2136969_+	hypothetical protein	NA	A0A1B1P9F4	Acinetobacter_phage	90.0	6.5e-25
WP_031966269.1|2137025_2137412_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	96.9	1.2e-65
WP_060454623.1|2137415_2137808_+	hypothetical protein	NA	A0A1B1P9E3	Acinetobacter_phage	86.9	4.6e-60
WP_016803036.1|2137807_2138098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454624.1|2138063_2138486_+	hypothetical protein	NA	A0A1B1P9D5	Acinetobacter_phage	80.0	1.0e-57
WP_060454625.1|2138487_2138883_+	hypothetical protein	NA	A0A1B1P9D6	Acinetobacter_phage	93.9	6.7e-67
WP_060454626.1|2139043_2139577_+	Rha family transcriptional regulator	NA	A0A1B1P9D9	Acinetobacter_phage	84.2	2.5e-77
WP_032023569.1|2139576_2139843_+	hypothetical protein	NA	A0A1B1P9E1	Acinetobacter_phage	90.9	3.3e-41
WP_038405942.1|2139908_2140838_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	41.0	8.2e-55
WP_060454627.1|2140882_2141416_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	61.2	5.7e-45
WP_000720595.1|2141749_2142307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106451087.1|2142667_2146642_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	88.1	0.0e+00
WP_031975097.1|2146677_2147214_-	hypothetical protein	NA	A0A2H4J720	uncultured_Caudovirales_phage	31.5	4.8e-15
WP_162830748.1|2147308_2147452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106451088.1|2147448_2147790_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_106451089.1|2147842_2148817_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	67.8	2.0e-59
WP_060454550.1|2148803_2149613_+|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	63.2	1.4e-90
WP_060454549.1|2149619_2150375_+	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	55.8	1.8e-84
WP_106451090.1|2150358_2151012_+|tail	tail assembly protein	tail	G3ENB6	Psychrobacter_phage	49.1	2.3e-43
2155287:2155309	attL	GCACTTGAAAATAGTGCTACTGC	NA	NA	NA	NA
WP_023188459.1|2157133_2157523_+	hypothetical protein	NA	A0A0D4DBQ9	Acinetobacter_phage	84.3	3.4e-55
WP_060454640.1|2157525_2158068_+	hypothetical protein	NA	A0A0B5KTG8	Acinetobacter_phage	89.9	6.3e-92
WP_078208034.1|2158194_2158389_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	93.8	1.0e-28
WP_017725138.1|2158385_2159600_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0IRB7	Acinetobacter_phage	55.9	7.7e-122
WP_000047853.1|2159921_2160413_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.3	3.7e-30
WP_001979799.1|2160414_2160678_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.0	2.4e-20
WP_000830721.1|2161349_2162534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001061609.1|2162586_2163567_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001129667.1|2163670_2164783_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_001984224.1|2164803_2166456_+	BCCT family carnitine transporter	NA	A0A2I7QNT1	Vibrio_phage	23.4	1.6e-08
WP_000214732.1|2166467_2167442_+	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	30.7	7.3e-30
WP_001277084.1|2167484_2168600_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_000096955.1|2168664_2170116_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_170318973.1|2170205_2171120_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_000139295.1|2171397_2172426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000834616.1|2172418_2174044_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.9	6.6e-92
WP_001048355.1|2174428_2174989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000838107.1|2175079_2175940_-	pirin family protein	NA	NA	NA	NA	NA
WP_000339888.1|2176110_2176563_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_000832710.1|2176581_2177811_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_079752645.1|2178161_2179433_+	EcsC family protein	NA	NA	NA	NA	NA
WP_000246374.1|2179633_2180008_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138055.1|2180167_2180638_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000113824.1|2180816_2182955_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.1	2.1e-50
WP_001029610.1|2183049_2184240_+	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
WP_000190202.1|2184418_2185378_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.4	4.5e-48
WP_017724775.1|2185343_2185595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813002.1|2185591_2185879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002000332.1|2185881_2186643_-	phage antirepressor	NA	A0A0P0IDX3	Acinetobacter_phage	55.7	2.4e-68
WP_017724774.1|2186642_2187011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060454567.1|2187015_2187489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060454566.1|2187491_2187728_-	hypothetical protein	NA	A0A2H4J515	uncultured_Caudovirales_phage	49.2	2.2e-09
WP_060454565.1|2187711_2188128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002028118.1|2189112_2189805_-	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	47.0	1.3e-52
WP_000576486.1|2189876_2190119_+	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	52.6	8.7e-09
WP_060454564.1|2190177_2190474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454563.1|2190473_2191511_+	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	44.5	5.2e-34
WP_079391551.1|2191510_2192842_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	55.0	2.2e-125
WP_034117038.1|2192838_2193117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034117094.1|2193281_2193587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034117036.1|2194148_2194418_+	hypothetical protein	NA	A0A0D4DC03	Acinetobacter_phage	78.7	3.0e-34
WP_060454562.1|2194432_2194927_+	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	34.8	1.1e-18
WP_024437301.1|2194992_2195889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153310298.1|2196542_2196686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000433061.1|2197185_2197716_+	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	5.7e-37
WP_024437298.1|2197705_2197888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106451091.1|2197893_2198184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454568.1|2198216_2198552_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	52.3	4.3e-30
WP_060454561.1|2198659_2199124_+	hypothetical protein	NA	A0A0F7L441	uncultured_marine_virus	44.2	8.8e-26
WP_060454560.1|2199156_2200659_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	67.5	3.2e-186
WP_060454559.1|2200713_2201307_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J367	uncultured_Caudovirales_phage	76.6	2.4e-84
WP_060454558.1|2201303_2202647_+|capsid	phage major capsid protein	capsid	A0A2H4JBZ9	uncultured_Caudovirales_phage	79.6	1.0e-175
WP_167850441.1|2202737_2202905_+	hypothetical protein	NA	A0A2H4J347	uncultured_Caudovirales_phage	65.5	1.2e-12
WP_060454557.1|2202916_2204377_+|portal	phage portal protein	portal	A0A2H4JB65	uncultured_Caudovirales_phage	61.2	2.3e-168
WP_039908105.1|2204373_2204667_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JAM4	uncultured_Caudovirales_phage	55.1	7.5e-23
WP_060454556.1|2204813_2205170_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	49.5	1.9e-20
WP_000211398.1|2205173_2205659_+	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	44.7	2.2e-27
WP_060454555.1|2206581_2207097_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_025468566.1|2207132_2207348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158701074.1|2207406_2207976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106451092.1|2208033_2211705_+	transglycosylase SLT domain-containing protein	NA	A0A0U4JEA4	Pseudomonas_phage	40.1	1.0e-44
WP_060454552.1|2211781_2212111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071079.1|2212103_2212445_+|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	41.1	1.4e-12
WP_060454551.1|2212497_2213472_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	67.8	2.0e-59
WP_060454550.1|2213458_2214268_+|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	63.2	1.4e-90
WP_060454549.1|2214274_2215030_+	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	55.8	1.8e-84
WP_106451090.1|2215013_2215667_+|tail	tail assembly protein	tail	G3ENB6	Psychrobacter_phage	49.1	2.3e-43
WP_023188459.1|2221788_2222178_+	hypothetical protein	NA	A0A0D4DBQ9	Acinetobacter_phage	84.3	3.4e-55
WP_060454640.1|2222180_2222723_+	hypothetical protein	NA	A0A0B5KTG8	Acinetobacter_phage	89.9	6.3e-92
WP_078208034.1|2222849_2223044_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	93.8	1.0e-28
WP_017725138.1|2223040_2224255_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0IRB7	Acinetobacter_phage	55.9	7.7e-122
WP_000047853.1|2224576_2225068_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.3	3.7e-30
WP_001979799.1|2225069_2225333_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.0	2.4e-20
WP_001061609.1|2227240_2228221_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001129667.1|2228324_2229437_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_001984224.1|2229457_2231110_+	BCCT family carnitine transporter	NA	A0A2I7QNT1	Vibrio_phage	23.4	1.6e-08
WP_000214732.1|2231121_2232096_+	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	30.7	7.3e-30
WP_001277084.1|2232138_2233254_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_000096955.1|2233318_2234770_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_170318973.1|2234859_2235774_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_000139295.1|2236051_2237080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000834616.1|2237072_2238698_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.9	6.6e-92
WP_001048355.1|2239082_2239643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000838107.1|2239733_2240594_-	pirin family protein	NA	NA	NA	NA	NA
WP_000339888.1|2240764_2241217_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_000832710.1|2241235_2242465_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_079752645.1|2242815_2244087_+	EcsC family protein	NA	NA	NA	NA	NA
WP_000246374.1|2244287_2244662_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138055.1|2244821_2245292_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000113824.1|2245470_2247609_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.1	2.1e-50
WP_001029610.1|2247703_2248894_+	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
WP_000190202.1|2249072_2250032_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.4	4.5e-48
WP_017724775.1|2249997_2250249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813002.1|2250245_2250533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002000332.1|2250535_2251297_-	phage antirepressor	NA	A0A0P0IDX3	Acinetobacter_phage	55.7	2.4e-68
WP_017724774.1|2251296_2251665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060454567.1|2251669_2252143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060454566.1|2252145_2252382_-	hypothetical protein	NA	A0A2H4J515	uncultured_Caudovirales_phage	49.2	2.2e-09
WP_060454565.1|2252365_2252782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002028118.1|2253766_2254459_-	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	47.0	1.3e-52
WP_000576486.1|2254530_2254773_+	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	52.6	8.7e-09
WP_060454564.1|2254831_2255128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454563.1|2255127_2256165_+	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	44.5	5.2e-34
WP_079391551.1|2256164_2257496_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	55.0	2.2e-125
WP_034117038.1|2257492_2257771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034117094.1|2257935_2258241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034117036.1|2258802_2259072_+	hypothetical protein	NA	A0A0D4DC03	Acinetobacter_phage	78.7	3.0e-34
WP_060454562.1|2259086_2259581_+	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	34.8	1.1e-18
WP_024437301.1|2259646_2260543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153310298.1|2261196_2261340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000433061.1|2261839_2262370_+	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	5.7e-37
WP_024437298.1|2262359_2262542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106451091.1|2262547_2262838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454568.1|2262870_2263206_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	52.3	4.3e-30
WP_060454561.1|2263313_2263778_+	hypothetical protein	NA	A0A0F7L441	uncultured_marine_virus	44.2	8.8e-26
WP_060454560.1|2263810_2265313_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	67.5	3.2e-186
WP_060454559.1|2265367_2265961_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J367	uncultured_Caudovirales_phage	76.6	2.4e-84
WP_060454558.1|2265957_2267301_+|capsid	phage major capsid protein	capsid	A0A2H4JBZ9	uncultured_Caudovirales_phage	79.6	1.0e-175
WP_167850441.1|2267391_2267559_+	hypothetical protein	NA	A0A2H4J347	uncultured_Caudovirales_phage	65.5	1.2e-12
WP_060454557.1|2267570_2269031_+|portal	phage portal protein	portal	A0A2H4JB65	uncultured_Caudovirales_phage	61.2	2.3e-168
WP_039908105.1|2269027_2269321_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JAM4	uncultured_Caudovirales_phage	55.1	7.5e-23
WP_060454556.1|2269467_2269824_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	49.5	1.9e-20
WP_000211398.1|2269827_2270313_+	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	44.7	2.2e-27
WP_000568015.1|2270312_2270684_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	47.9	1.1e-21
WP_000024425.1|2270759_2271233_+	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	61.1	7.8e-54
WP_060454555.1|2271232_2271748_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_025468566.1|2271783_2271999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158701074.1|2272057_2272627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106451092.1|2272684_2276356_+	transglycosylase SLT domain-containing protein	NA	A0A0U4JEA4	Pseudomonas_phage	40.1	1.0e-44
WP_060454552.1|2276432_2276762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071079.1|2276754_2277096_+|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	41.1	1.4e-12
WP_060454551.1|2277148_2278123_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	67.8	2.0e-59
WP_060454550.1|2278109_2278919_+|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	63.2	1.4e-90
WP_060454549.1|2278925_2279681_+	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	55.8	1.8e-84
WP_106451090.1|2279664_2280318_+|tail	tail assembly protein	tail	G3ENB6	Psychrobacter_phage	49.1	2.3e-43
WP_023188459.1|2286439_2286829_+	hypothetical protein	NA	A0A0D4DBQ9	Acinetobacter_phage	84.3	3.4e-55
2283858:2283880	attR	GCACTTGAAAATAGTGCTACTGC	NA	NA	NA	NA
WP_060454640.1|2286831_2287374_+	hypothetical protein	NA	A0A0B5KTG8	Acinetobacter_phage	89.9	6.3e-92
WP_060455662.1|2287500_2287698_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	92.9	1.1e-22
WP_031974898.1|2287990_2288872_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000992291.1|2289109_2289985_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000621547.1|2290092_2290548_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000844343.1|2290592_2291408_-	arginyltransferase	NA	NA	NA	NA	NA
WP_000854785.1|2291426_2292158_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001276144.1|2292277_2293225_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	3.2e-62
WP_000127814.1|2293494_2296527_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	45.0	8.5e-77
>prophage 159
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2302792	2306927	4233827		Bacillus_phage(66.67%)	3	NA	NA
WP_000093035.1|2302792_2304832_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	3.2e-112
WP_000868152.1|2304856_2305309_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	57.5	2.0e-46
WP_001102850.1|2305508_2306927_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.4	7.8e-41
>prophage 160
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2316236	2319833	4233827		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000698803.1|2316236_2319833_-	AAA family ATPase	NA	Q5ULP4	Lactobacillus_virus	27.4	5.8e-08
>prophage 161
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2337376	2340014	4233827		Vibrio_phage(100.0%)	3	NA	NA
WP_000080844.1|2337376_2338330_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	34.4	4.6e-45
WP_000339854.1|2338341_2338950_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_000151794.1|2338952_2340014_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	32.6	6.7e-29
>prophage 162
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2344677	2349008	4233827		Vibrio_phage(50.0%)	2	NA	NA
WP_000558128.1|2344677_2347914_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.1	1.5e-58
WP_000719869.1|2348489_2349008_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	39.8	9.2e-24
>prophage 163
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2374475	2382390	4233827	holin	Vibrio_phage(66.67%)	5	NA	NA
WP_001021934.1|2374475_2376134_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.7e-56
WP_001286303.1|2376229_2377702_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001985959.1|2377694_2378330_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_060454531.1|2378583_2380206_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.3	7.9e-21
WP_000179784.1|2380323_2382390_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
>prophage 164
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2393192	2393774	4233827		Klebsiella_phage(100.0%)	1	NA	NA
WP_004748051.1|2393192_2393774_+	nicotinamide mononucleotide transporter	NA	A0A0S1S1B4	Klebsiella_phage	28.0	6.1e-08
>prophage 165
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2401722	2410752	4233827		Mycobacterium_phage(25.0%)	8	NA	NA
WP_060454534.1|2401722_2402547_+	alpha/beta hydrolase	NA	A0A2D1G8C7	Mycobacterium_phage	31.6	1.1e-13
WP_004748037.1|2402562_2403357_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.4	3.3e-12
WP_000735778.1|2403372_2404164_+	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_024437179.1|2404177_2405644_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000140217.1|2405682_2407323_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.5	1.6e-24
WP_080947839.1|2407499_2408675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454535.1|2408736_2410035_-	MFS transporter	NA	NA	NA	NA	NA
WP_002132514.1|2410269_2410752_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.4	2.9e-19
>prophage 166
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2421343	2425030	4233827		Dickeya_phage(100.0%)	1	NA	NA
WP_000105336.1|2421343_2425030_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	3.3e-14
>prophage 167
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2439968	2443286	4233827		Mycobacterium_phage(50.0%)	4	NA	NA
WP_000197540.1|2439968_2440994_-	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	31.0	6.5e-05
WP_001987747.1|2441254_2441893_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_002036590.1|2441925_2442549_-	arylesterase	NA	NA	NA	NA	NA
WP_001136101.1|2442593_2443286_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	4.2e-32
>prophage 168
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2455370	2461498	4233827	tRNA	Catovirus(50.0%)	5	NA	NA
WP_001128163.1|2455370_2456933_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	5.5e-88
WP_000479765.1|2457122_2458565_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_002011285.1|2458821_2458953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140408.1|2458945_2459854_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_000019500.1|2459884_2461498_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.2	2.6e-40
>prophage 169
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2488745	2491175	4233827		Moraxella_phage(100.0%)	1	NA	NA
WP_001292274.1|2488745_2491175_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	62.7	8.4e-277
>prophage 170
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2501482	2554332	4233827	tail,integrase,transposase,capsid,terminase	Acinetobacter_phage(92.98%)	71	2525851:2525868	2555707:2555724
WP_075884373.1|2501482_2502259_-	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	98.4	2.0e-155
WP_000654847.1|2502262_2502508_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
WP_020752379.1|2502509_2503586_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.4	6.0e-142
WP_060454547.1|2503582_2504704_-	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.2	1.1e-210
WP_000181048.1|2504715_2505039_-	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	98.1	5.7e-56
WP_001101023.1|2505041_2505482_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	96.6	1.1e-73
WP_000276791.1|2505973_2506264_-	hypothetical protein	NA	A0A0D4DBS2	Acinetobacter_phage	100.0	1.5e-44
WP_001169164.1|2506314_2506530_-	KTSC domain-containing protein	NA	A0A0D4DBY2	Acinetobacter_phage	100.0	5.0e-32
WP_001037047.1|2506587_2506878_-	hypothetical protein	NA	A0A0D4DCB9	Acinetobacter_phage	100.0	7.9e-49
WP_000562174.1|2506917_2507217_-	hypothetical protein	NA	A0A0D4DCL0	Acinetobacter_phage	100.0	1.5e-47
WP_000605245.1|2507256_2507982_-	LexA family transcriptional regulator	NA	A0A0D4DBI5	Acinetobacter_phage	100.0	1.8e-134
WP_001068174.1|2508108_2508339_+	hypothetical protein	NA	A0A0D4DBS7	Acinetobacter_phage	100.0	6.1e-36
WP_000166124.1|2508375_2508642_+	hypothetical protein	NA	A0A0D4DBY7	Acinetobacter_phage	100.0	1.6e-43
WP_001194330.1|2508689_2508962_+	hypothetical protein	NA	A0A0D4DCC3	Acinetobacter_phage	98.9	3.7e-40
WP_001084131.1|2508958_2509255_+	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	98.0	1.4e-48
WP_001267987.1|2509251_2509614_+	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	98.3	7.1e-55
WP_060454546.1|2509606_2510536_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	99.0	3.1e-171
WP_060454545.1|2510528_2511278_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	95.6	7.8e-133
WP_001031753.1|2511274_2511391_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	88.9	2.9e-10
WP_060454548.1|2511390_2511789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000017820.1|2511785_2512193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454544.1|2512189_2512588_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.1	1.7e-25
WP_001039748.1|2512584_2512764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454543.1|2512753_2513077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002120863.1|2513076_2513478_+	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	96.2	1.8e-67
WP_060454542.1|2513488_2514241_+	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	96.8	9.9e-136
WP_001017703.1|2514384_2514603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611894.1|2514862_2515685_-|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_060454541.1|2515755_2516115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152665.1|2516306_2516543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|2517455_2518481_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_106451094.1|2518501_2518750_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.7	2.6e-32
WP_000378505.1|2518812_2519247_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	96.5	3.5e-77
WP_060454540.1|2519215_2519857_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	98.6	3.9e-125
WP_000212566.1|2519915_2520386_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_000102080.1|2520375_2521803_+|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
WP_060454539.1|2521799_2523251_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.6	5.0e-285
WP_060454538.1|2523252_2524356_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	99.5	3.0e-205
WP_000965231.1|2524364_2524793_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000004363.1|2524891_2525134_+	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_001139861.1|2525351_2525543_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000770049.1|2525656_2526424_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
2525851:2525868	attL	TTTTGAAGGAATTGAAGA	NA	NA	NA	NA
WP_000214198.1|2526451_2527408_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000692540.1|2527473_2528139_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000008496.1|2528143_2528533_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
WP_000524213.1|2528534_2528903_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
WP_000247952.1|2528911_2529316_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
WP_000539748.1|2529287_2529656_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
WP_002016455.1|2529612_2530056_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	87.8	3.1e-68
WP_001277696.1|2530057_2530276_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_000749909.1|2530384_2530906_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000064593.1|2531002_2531356_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_106451095.1|2531355_2532534_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	66.3	9.2e-104
WP_000094278.1|2532586_2533504_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_001185585.1|2533573_2534089_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000335868.1|2534591_2534891_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_000274931.1|2534899_2535358_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000721572.1|2535462_2536143_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_001275792.1|2536144_2536408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|2536535_2540846_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_000721057.1|2540936_2541524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277448.1|2541616_2542015_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000368388.1|2542014_2542521_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000835160.1|2542517_2542880_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_060454634.1|2542872_2546298_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.0	0.0e+00
WP_000433907.1|2546365_2546755_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_001019739.1|2546796_2547342_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
WP_060454635.1|2547823_2550142_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001207327.1|2550423_2552070_+	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_106451096.1|2552380_2552869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046989.1|2552958_2554332_-|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
2555707:2555724	attR	TTTTGAAGGAATTGAAGA	NA	NA	NA	NA
>prophage 171
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2563922	2564759	4233827		Streptococcus_phage(100.0%)	1	NA	NA
WP_001275988.1|2563922_2564759_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	5.3e-45
>prophage 172
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2569550	2574378	4233827		Bradyrhizobium_phage(50.0%)	2	NA	NA
WP_000084042.1|2569550_2570930_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
WP_024437407.1|2571162_2574378_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	37.7	2.8e-25
>prophage 173
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2578298	2579888	4233827		Planktothrix_phage(100.0%)	1	NA	NA
WP_000550793.1|2578298_2579888_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	3.2e-19
>prophage 174
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2583768	2588280	4233827		Acaryochloris_phage(33.33%)	4	NA	NA
WP_001982681.1|2583768_2584431_-	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
WP_001084867.1|2584415_2585450_-	dihydroorotase	NA	NA	NA	NA	NA
WP_000013374.1|2585599_2586862_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	2.9e-18
WP_001986427.1|2586921_2588280_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
>prophage 175
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2598578	2606540	4233827		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_024437400.1|2598578_2601698_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	52.0	5.7e-278
WP_024437399.1|2601767_2606540_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.3	4.2e-38
>prophage 176
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2622131	2623367	4233827		Klosneuvirus(100.0%)	1	NA	NA
WP_024437390.1|2622131_2623367_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	4.9e-23
>prophage 177
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2639718	2640423	4233827	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|2639718_2640423_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 178
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2678853	2691819	4233827	tRNA	Moraxella_phage(20.0%)	11	NA	NA
WP_000729981.1|2678853_2680173_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	1.7e-58
WP_031974755.1|2680284_2681283_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001111769.1|2681326_2681884_-	cytochrome b	NA	NA	NA	NA	NA
WP_000735756.1|2682123_2682513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000495836.1|2682578_2683145_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
WP_000906487.1|2683214_2683469_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_001185176.1|2683715_2684996_-	aspartate kinase	NA	NA	NA	NA	NA
WP_024437420.1|2685061_2687698_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
WP_001188823.1|2687967_2688993_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000155682.1|2689268_2690435_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000517792.1|2690499_2691819_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
>prophage 179
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2696506	2700739	4233827		Planktothrix_phage(33.33%)	3	NA	NA
WP_024437421.1|2696506_2697313_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
WP_001210050.1|2697613_2700193_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_000941316.1|2700250_2700739_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
>prophage 180
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2714631	2726515	4233827		Lactococcus_phage(33.33%)	9	NA	NA
WP_000558745.1|2714631_2716218_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.4e-25
WP_000058246.1|2716459_2716678_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_001133993.1|2716714_2717302_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_000024050.1|2717366_2717582_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_001987180.1|2717774_2718350_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_024437422.1|2718690_2722548_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.1	6.4e-45
WP_000512830.1|2722642_2723749_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_000397480.1|2723849_2725112_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_000381296.1|2725156_2726515_-	aromatic acid/H+ symport family MFS transporter	NA	S4TR35	Salmonella_phage	29.0	4.6e-06
>prophage 181
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2741486	2797046	4233827	coat,transposase,capsid,tRNA	Acinetobacter_phage(35.0%)	60	NA	NA
WP_000377526.1|2741486_2743958_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.6	1.1e-95
WP_001020650.1|2744033_2744435_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000331911.1|2744462_2744870_+	GFA family protein	NA	NA	NA	NA	NA
WP_001088962.1|2745462_2745819_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000980495.1|2746298_2746628_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	63.8	3.1e-33
WP_000253364.1|2747068_2747662_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000825869.1|2747712_2747937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998196.1|2748161_2748356_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_076611894.1|2749194_2750016_+|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_000636785.1|2751002_2751236_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001185373.1|2751387_2752059_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	56.6	1.4e-64
WP_000016214.1|2752294_2752492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427183.1|2752659_2753049_+	hypothetical protein	NA	A0A0P0IVR6	Acinetobacter_phage	74.4	1.4e-48
WP_001019695.1|2753086_2753632_+	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	73.5	3.5e-74
WP_000015970.1|2753698_2754316_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000072673.1|2754826_2755042_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000350297.1|2755245_2755470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932373.1|2755749_2756565_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_086241981.1|2756721_2756841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127320.1|2757329_2757788_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.0e-27
WP_001004679.1|2758079_2758424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437424.1|2758521_2759628_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	66.6	2.0e-145
WP_000648031.1|2759622_2760837_-	MFS transporter	NA	NA	NA	NA	NA
WP_000024017.1|2760948_2761395_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001210983.1|2761481_2761811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157560.1|2761824_2762028_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	89.6	5.0e-18
WP_000644342.1|2762550_2763144_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_076611894.1|2763164_2763987_-|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_000248342.1|2764414_2765044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182274.1|2765543_2766965_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	1.5e-55
WP_001133556.1|2767178_2768156_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	5.6e-38
WP_000179337.1|2768159_2768699_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000381220.1|2768736_2769285_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000554244.1|2769268_2769817_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_001183458.1|2769816_2770563_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_015451474.1|2771080_2772304_+	TolC family protein	NA	NA	NA	NA	NA
WP_000988402.1|2772300_2774442_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
WP_000003555.1|2774438_2775629_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001116932.1|2775721_2776321_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	3.8e-21
WP_000132358.1|2776313_2776925_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	54.0	3.6e-11
WP_001082436.1|2777080_2777923_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
WP_001186837.1|2778039_2778708_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	43.3	3.3e-26
WP_000232555.1|2778847_2779519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000144889.1|2779699_2780023_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_086241995.1|2780368_2780899_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001083263.1|2780963_2783609_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	1.5e-32
WP_001290072.1|2783883_2784351_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000972449.1|2784470_2785331_+	EamA family transporter	NA	NA	NA	NA	NA
WP_073392632.1|2785837_2787187_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000165396.1|2787317_2788250_+	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.7	1.0e-41
WP_001143897.1|2788836_2789478_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106451097.1|2789742_2791047_+	MFS transporter	NA	NA	NA	NA	NA
WP_000760331.1|2791141_2791579_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_010326927.1|2791896_2792922_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_000197928.1|2792963_2793218_+	transporter suffix domain-containing protein	NA	NA	NA	NA	NA
WP_000698006.1|2793320_2794316_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000977349.1|2794432_2795206_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000697437.1|2795229_2795862_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002053587.1|2795864_2796146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000864626.1|2796575_2797046_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 182
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2800911	2868573	4233827	plate,transposase	uncultured_Caudovirales_phage(22.22%)	56	NA	NA
WP_001127331.1|2800911_2801370_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.9e-31
WP_000453966.1|2801464_2801893_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024437426.1|2801938_2803186_-	serine hydrolase	NA	NA	NA	NA	NA
WP_000935004.1|2803808_2806991_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	63.8	2.2e-256
WP_024437427.1|2807010_2811927_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	56.0	1.1e-52
WP_001245610.1|2811916_2812348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611894.1|2812794_2813616_+|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_000945589.1|2813956_2814208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566663.1|2814566_2814854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000337804.1|2815222_2815552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611894.1|2815622_2816445_-|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_085943508.1|2816937_2817246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049894.1|2817529_2818441_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001987220.1|2818786_2820040_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_000496066.1|2820074_2820839_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_000276200.1|2820850_2821657_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_001211808.1|2821689_2823273_+	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_001090990.1|2823272_2824991_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000698620.1|2825293_2826514_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	29.6	1.4e-33
WP_024437428.1|2826623_2827532_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000792045.1|2827593_2828178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133089.1|2828820_2829381_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000921226.1|2829441_2829873_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_001202397.1|2830125_2831289_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	5.3e-11
WP_001090532.1|2831602_2832343_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_000217385.1|2832358_2833012_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_000475265.1|2833014_2836620_+	urea carboxylase	NA	NA	NA	NA	NA
WP_001196266.1|2836659_2837196_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001140304.1|2837289_2837643_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001000630.1|2837834_2837960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001124851.1|2837964_2838399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000916842.1|2838411_2840223_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_000591243.1|2840219_2841242_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001000087.1|2841293_2842175_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	5.0e-38
WP_000542520.1|2842174_2843119_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000043349.1|2843214_2843616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869712.1|2844704_2845397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066523.1|2845909_2847391_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000653195.1|2847440_2847944_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001047031.1|2848023_2848500_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000568823.1|2848516_2850328_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001190388.1|2850291_2851290_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000591877.1|2851286_2852699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000556909.1|2852729_2856554_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000557241.1|2856591_2857551_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_001072410.1|2857553_2858321_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000168111.1|2858337_2858601_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_086319600.1|2858820_2861502_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.7	1.7e-81
WP_000020715.1|2861525_2862620_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000471450.1|2862636_2864001_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000083629.1|2864018_2864825_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000046446.1|2864837_2865440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972583.1|2865447_2866401_+	M15 family metallopeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.3	2.8e-10
WP_000460185.1|2866403_2867255_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086242011.1|2867427_2868075_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000646721.1|2868090_2868573_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	39.8	2.4e-18
>prophage 183
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2927403	2928606	4233827		Bacillus_virus(100.0%)	1	NA	NA
WP_001166804.1|2927403_2928606_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.6	7.1e-27
>prophage 184
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2942238	2944071	4233827		Pelagibacter_phage(100.0%)	1	NA	NA
WP_000120405.1|2942238_2944071_-	carbamoyltransferase	NA	M1ICZ5	Pelagibacter_phage	29.5	1.3e-51
>prophage 185
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2951347	2952109	4233827		Bacillus_phage(100.0%)	1	NA	NA
WP_000101935.1|2951347_2952109_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	45.2	3.2e-09
>prophage 186
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2968207	2977292	4233827		Klosneuvirus(33.33%)	7	NA	NA
WP_001288914.1|2968207_2969113_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	39.6	1.8e-46
WP_000461809.1|2969109_2971101_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_000121724.1|2971112_2971916_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_031974831.1|2971925_2973527_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	69.4	3.9e-20
WP_001053637.1|2973551_2974724_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_002060665.1|2974892_2975486_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001183741.1|2975597_2977292_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	2.2e-26
>prophage 187
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2983522	2994077	4233827		Acinetobacter_phage(20.0%)	12	NA	NA
WP_001136759.1|2983522_2983951_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	2.1e-26
WP_000498477.1|2984038_2984260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132045.1|2984344_2984662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108365.1|2984767_2984989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000482092.1|2985274_2985754_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	50.3	3.1e-34
WP_001145686.1|2986069_2987479_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_085941324.1|2987533_2989678_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.1	5.2e-137
WP_000432324.1|2989732_2990611_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	42.1	2.2e-54
WP_000983630.1|2990752_2991166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031979416.1|2991650_2992886_+	stress-induced protein	NA	NA	NA	NA	NA
WP_000795915.1|2992946_2993183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001124835.1|2993465_2994077_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.4	4.9e-48
>prophage 188
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	2997240	3004422	4233827		Ectocarpus_siliculosus_virus(50.0%)	7	NA	NA
WP_106451098.1|2997240_3000705_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.7	1.7e-33
WP_000107125.1|3000701_3001661_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001025680.1|3001804_3002089_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_086241994.1|3002156_3002309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937468.1|3002397_3003033_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000418066.1|3003022_3003688_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001130362.1|3003690_3004422_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	5.6e-35
>prophage 189
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3008638	3011507	4233827		environmental_halophage(50.0%)	2	NA	NA
WP_000211577.1|3008638_3010600_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.5	4.2e-93
WP_001107594.1|3010574_3011507_-	hypothetical protein	NA	A0A2K9L2D2	Tupanvirus	35.7	2.2e-44
>prophage 190
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3019074	3020565	4233827		Streptococcus_phage(100.0%)	1	NA	NA
WP_000113408.1|3019074_3020565_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	30.2	8.6e-22
>prophage 191
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3044420	3048956	4233827	transposase	Escherichia_phage(66.67%)	4	NA	NA
WP_001067784.1|3044420_3045125_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_000960976.1|3045347_3045920_+	aminoglycoside N-acetyltransferase AAC(6')-Ian	NA	A0A0N9SKF6	Staphylococcus_phage	40.1	8.0e-37
WP_000093022.1|3046576_3048106_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067784.1|3048251_3048956_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
>prophage 192
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3061084	3061927	4233827		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000138006.1|3061084_3061513_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	60.6	3.1e-41
WP_000610149.1|3061597_3061927_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.2	4.5e-24
>prophage 193
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3065397	3066984	4233827		Lactococcus_phage(100.0%)	1	NA	NA
WP_171128781.1|3065397_3066984_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.4e-25
>prophage 194
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3071867	3075431	4233827		Streptomyces_phage(100.0%)	1	NA	NA
WP_001160984.1|3071867_3075431_-	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	34.6	4.0e-174
>prophage 195
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3081258	3081744	4233827		Fowlpox_virus(100.0%)	1	NA	NA
WP_000066032.1|3081258_3081744_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.6	3.0e-24
>prophage 196
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3094493	3095570	4233827		Planktothrix_phage(100.0%)	1	NA	NA
WP_086241966.1|3094493_3095570_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.3e-35
>prophage 197
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3105321	3106065	4233827		Planktothrix_phage(100.0%)	1	NA	NA
WP_001132006.1|3105321_3106065_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.0e-29
>prophage 198
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3112052	3113285	4233827	integrase	Moraxella_phage(100.0%)	1	3111607:3111621	3120022:3120036
3111607:3111621	attL	CAAAATTTAGCTTAA	NA	NA	NA	NA
WP_000108031.1|3112052_3113285_+|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	42.4	7.9e-82
WP_000108031.1|3112052_3113285_+|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	42.4	7.9e-82
3120022:3120036	attR	TTAAGCTAAATTTTG	NA	NA	NA	NA
>prophage 199
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3134652	3135819	4233827		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001209544.1|3134652_3135819_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.6	1.4e-125
>prophage 200
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3147846	3154380	4233827		Aeromonas_phage(33.33%)	6	NA	NA
WP_000119795.1|3147846_3149337_-	sodium/proline symporter PutP	NA	A0A240F3J2	Aeromonas_phage	23.7	2.4e-08
WP_086241961.1|3149743_3150451_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	43.5	2.7e-34
WP_001016341.1|3150545_3150920_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000705528.1|3150958_3151984_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000966086.1|3152092_3152533_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_000922240.1|3152532_3154380_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	9.0e-29
>prophage 201
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3170750	3175270	4233827		Brevibacillus_phage(33.33%)	5	NA	NA
WP_000057217.1|3170750_3171533_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	26.7	3.3e-17
WP_000023429.1|3171529_3172417_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.6	7.4e-13
WP_024437313.1|3172466_3173102_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_000669684.1|3173117_3173546_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_001070723.1|3173542_3175270_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.4	6.6e-58
>prophage 202
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3183307	3185652	4233827	tRNA	Equid_gammaherpesvirus(50.0%)	3	NA	NA
WP_001177528.1|3183307_3184021_+	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	47.6	1.1e-51
WP_086241960.1|3184017_3185142_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_000033177.1|3185148_3185652_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	2.9e-06
>prophage 203
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3188793	3189096	4233827		Burkholderia_phage(100.0%)	1	NA	NA
WP_000205997.1|3188793_3189096_+	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
>prophage 204
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3195399	3231036	4233827	integrase,terminase,tail,capsid	Acinetobacter_phage(78.05%)	57	3195242:3195263	3238527:3238548
3195242:3195263	attL	CGCTCTAAATTGAGCGCTTTTT	NA	NA	NA	NA
WP_000190203.1|3195399_3196359_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.4	7.6e-48
WP_017724775.1|3196324_3196576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031975002.1|3196572_3196785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075884404.1|3196962_3197190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006581905.1|3197186_3197798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060454650.1|3197794_3198727_-	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	40.5	3.4e-61
WP_060454651.1|3198914_3199148_-	hypothetical protein	NA	A0A068CDE4	Acinetobacter_phage	45.1	2.1e-07
WP_068920996.1|3199147_3199414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508120.1|3199433_3199781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020753284.1|3200018_3200960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000370477.1|3201062_3201278_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	100.0	2.5e-31
WP_031975139.1|3201293_3202040_-	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	79.3	7.4e-107
WP_001100147.1|3202145_3202334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002052638.1|3202342_3202618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001109646.1|3202658_3202817_+	hypothetical protein	NA	A0A1B1P9H5	Acinetobacter_phage	98.1	7.9e-19
WP_031975136.1|3202816_3203635_+	hypothetical protein	NA	I6RTT8	Marinomonas_phage	33.6	1.3e-08
WP_031975133.1|3203634_3204996_+	replicative DNA helicase	NA	A0A1B1P9I0	Acinetobacter_phage	87.2	2.9e-226
WP_000854669.1|3204992_3205250_+	hypothetical protein	NA	A0A2H4J6Z3	uncultured_Caudovirales_phage	61.5	7.3e-22
WP_162830751.1|3205246_3205423_+	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	86.2	7.4e-18
WP_031975131.1|3205419_3205764_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	98.2	4.8e-61
WP_004834288.1|3205756_3206035_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	46.5	2.2e-11
WP_031975130.1|3206027_3206276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031975128.1|3206279_3206780_+	hypothetical protein	NA	I2GUD3	Acinetobacter_phage	57.0	3.9e-19
WP_031975127.1|3206776_3207139_+	hypothetical protein	NA	A0A220NQK3	Acinetobacter_phage	95.0	1.4e-47
WP_000206511.1|3207142_3207568_+	VRR-NUC domain-containing protein	NA	A0A0D4DBJ8	Acinetobacter_phage	97.2	2.7e-74
WP_060454617.1|3207577_3208252_+	metallophosphoesterase	NA	A0A0A0RMI8	Acinetobacter_phage	50.9	1.1e-53
WP_000990565.1|3208262_3208724_+	hypothetical protein	NA	A0A2H4J353	uncultured_Caudovirales_phage	75.8	2.6e-62
WP_057690396.1|3209069_3209273_+	hypothetical protein	NA	A0A1B1P9J1	Acinetobacter_phage	94.0	1.2e-27
WP_060454618.1|3209223_3209499_+	hypothetical protein	NA	A0A0D4DC07	Acinetobacter_phage	75.8	3.3e-36
WP_031975119.1|3209501_3209771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057082075.1|3209835_3210321_+	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	56.2	3.4e-44
WP_050675603.1|3210371_3210992_+	hypothetical protein	NA	A0A1B1P9C2	Acinetobacter_phage	32.9	9.1e-10
WP_043053755.1|3210951_3212235_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	99.1	2.1e-250
WP_060454619.1|3212234_3213641_+	DUF4055 domain-containing protein	NA	A0A1B1P9C6	Acinetobacter_phage	95.7	3.3e-265
WP_060454620.1|3213657_3214743_+|capsid	minor capsid protein	capsid	A0A1B1P9B7	Acinetobacter_phage	97.8	1.1e-196
WP_002016231.1|3214739_3214952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454621.1|3215037_3215763_+	hypothetical protein	NA	A0A1B1P9C7	Acinetobacter_phage	91.7	6.5e-76
WP_060454622.1|3215780_3216797_+	hypothetical protein	NA	A0A1B1P9D0	Acinetobacter_phage	87.3	3.3e-166
WP_017725153.1|3216808_3216991_+	hypothetical protein	NA	A0A1B1P9F4	Acinetobacter_phage	90.0	6.5e-25
WP_031966269.1|3217047_3217434_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	96.9	1.2e-65
WP_060454623.1|3217437_3217830_+	hypothetical protein	NA	A0A1B1P9E3	Acinetobacter_phage	86.9	4.6e-60
WP_016803036.1|3217829_3218120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060454624.1|3218085_3218508_+	hypothetical protein	NA	A0A1B1P9D5	Acinetobacter_phage	80.0	1.0e-57
WP_060454625.1|3218509_3218905_+	hypothetical protein	NA	A0A1B1P9D6	Acinetobacter_phage	93.9	6.7e-67
WP_060454626.1|3219065_3219599_+	Rha family transcriptional regulator	NA	A0A1B1P9D9	Acinetobacter_phage	84.2	2.5e-77
WP_032023569.1|3219598_3219865_+	hypothetical protein	NA	A0A1B1P9E1	Acinetobacter_phage	90.9	3.3e-41
WP_038405942.1|3219930_3220860_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	41.0	8.2e-55
WP_060454627.1|3220904_3221438_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	61.2	5.7e-45
WP_000720595.1|3221771_3222329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106451087.1|3222689_3226664_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	88.1	0.0e+00
WP_031975097.1|3226699_3227236_-	hypothetical protein	NA	A0A2H4J720	uncultured_Caudovirales_phage	31.5	4.8e-15
WP_162830748.1|3227330_3227474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106451088.1|3227470_3227812_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_106451089.1|3227866_3228841_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	67.8	2.0e-59
WP_060454550.1|3228827_3229637_+|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	63.2	1.4e-90
WP_060454549.1|3229643_3230399_+	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	55.8	1.8e-84
WP_106451090.1|3230382_3231036_+|tail	tail assembly protein	tail	G3ENB6	Psychrobacter_phage	49.1	2.3e-43
3238527:3238548	attR	CGCTCTAAATTGAGCGCTTTTT	NA	NA	NA	NA
>prophage 205
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3237157	3238416	4233827		Acinetobacter_phage(100.0%)	3	NA	NA
WP_023188459.1|3237157_3237547_+	hypothetical protein	NA	A0A0D4DBQ9	Acinetobacter_phage	84.3	3.4e-55
WP_060454640.1|3237549_3238092_+	hypothetical protein	NA	A0A0B5KTG8	Acinetobacter_phage	89.9	6.3e-92
WP_060455662.1|3238218_3238416_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	92.9	1.1e-22
>prophage 206
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3244315	3246904	4233827		Acinetobacter_phage(100.0%)	1	NA	NA
WP_086241978.1|3244315_3246904_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.5	1.9e-45
>prophage 207
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3251392	3258037	4233827		Klosneuvirus(33.33%)	5	NA	NA
WP_086241976.1|3251392_3253426_+	Zn-dependent oligopeptidase	NA	A0A1V0SID3	Klosneuvirus	29.9	1.8e-75
WP_000881924.1|3253438_3254377_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000953840.1|3254384_3255527_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001295043.1|3255539_3257270_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	6.7e-18
WP_001117472.1|3257302_3258037_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	41.3	1.2e-48
>prophage 208
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3268742	3273857	4233827		Lake_Baikal_phage(50.0%)	6	NA	NA
WP_001175670.1|3268742_3270212_+	guanylate cyclase	NA	A0A218MLZ2	uncultured_virus	29.3	5.5e-21
WP_001137383.1|3270260_3270599_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196574.1|3270617_3272477_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.9	4.7e-102
WP_001015254.1|3272515_3273034_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_000581597.1|3273119_3273440_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	2.0e-24
WP_000331712.1|3273470_3273857_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.0	6.0e-52
>prophage 209
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3277209	3277482	4233827		Burkholderia_phage(100.0%)	1	NA	NA
WP_001043034.1|3277209_3277482_+	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	65.2	1.3e-24
>prophage 210
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3280655	3286112	4233827		Catovirus(50.0%)	4	NA	NA
WP_000993546.1|3280655_3281879_+	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	36.3	9.4e-51
WP_001053244.1|3281998_3283204_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_171059669.1|3283225_3284509_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000070798.1|3284738_3286112_-	AarF/ABC1/UbiB kinase family protein	NA	M1HE59	Acanthocystis_turfacea_Chlorella_virus	25.7	5.5e-07
>prophage 211
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3308395	3311999	4233827		uncultured_virus(50.0%)	3	NA	NA
WP_001023040.1|3308395_3309964_+	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	65.8	3.1e-115
WP_024437166.1|3310070_3310814_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000572395.1|3310889_3311999_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.5	9.3e-82
>prophage 212
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3320597	3322355	4233827		Staphylococcus_phage(100.0%)	1	NA	NA
WP_024437332.1|3320597_3322355_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	1.0e-18
>prophage 213
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3366455	3376309	4233827		Bacillus_virus(40.0%)	10	NA	NA
WP_000206303.1|3366455_3367508_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	45.1	2.8e-88
WP_024437581.1|3367937_3368957_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086241991.1|3368959_3369970_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000614439.1|3369966_3370731_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	2.8e-16
WP_031972125.1|3370727_3371219_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024437579.1|3371213_3372002_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024437578.1|3372100_3372910_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_024437577.1|3373091_3373976_+	ribose-phosphate pyrophosphokinase	NA	A0A076G6G0	Escherichia_phage	37.5	7.5e-34
WP_024437576.1|3373987_3375481_+	nicotinate phosphoribosyltransferase	NA	A0A1W6DY18	Aeromonas_phage	50.4	7.8e-140
WP_024437575.1|3375541_3376309_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	33.0	1.5e-25
>prophage 214
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3388283	3388724	4233827		Vibrio_phage(100.0%)	1	NA	NA
WP_024437566.1|3388283_3388724_-	HD domain-containing protein	NA	A0A0B5H2U9	Vibrio_phage	34.8	6.2e-13
>prophage 215
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3393772	3394267	4233827		Haemophilus_phage(100.0%)	1	NA	NA
WP_024437109.1|3393772_3394267_+	phage antirepressor KilAC domain-containing protein	NA	Q7Y5W2	Haemophilus_phage	57.1	3.9e-32
>prophage 216
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3404089	3409276	4233827		Leptospira_phage(66.67%)	3	NA	NA
WP_024437099.1|3404089_3404833_-	efflux system response regulator transcription factor AdeR	NA	W8CYM9	Bacillus_phage	30.2	7.5e-27
WP_001169091.1|3404978_3406169_+	multidrug efflux RND transporter periplasmic adaptor subunit AdeA	NA	S5VL44	Leptospira_phage	22.4	1.1e-06
WP_000987604.1|3406165_3409276_+	multidrug efflux RND transporter permease subunit AdeB	NA	S5VTK5	Leptospira_phage	24.5	7.9e-62
>prophage 217
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3419916	3486604	4233827	holin,transposase,capsid	Klosneuvirus(18.18%)	58	NA	NA
WP_085940648.1|3419916_3421006_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_024433870.1|3422440_3423919_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024437091.1|3423974_3425015_+	proline racemase family protein	NA	NA	NA	NA	NA
WP_032020784.1|3425033_3426692_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.3	6.3e-58
WP_024432727.1|3426753_3427263_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024432728.1|3427272_3428031_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_031972136.1|3428036_3428843_+	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_024437597.1|3428851_3429604_+	SDR family oxidoreductase	NA	H2EEJ0	Moumouvirus	25.5	2.7e-08
WP_042791608.1|3429832_3431041_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_024432732.1|3431074_3431608_-	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_024437034.1|3431768_3432275_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024432734.1|3432326_3433499_-	MFS transporter	NA	NA	NA	NA	NA
WP_024432733.1|3433516_3435169_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.5	6.3e-58
WP_158315915.1|3435406_3436246_-	EamA family transporter	NA	NA	NA	NA	NA
WP_024437043.1|3436272_3436962_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_024432738.1|3437094_3438126_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024432739.1|3438154_3438820_-	LrgB family protein	NA	NA	NA	NA	NA
WP_024437042.1|3439481_3440789_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_024437041.1|3440862_3442653_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	27.2	4.3e-44
WP_024437040.1|3442822_3444325_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_024437039.1|3444497_3445754_+	MFS transporter	NA	NA	NA	NA	NA
WP_024437038.1|3445818_3446610_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_024437037.1|3446638_3446836_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_024437036.1|3446868_3447654_+	thiazole synthase	NA	NA	NA	NA	NA
WP_044114014.1|3447811_3449020_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_024437609.1|3449079_3449940_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024437041.1|3450047_3451838_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	27.2	4.3e-44
WP_024437599.1|3451882_3452548_-	ThuA domain-containing protein	NA	NA	NA	NA	NA
WP_024437600.1|3452770_3453850_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024437601.1|3453958_3454828_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_024437602.1|3454869_3456462_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9M4	Catovirus	33.9	1.8e-65
WP_024437603.1|3456514_3457528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611894.1|3457596_3458419_-|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_057047439.1|3458632_3459241_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_031972142.1|3459272_3460103_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.6	7.3e-63
WP_000794351.1|3461231_3461522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000731819.1|3462012_3462546_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000774086.1|3462634_3463369_+	molecular chaperone	NA	NA	NA	NA	NA
WP_024437634.1|3463426_3465985_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_024437635.1|3465981_3467010_+	fimbrial protein	NA	NA	NA	NA	NA
WP_161631593.1|3467116_3468097_+	DUF4882 family protein	NA	NA	NA	NA	NA
WP_000842124.1|3468154_3469264_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.5	5.2e-32
WP_086242014.1|3469493_3471188_-|capsid	phage capsid protein	capsid	A0A076G822	Escherichia_phage	37.7	1.2e-104
WP_024437637.1|3471547_3472711_+	catalase family protein	NA	NA	NA	NA	NA
WP_001127349.1|3472788_3473154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001136787.1|3473967_3474435_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	52.4	6.6e-37
WP_002086381.1|3474867_3476427_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_000582742.1|3476435_3477023_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_000044010.1|3477189_3477426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920230.1|3477679_3477856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015451.1|3478436_3479489_-	dipeptidase	NA	NA	NA	NA	NA
WP_000134708.1|3479505_3480660_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_001031359.1|3480656_3480941_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_000195110.1|3480937_3481696_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_000548481.1|3481704_3482616_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_001982218.1|3482691_3482766_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_000202690.1|3482989_3485065_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_024437638.1|3485239_3486604_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	35.2	2.0e-62
>prophage 218
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3498560	3499181	4233827		Planktothrix_phage(100.0%)	1	NA	NA
WP_000903975.1|3498560_3499181_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.4	8.5e-16
>prophage 219
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3508780	3509566	4233827		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001017888.1|3508780_3509566_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	5.2e-10
>prophage 220
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3533417	3536843	4233827		Burkholderia_virus(50.0%)	4	NA	NA
WP_000222732.1|3533417_3534704_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	8.1e-37
WP_001194841.1|3534743_3535025_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_024437283.1|3535008_3536007_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000028992.1|3536003_3536843_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	9.0e-37
>prophage 221
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3542196	3543546	4233827		Ochrobactrum_phage(100.0%)	1	NA	NA
WP_001186380.1|3542196_3543546_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	66.7	1.2e-30
>prophage 222
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3565501	3570066	4233827	transposase	Pandoravirus(50.0%)	4	NA	NA
WP_024437523.1|3565501_3566593_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.1	8.1e-78
WP_000441019.1|3566605_3567610_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_106451099.1|3567846_3569040_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_010326927.1|3569040_3570066_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
>prophage 223
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3578116	3580545	4233827		Tupanvirus(50.0%)	2	NA	NA
WP_000997200.1|3578116_3579637_-	catalase	NA	A0A2K9L0T1	Tupanvirus	45.1	5.4e-96
WP_005131629.1|3579714_3580545_-	alpha/beta hydrolase	NA	A0A1B1SFC9	Mycobacterium_phage	29.8	3.7e-14
>prophage 224
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3586556	3588191	4233827		Staphylococcus_phage(100.0%)	1	NA	NA
WP_031975034.1|3586556_3588191_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.0	2.8e-18
>prophage 225
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3641587	3642415	4233827		Streptococcus_phage(100.0%)	1	NA	NA
WP_086242003.1|3641587_3642415_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.6	7.6e-20
>prophage 226
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3653208	3657070	4233827		Streptococcus_phage(33.33%)	3	NA	NA
WP_000078452.1|3653208_3654498_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.8	1.0e-135
WP_000080538.1|3654543_3655401_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.5e-50
WP_000148658.1|3655432_3657070_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.7	1.4e-150
>prophage 227
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3664950	3669499	4233827	protease	Serratia_phage(25.0%)	4	NA	NA
WP_024437554.1|3664950_3666006_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	46.1	4.7e-83
WP_000904308.1|3666433_3666796_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	62.6	1.3e-27
WP_106451101.1|3666799_3669076_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.2	9.0e-164
WP_001260033.1|3669085_3669499_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.0	2.9e-12
>prophage 228
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3706655	3759711	4233827	tail,transposase,capsid,plate,head	Pseudomonas_phage(25.93%)	61	NA	NA
WP_000880349.1|3706655_3709514_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.8	1.0e-15
WP_001062807.1|3709528_3710476_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_001192459.1|3710462_3712181_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000734807.1|3712225_3712732_-	PEGA domain-containing protein	NA	B9UDL3	Salmonella_phage	44.2	7.1e-21
WP_024437164.1|3713118_3713403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437163.1|3713404_3714148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437162.1|3714291_3714567_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024437161.1|3714566_3716717_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	I6P9C2	Pseudomonas_phage	38.1	1.4e-118
WP_024437160.1|3716773_3717529_+	ATP-binding protein	NA	L7P7S2	Pseudomonas_phage	49.0	1.2e-56
WP_024437159.1|3717531_3718206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437158.1|3718202_3718448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049867412.1|3718413_3718776_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024437156.1|3718784_3718997_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_031971897.1|3719050_3719230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437154.1|3719229_3719733_+	host-nuclease inhibitor Gam family protein	NA	A0A2K9VGT9	Faecalibacterium_phage	33.5	2.9e-14
WP_024437153.1|3719756_3720065_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	58.4	2.4e-19
WP_162830741.1|3720146_3720296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437152.1|3720357_3720561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437151.1|3720560_3720992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437150.1|3720972_3721413_+	regulatory protein GemA	NA	H1ZZD1	Pseudomonas_virus	40.6	2.0e-19
WP_024437149.1|3721369_3721804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437148.1|3721924_3722425_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	65.2	3.4e-55
WP_024437147.1|3722421_3722781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437146.1|3722777_3723119_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	39.4	3.3e-14
WP_024437145.1|3723118_3723430_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	52.9	2.9e-25
WP_024437144.1|3723438_3723987_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	50.0	8.5e-44
WP_024437143.1|3723983_3725543_+	hypothetical protein	NA	A0A2H4JF57	uncultured_Caudovirales_phage	59.7	3.9e-158
WP_049867416.1|3725539_3725971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050575752.1|3725994_3726330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437142.1|3726339_3727080_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_024437141.1|3727303_3728071_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	60.2	2.9e-90
WP_024437140.1|3728146_3729721_+	DUF935 domain-containing protein	NA	A0A0A1IVG5	Pseudomonas_phage	40.9	2.7e-103
WP_024437139.1|3729720_3731034_+|capsid	minor capsid protein	capsid	I6PBD2	Pseudomonas_phage	35.7	1.1e-78
WP_024437138.1|3731135_3731612_+	phage virion morphogenesis protein	NA	F8TVC6	EBPR_siphovirus	38.4	7.0e-10
WP_024437137.1|3731798_3732860_+	hypothetical protein	NA	A0A0A1IUZ5	Pseudomonas_phage	34.3	3.3e-36
WP_024437136.1|3732878_3733304_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	37.4	2.5e-11
WP_024437135.1|3733303_3734236_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	57.7	2.1e-98
WP_024437134.1|3734239_3734674_+	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	37.6	1.1e-17
WP_024437133.1|3734670_3735261_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_024437132.1|3735263_3735611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437130.1|3737577_3738639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437129.1|3738641_3739451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437128.1|3739570_3739948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437127.1|3739958_3740300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125305477.1|3740311_3740509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437125.1|3742735_3743326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437124.1|3743396_3744572_+	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	22.3	1.3e-20
WP_024437123.1|3744561_3745617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437122.1|3745613_3746099_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	40.2	3.4e-12
WP_024437121.1|3746106_3746469_+	phage GP46 family protein	NA	NA	NA	NA	NA
WP_024437120.1|3746472_3747519_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	26.2	6.2e-27
WP_024437119.1|3747515_3748052_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_024437118.1|3748048_3749587_+|tail	tail protein	tail	NA	NA	NA	NA
WP_000163427.1|3750163_3750628_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001129189.1|3750818_3751034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203165.1|3751640_3753734_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	28.2	1.3e-15
WP_000120225.1|3753859_3754303_+	universal stress protein	NA	NA	NA	NA	NA
WP_001032866.1|3754357_3755800_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_000332533.1|3756154_3756784_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	54.5	3.5e-57
WP_000957167.1|3757030_3758485_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	69.5	1.0e-181
WP_001026402.1|3758532_3759711_-	S8 family peptidase	NA	A0A2K9L570	Tupanvirus	40.6	1.5e-32
>prophage 229
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3768136	3769186	4233827		Bacillus_phage(100.0%)	1	NA	NA
WP_000344169.1|3768136_3769186_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.4	5.7e-113
>prophage 230
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3779927	3780680	4233827		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000132224.1|3779927_3780680_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	42.2	7.4e-22
>prophage 231
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3795376	3797846	4233827		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_000604795.1|3795376_3796384_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	31.9	9.5e-49
WP_000105718.1|3796449_3796818_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	37.0	6.8e-13
WP_000859772.1|3796862_3797213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194628.1|3797230_3797515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047539.1|3797534_3797846_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.1	2.0e-18
>prophage 232
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3817822	3819151	4233827		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000652007.1|3817822_3819151_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	44.3	2.4e-100
>prophage 233
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3839091	3844935	4233827		Bacteriophage(33.33%)	4	NA	NA
WP_042791419.1|3839091_3841272_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	39.4	1.7e-42
WP_001170310.1|3841445_3842924_-	multidrug efflux MFS transporter AmvA	NA	A0A0M3UL24	Mycobacterium_phage	27.1	3.8e-30
WP_000323805.1|3843049_3843628_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024437114.1|3843675_3844935_-	serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	23.5	1.0e-12
>prophage 234
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3854402	3857894	4233827		Bacillus_virus(50.0%)	2	NA	NA
WP_000775746.1|3854402_3855122_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	1.0e-12
WP_000674107.1|3855137_3857894_-	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.3	1.4e-38
>prophage 235
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3861630	3863217	4233827		Hokovirus(100.0%)	1	NA	NA
WP_000193888.1|3861630_3863217_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	26.4	3.5e-21
>prophage 236
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3869790	3870261	4233827		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001123841.1|3869790_3870261_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.4	1.4e-31
>prophage 237
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3888814	3890527	4233827		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000808297.1|3888814_3890527_-	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	40.0	1.7e-77
>prophage 238
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3901131	3903537	4233827	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_000803943.1|3901131_3902859_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.2e-187
WP_000009660.1|3903027_3903537_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
>prophage 239
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3907870	3909820	4233827		Wolbachia_phage(100.0%)	1	NA	NA
WP_024437201.1|3907870_3909820_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	3.9e-83
>prophage 240
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3923549	3956348	4233827		Acinetobacter_phage(33.33%)	29	NA	NA
WP_001289324.1|3923549_3924044_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.1	1.3e-43
WP_000680001.1|3924047_3925346_+	DNA polymerase V subunit UmuC	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	62.6	6.1e-157
WP_001072150.1|3925499_3926198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602528.1|3926581_3926941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766533.1|3927066_3927837_-	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	98.4	1.7e-151
WP_001279704.1|3927833_3928121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000894311.1|3928242_3928461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627456.1|3928453_3929152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030337.1|3929151_3929946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594623.1|3930033_3930282_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000067916.1|3930483_3931383_+	hypothetical protein	NA	G9L6D8	Escherichia_phage	48.9	1.1e-40
WP_000373972.1|3931541_3932255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000067934.1|3932470_3933550_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	31.9	2.6e-36
WP_000951724.1|3933546_3934176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209676.1|3934326_3935778_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	42.8	1.1e-82
WP_031975009.1|3935777_3937730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863712.1|3937803_3938457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000098518.1|3938456_3939992_-	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	9.4e-32
WP_000852569.1|3940150_3940345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012464.1|3940397_3941060_-	hypothetical protein	NA	U5PVV9	Acinetobacter_phage	51.8	9.9e-55
WP_001135547.1|3941059_3941380_-	hypothetical protein	NA	U5PWK1	Acinetobacter_phage	56.2	6.1e-26
WP_031979477.1|3941424_3951783_-	DUF1983 domain-containing protein	NA	A0A126DKX0	Acinetobacter_phage	26.3	3.1e-78
WP_001167472.1|3951792_3952686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240946.1|3952685_3953135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187718.1|3953134_3953782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119669.1|3953909_3954176_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.0	6.8e-15
WP_001015563.1|3954138_3954414_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000229653.1|3954959_3955211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210195.1|3955451_3956348_+	hypothetical protein	NA	A5VW58	Enterobacteria_phage	49.2	3.7e-44
>prophage 241
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3962726	3970972	4233827	tail	Escherichia_phage(50.0%)	10	NA	NA
WP_001272161.1|3962726_3963857_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	35.2	1.3e-22
WP_001243272.1|3963858_3964137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000996675.1|3964151_3965690_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001162229.1|3965762_3967754_-	hypothetical protein	NA	A0A077SK57	Escherichia_phage	54.9	3.6e-07
WP_000014221.1|3967773_3968286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130711.1|3968297_3968498_-	TraR/DksA C4-type zinc finger protein	NA	G3EN77	Psychrobacter_phage	42.4	2.2e-05
WP_001108881.1|3968490_3969294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157182.1|3969296_3970202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237354.1|3970274_3970502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183519.1|3970513_3970972_-	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	1.8e-10
>prophage 242
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3975939	3977845	4233827		Enterobacteria_phage(50.0%)	2	NA	NA
WP_001259764.1|3975939_3976839_-	hypothetical protein	NA	A5VW58	Enterobacteria_phage	42.9	3.8e-41
WP_000801068.1|3976903_3977845_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	29.6	5.4e-06
>prophage 243
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	3988835	4003900	4233827	integrase	Acinetobacter_phage(46.15%)	26	3982011:3982027	4004623:4004639
3982011:3982027	attL	CTCAATTTTCACTTTTT	NA	NA	NA	NA
WP_000994860.1|3988835_3989600_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.4	3.0e-63
WP_000124478.1|3989596_3990640_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_001055561.1|3990643_3992122_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	53.3	9.7e-135
WP_004708298.1|3992118_3992505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024436143.1|3992510_3993071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817335.1|3993115_3993655_-	HNH endonuclease	NA	Q94MV4	Myxococcus_phage	54.9	2.4e-30
WP_000218435.1|3993651_3994269_-	hypothetical protein	NA	R9VWB9	Serratia_phage	40.3	3.2e-31
WP_000575719.1|3994265_3994721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200037.1|3994717_3994903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290737.1|3994899_3995100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818521.1|3995133_3995508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335919.1|3995540_3995774_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000550612.1|3995900_3996590_+	helix-turn-helix domain-containing protein	NA	A0A0R6PCY1	Moraxella_phage	37.1	5.0e-25
WP_000922095.1|3996601_3996877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105905.1|3997092_3997425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001290755.1|3997465_3998269_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	32.8	2.1e-27
WP_000350172.1|3998354_3998615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072362.1|3998673_3999003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260062.1|3998999_3999371_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	38.8	4.9e-11
WP_000644001.1|3999541_4000222_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_000805212.1|4000234_4001263_+	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	27.8	5.0e-13
WP_000986117.1|4001400_4001694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130794.1|4001690_4002092_+	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	96.1	6.2e-36
WP_000877059.1|4002088_4002424_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	59.1	4.6e-32
WP_000039877.1|4002425_4002695_+	helix-turn-helix domain-containing protein	NA	A0A0N7IRE8	Acinetobacter_phage	53.5	1.8e-15
WP_000773636.1|4002691_4003900_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	48.0	2.8e-108
4004623:4004639	attR	CTCAATTTTCACTTTTT	NA	NA	NA	NA
>prophage 244
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	4019974	4029355	4233827		Streptococcus_phage(33.33%)	8	NA	NA
WP_086242012.1|4019974_4022014_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	27.6	1.1e-38
WP_000891213.1|4022022_4023732_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000993409.1|4023993_4024431_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000338779.1|4024387_4024768_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000739365.1|4024783_4026082_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0R6PEF3	Moraxella_phage	49.1	1.3e-106
WP_000137909.1|4026140_4026917_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_000083683.1|4027086_4027665_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000853303.1|4027711_4029355_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	38.1	1.1e-78
>prophage 245
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	4047254	4049642	4233827		Hokovirus(100.0%)	1	NA	NA
WP_000853480.1|4047254_4049642_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	6.3e-176
>prophage 246
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	4057131	4058577	4233827		Escherichia_phage(100.0%)	1	NA	NA
WP_000075888.1|4057131_4058577_+	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	2.5e-119
>prophage 247
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	4070053	4075257	4233827		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_106451107.1|4070053_4071628_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.6	7.1e-67
WP_001024113.1|4071753_4073040_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000733779.1|4073289_4074156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614025.1|4074231_4075257_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	9.1e-31
>prophage 248
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	4089737	4159536	4233827	protease,transposase,tRNA	Moraxella_phage(25.0%)	53	NA	NA
WP_076611894.1|4089737_4090560_-|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_000574044.1|4091048_4092734_+	aspartate-alanine antiporter	NA	NA	NA	NA	NA
WP_000520925.1|4092790_4094389_+	bifunctional aspartate transaminase/aspartate 4-decarboxylase	NA	NA	NA	NA	NA
WP_000340904.1|4094439_4095342_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000792947.1|4095576_4096131_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001260519.1|4097283_4098771_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.9	6.1e-60
WP_001149936.1|4099314_4099434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001022741.1|4099491_4100511_-	Csu fimbrial tip adhesin CsuE	NA	NA	NA	NA	NA
WP_000603297.1|4100507_4103006_-	Csu fimbrial usher CsuD	NA	NA	NA	NA	NA
WP_148792957.1|4103002_4103836_-	Csu fimbrial biogenesis chaperone CsuC	NA	NA	NA	NA	NA
WP_000876484.1|4103829_4104348_-	Csu fimbrial biogenesis protein CsuB	NA	NA	NA	NA	NA
WP_171059675.1|4104353_4104809_-	Csu fimbrial biogenesis protein CsuA	NA	NA	NA	NA	NA
WP_000790104.1|4104976_4105513_-	Csu fimbrial major subunit CsuAB	NA	NA	NA	NA	NA
WP_010326927.1|4106028_4107054_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_076611894.1|4107279_4108102_-|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_171290682.1|4108153_4108711_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029642295.1|4108779_4108980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572518.1|4108998_4109697_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000423653.1|4109793_4110696_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000397471.1|4110748_4111984_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000054924.1|4112344_4113493_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000097861.1|4113650_4114487_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000429457.1|4114537_4115143_+	LysE family translocator	NA	NA	NA	NA	NA
WP_000469224.1|4115710_4116037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102886.1|4116033_4116504_-	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_000721827.1|4116667_4117030_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_000690466.1|4117319_4117964_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000581929.1|4117960_4118560_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000536980.1|4118534_4119329_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_024437187.1|4119316_4120291_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001094391.1|4120589_4120823_+	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_001058164.1|4120970_4122368_-	amino acid permease	NA	NA	NA	NA	NA
WP_000181277.1|4122470_4124039_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_086241996.1|4124149_4125532_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000802860.1|4125629_4126547_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000177070.1|4127779_4128688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611894.1|4129108_4129930_+|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_001061008.1|4130176_4130731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002080284.1|4130733_4131876_-	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_000792642.1|4131992_4132442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024437189.1|4143676_4145434_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.0	2.4e-39
WP_000912079.1|4146216_4147020_-	protein kinase	NA	B6VC32	Iragoides_fasciata_nucleopolyhedrovirus	33.9	1.3e-05
WP_000461855.1|4147006_4148515_-	DUF3336 domain-containing protein	NA	NA	NA	NA	NA
WP_000190819.1|4148693_4149575_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000744448.1|4149678_4150782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000636261.1|4150784_4151795_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.3	2.1e-125
WP_001136722.1|4151940_4152156_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000209410.1|4152182_4152629_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	1.9e-17
WP_086241998.1|4152720_4154148_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000758325.1|4154292_4155258_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.3	3.8e-15
WP_024437192.1|4155269_4155926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031971918.1|4156026_4157916_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000334671.1|4157994_4159536_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.6	1.9e-85
>prophage 249
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	4165706	4168794	4233827		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	4	NA	NA
WP_002000703.1|4165706_4166876_-	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	3.4e-50
WP_000126912.1|4166961_4167174_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	50.0	1.5e-12
WP_000108398.1|4167548_4167794_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001285359.1|4167927_4168794_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.3	2.1e-44
>prophage 250
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	4183789	4184803	4233827		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001093417.1|4183789_4184803_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	46.7	2.2e-77
>prophage 251
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	4190629	4193114	4233827		Bacillus_phage(66.67%)	3	NA	NA
WP_001257360.1|4190629_4191988_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	24.8	7.6e-17
WP_001221447.1|4191984_4192647_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.1	5.0e-22
WP_000783090.1|4192754_4193114_-	NirD/YgiW/YdeI family stress tolerance protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	3.3e-12
>prophage 252
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	4200807	4203858	4233827	tRNA	Phage_TP(33.33%)	4	NA	NA
WP_000845857.1|4200807_4202178_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	62.9	2.0e-126
WP_001196300.1|4202180_4202444_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	49.4	6.5e-18
WP_000121131.1|4202680_4203010_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000438616.1|4203081_4203858_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	4.8e-24
>prophage 253
NZ_CP027611	Acinetobacter baumannii strain AR_0101 chromosome, complete genome	4233827	4208773	4233346	4233827	tail	Acinetobacter_phage(33.33%)	13	NA	NA
WP_001027064.1|4208773_4211953_+	multidrug efflux RND transporter permease subunit AdeG	NA	S5VTK5	Leptospira_phage	21.7	1.9e-66
WP_000633136.1|4211965_4213414_+	multidrug efflux RND transporter outer membrane subunit AdeH	NA	NA	NA	NA	NA
WP_000457893.1|4213454_4214708_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	2.3e-97
WP_002010476.1|4214768_4214924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024437193.1|4214953_4216183_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001147935.1|4216432_4217119_+	DUF3820 family protein	NA	A0A059VJT9	Pseudomonas_phage	41.6	1.1e-35
WP_160945227.1|4217263_4217899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031974908.1|4218469_4218667_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	54.1	1.5e-11
WP_031974909.1|4218920_4219463_-	N-acetylmuramidase	NA	A0A0B5KTG8	Acinetobacter_phage	91.6	4.4e-93
WP_031974910.1|4219501_4219891_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	84.5	4.3e-58
WP_104877234.1|4219977_4231890_-|tail	phage tail protein	tail	A0A0R6PID2	Moraxella_phage	36.0	2.7e-09
WP_000920735.1|4231947_4232607_-|tail	tail assembly protein	tail	A0A0R6PI87	Moraxella_phage	61.0	7.3e-42
WP_000761333.1|4232590_4233346_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	56.6	3.3e-86
