The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027570	Megasphaera elsdenii DSM 20460 strain ATCC 25940 chromosome, complete genome	2478942	1462155	1552035	2478942	capsid,tRNA,terminase,protease,integrase,plate,portal,holin,tail	Vibrio_phage(18.42%)	111	1478143:1478189	1521488:1521534
WP_014016001.1|1462155_1462893_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_014016002.1|1462889_1463462_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_014016003.1|1463476_1464211_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014016004.1|1464503_1464746_+	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_014016005.1|1464771_1465365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016006.1|1465387_1465948_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_014016007.1|1466422_1466914_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_014016008.1|1467090_1468710_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_014016009.1|1468862_1469141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016010.1|1469179_1470490_+	radical SAM protein	NA	NA	NA	NA	NA
WP_014016012.1|1470879_1471188_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_014016013.1|1471441_1472122_+	EcsC family protein	NA	NA	NA	NA	NA
WP_014016014.1|1472136_1472343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157868798.1|1472398_1472728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041647473.1|1472774_1473764_+	WYL domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_173364625.1|1473878_1475147_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_173364614.1|1475064_1475370_+	PD-(D/E)XK nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_014016019.1|1475465_1476995_+	methylmalonyl-CoA carboxyltransferase	NA	NA	NA	NA	NA
WP_014016021.1|1477528_1477936_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
1478143:1478189	attL	TGGTGGACCATCAGGGGATCGAACCCTGGACACCCTGATTAAGAGTC	NA	NA	NA	NA
WP_014016022.1|1478311_1479388_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	33.5	4.1e-42
WP_014016023.1|1479431_1479647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014016024.1|1479664_1480498_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	66.7	2.0e-76
WP_014016025.1|1480712_1481267_-	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	30.4	1.8e-17
WP_014016026.1|1481371_1482802_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	52.7	1.5e-68
WP_014016027.1|1482838_1483453_-	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	32.2	3.1e-18
WP_041647139.1|1483628_1483829_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6B2	Bacillus_phage	45.6	2.8e-05
WP_014016028.1|1483964_1484198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041647142.1|1484696_1485233_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014016032.1|1485299_1485470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016033.1|1485484_1485745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016034.1|1485760_1486042_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014016035.1|1486266_1486542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016036.1|1486544_1486766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016037.1|1486919_1487663_+	ParA family protein	NA	H7BUL8	unidentified_phage	34.2	5.9e-24
WP_014016038.1|1487659_1488754_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014016039.1|1488740_1489292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016040.1|1489304_1489742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016041.1|1489981_1490824_+	hypothetical protein	NA	I2E8X7	Clostridium_phage	32.0	1.6e-28
WP_014016042.1|1491049_1491241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016043.1|1491250_1491445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016044.1|1491441_1491897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016045.1|1491893_1492337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016046.1|1492857_1493376_+	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	35.7	1.7e-14
WP_014016047.1|1493372_1495283_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	43.1	7.1e-138
WP_014016048.1|1495291_1495510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016049.1|1495522_1497115_+|portal	phage portal protein	portal	A0A2K9V452	Faecalibacterium_phage	40.3	1.2e-103
WP_014016050.1|1497104_1498175_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	35.2	7.5e-36
WP_014016051.1|1498174_1498510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016052.1|1498522_1499575_+|capsid	major capsid protein	capsid	A0A0K2FHW2	Achromobacter_phage	24.9	1.2e-06
WP_014016053.1|1499586_1499829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016054.1|1499825_1500152_+	hypothetical protein	NA	A0A0C5AJ53	Bacteriophage	35.6	2.0e-08
WP_014016055.1|1500160_1500676_+	hypothetical protein	NA	A0A067ZG41	Vibrio_phage	33.3	6.2e-12
WP_014016056.1|1500680_1501190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016057.1|1501182_1501419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016058.1|1501420_1502866_+|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	50.4	8.1e-126
WP_014016059.1|1502878_1503409_+|tail	phage major tail tube protein	tail	A0A2K9V323	Faecalibacterium_phage	37.6	2.3e-22
WP_014016060.1|1503419_1503746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157868799.1|1503766_1503913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016062.1|1507455_1507659_+|tail	tail protein X	tail	A0A2K9V482	Faecalibacterium_phage	50.0	1.2e-11
WP_014016063.1|1507663_1508830_+	phage regulatory protein	NA	A0A0C5AJ59	Bacteriophage	32.0	3.6e-44
WP_014016064.1|1508819_1509284_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	28.2	3.0e-10
WP_014016065.1|1509292_1509763_+|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	32.3	7.1e-15
WP_014016066.1|1509773_1510088_+	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	46.1	5.1e-17
WP_014016067.1|1510074_1511190_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	47.0	7.4e-87
WP_014016068.1|1511186_1512494_+|tail	phage tail protein I	tail	A0A2K9V471	Faecalibacterium_phage	38.7	1.6e-19
WP_014016069.1|1512499_1514149_+	hypothetical protein	NA	G3MAG1	Bacillus_virus	22.4	1.6e-05
WP_014016070.1|1514170_1514620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016071.1|1514625_1515696_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	Q8H9N0	Vibrio_phage	38.7	3.6e-62
WP_051014214.1|1515804_1516104_+	diversity-generating retroelement protein Avd	NA	D4HTV8	Vibrio_phage	46.3	1.1e-18
WP_041647154.1|1516425_1517502_+	DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	52.4	1.0e-104
WP_041647483.1|1517501_1517945_+|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	47.2	1.6e-21
WP_014016075.1|1517941_1518511_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A142F1B8	Bacillus_phage	37.1	1.7e-15
WP_014016076.1|1518529_1518808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016077.1|1519117_1519837_-	hypothetical protein	NA	H7BW64	unidentified_phage	46.8	2.2e-07
WP_014016078.1|1520006_1520204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016079.1|1520298_1520733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016080.1|1520814_1521003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016081.1|1521085_1521322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016082.1|1521778_1523236_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.9	9.5e-50
1521488:1521534	attR	TGGTGGACCATCAGGGGATCGAACCCTGGACACCCTGATTAAGAGTC	NA	NA	NA	NA
WP_014016083.1|1523226_1524033_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_014016084.1|1524058_1524892_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_014016085.1|1524888_1526367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014016086.1|1526613_1528164_+	acyl CoA:acetate/3-ketoacid CoA transferase	NA	NA	NA	NA	NA
WP_014016087.1|1528247_1528652_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_014016088.1|1528812_1529490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016089.1|1529616_1531272_-	acetolactate synthase large subunit	NA	NA	NA	NA	NA
WP_014016090.1|1531708_1532134_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014016091.1|1532196_1532757_+	signal peptidase I	NA	NA	NA	NA	NA
WP_014016092.1|1532902_1533394_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_014016093.1|1533397_1533892_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	65.9	1.2e-49
WP_014016094.1|1533961_1534345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016095.1|1534478_1535585_-	acyltransferase	NA	NA	NA	NA	NA
WP_014016096.1|1535673_1536186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016097.1|1536200_1536608_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_014016098.1|1536629_1537205_+	GTP cyclohydrolase I	NA	R4TMI5	Halovirus	38.6	3.4e-27
WP_014016099.1|1537197_1537563_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014016100.1|1537555_1538038_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	40.1	6.6e-16
WP_014016101.1|1538040_1538706_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	4.3e-42
WP_014016102.1|1538702_1540256_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014016103.1|1540522_1540753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895104.1|1540749_1541478_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014016105.1|1541501_1542290_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_014016106.1|1542394_1543102_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_014016107.1|1543110_1543935_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_014016108.1|1543964_1544294_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	57.3	1.0e-31
WP_014016109.1|1544283_1544916_+	radical SAM protein	NA	S4TZT1	uncultured_phage	51.2	1.7e-48
WP_014016110.1|1544935_1545568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014016112.1|1545793_1547272_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014016113.1|1547484_1548132_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_014016114.1|1548177_1551099_+	insulinase family protein	NA	NA	NA	NA	NA
WP_014016115.1|1551111_1552035_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP027570	Megasphaera elsdenii DSM 20460 strain ATCC 25940 chromosome, complete genome	2478942	1579020	1586230	2478942	protease	Agrobacterium_phage(16.67%)	7	NA	NA
WP_027895124.1|1579020_1579617_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.7	3.1e-55
WP_014016142.1|1579634_1580873_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.5	2.1e-143
WP_014016143.1|1580945_1583279_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.4	5.6e-177
WP_014016144.1|1583278_1583914_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014016145.1|1584110_1584482_+	thioredoxin	NA	A0A2I2L415	Orpheovirus	30.4	2.1e-09
WP_014016146.1|1584518_1585445_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	39.7	9.6e-56
WP_014016147.1|1585486_1586230_+	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	34.4	9.5e-22
>prophage 3
NZ_CP027570	Megasphaera elsdenii DSM 20460 strain ATCC 25940 chromosome, complete genome	2478942	1987743	1995530	2478942	transposase	uncultured_phage(14.29%)	12	NA	NA
WP_014016889.1|1987743_1988193_+	dUTP diphosphatase	NA	S4U059	uncultured_phage	44.8	1.3e-29
WP_041647284.1|1988212_1988893_+	site-specific DNA-methyltransferase	NA	A0A1C9C5F8	Heterosigma_akashiwo_virus	26.2	3.0e-14
WP_014016887.1|1988915_1989134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016886.1|1989137_1989344_+	hypothetical protein	NA	H7BV51	unidentified_phage	48.5	1.2e-11
WP_014016885.1|1989570_1989840_+	DUF3310 domain-containing protein	NA	W5R8R5	Staphylococcus_phage	42.3	4.5e-06
WP_014016884.1|1989844_1990342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016883.1|1990334_1990787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016882.1|1990792_1991332_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014016881.1|1991312_1991576_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_014016880.1|1991575_1992193_+	anaerobic ribonucleoside-triphosphate reductase large subunit	NA	A0A060AN10	Cronobacter_phage	41.5	3.5e-38
WP_014016879.1|1992466_1994200_+	anaerobic ribonucleoside triphosphate reductase	NA	Q332F0	Clostridium_botulinum_C_phage	36.0	3.2e-97
WP_014015019.1|1994615_1995530_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.0	1.5e-40
>prophage 4
NZ_CP027570	Megasphaera elsdenii DSM 20460 strain ATCC 25940 chromosome, complete genome	2478942	2339508	2346567	2478942		Synechococcus_phage(33.33%)	6	NA	NA
WP_014016575.1|2339508_2340114_-	IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	53.9	2.0e-49
WP_014016574.1|2340133_2340748_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.3	1.7e-24
WP_014016573.1|2340740_2341805_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D8KLC2	Synechococcus_phage	41.3	9.3e-63
WP_014016572.1|2341785_2343213_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	4.9e-59
WP_173364629.1|2343257_2343734_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.3	3.1e-26
WP_014016570.1|2344035_2346567_+	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	23.0	1.1e-21
