The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	0	22368	3892138		Klosneuvirus(100.0%)	21	NA	NA
WP_106470571.1|1533_1839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106470572.1|1873_2419_-	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
WP_106470573.1|2411_5342_-	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_106470574.1|5338_5602_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_106473856.1|5731_6985_-	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_106473857.1|7126_8557_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_149615423.1|8811_10230_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_106470576.1|10229_10793_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_106470577.1|10793_11339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106473858.1|11317_11839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106470578.1|11972_12269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470579.1|12272_12860_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106470580.1|13390_14677_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_106470581.1|14714_15689_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_106470582.1|15793_17539_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_106470583.1|18208_18787_+	DedA family protein	NA	NA	NA	NA	NA
WP_106470584.1|18783_19245_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_106473859.1|19285_19720_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_106473860.1|19824_20250_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106473861.1|20369_21296_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	33.0	3.7e-23
WP_106470585.1|21309_22368_+	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	49.4	1.9e-87
>prophage 2
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	25511	27074	3892138		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_106470588.1|25511_27074_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.1	1.3e-09
>prophage 3
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	33414	34791	3892138		Planktothrix_phage(50.0%)	2	NA	NA
WP_106470596.1|33414_34500_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	2.4e-21
WP_106473863.1|34533_34791_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	89.9	4.3e-30
>prophage 4
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	38905	39664	3892138		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_106470600.1|38905_39664_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	3.1e-12
>prophage 5
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	42882	46301	3892138		Bacillus_phage(100.0%)	3	NA	NA
WP_106470604.1|42882_45564_-	sodium:solute symporter	NA	W8CYF6	Bacillus_phage	28.5	1.4e-14
WP_106473866.1|45560_45857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106470605.1|45920_46301_-	response regulator	NA	W8CYM9	Bacillus_phage	34.2	2.8e-14
>prophage 6
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	51669	52425	3892138		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_106470610.1|51669_52425_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.6	5.3e-12
>prophage 7
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	56573	59395	3892138		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_106470615.1|56573_58439_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	2.2e-11
WP_106473867.1|58435_59395_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.9	1.8e-17
>prophage 8
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	62603	63356	3892138		Planktothrix_phage(100.0%)	1	NA	NA
WP_106470620.1|62603_63356_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	9.6e-30
>prophage 9
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	79347	83685	3892138		Bacillus_phage(50.0%)	3	NA	NA
WP_106470638.1|79347_81090_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.9	3.8e-29
WP_106470639.1|81086_81719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470640.1|81963_83685_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	31.0	1.1e-31
>prophage 10
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	89488	93912	3892138	protease	Tupanvirus(33.33%)	5	NA	NA
WP_106470646.1|89488_90241_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.2	2.3e-15
WP_106470647.1|90237_90735_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_106473870.1|90895_91747_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_106470648.1|91860_92493_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.3	1.7e-56
WP_106470649.1|92643_93912_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.3	2.3e-132
>prophage 11
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	97255	98326	3892138		Synechococcus_phage(100.0%)	1	NA	NA
WP_106470655.1|97255_98326_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	V5UTY8	Synechococcus_phage	37.7	2.4e-10
>prophage 12
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	112441	115665	3892138		Halovirus(33.33%)	4	NA	NA
WP_106473871.1|112441_113041_+	Rhs element Vgr protein	NA	R4T6M7	Halovirus	27.3	1.5e-09
WP_106470667.1|113053_113449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470668.1|113452_113929_+	hypothetical protein	NA	G9J1Z4	Bacillus_phage	34.9	3.2e-07
WP_106470669.1|113925_115665_+	hypothetical protein	NA	Q8V6M5	Halorubrum_phage	36.2	6.3e-16
>prophage 13
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	133092	139345	3892138	tRNA	uncultured_Mediterranean_phage(80.0%)	7	NA	NA
WP_106470682.1|133092_133707_-	heme ABC exporter ATP-binding protein CcmA	NA	G9BWD6	Planktothrix_phage	28.9	9.9e-09
WP_106470683.1|133792_134146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473877.1|134147_134903_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_106470684.1|134930_135899_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	50.9	6.5e-63
WP_106470685.1|135900_137562_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	22.9	3.3e-06
WP_106470686.1|137595_137880_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	59.6	4.3e-23
WP_106470687.1|138052_139345_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.2	4.9e-82
>prophage 14
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	150704	154514	3892138		Bacillus_phage(50.0%)	3	NA	NA
WP_106470696.1|150704_152516_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	30.1	4.6e-46
WP_106470697.1|152525_153854_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_106470698.1|153962_154514_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	26.6	4.4e-08
>prophage 15
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	197735	200513	3892138		Salicola_phage(100.0%)	1	NA	NA
WP_106473882.1|197735_200513_-	disulfide oxidoreductase	NA	A0A248SJQ0	Salicola_phage	32.3	2.4e-17
>prophage 16
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	206088	206358	3892138		Escherichia_phage(100.0%)	1	NA	NA
WP_106473885.1|206088_206358_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	45.1	6.5e-13
>prophage 17
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	214851	218214	3892138		Bacillus_phage(33.33%)	4	NA	NA
WP_106470750.1|214851_215877_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.4	4.6e-35
WP_106470751.1|215873_217055_-	cystathionine gamma-synthase	NA	A0A2I2L687	Orpheovirus	29.1	1.1e-06
WP_106470752.1|217054_217576_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_106470753.1|217572_218214_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	39.6	5.0e-11
>prophage 18
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	225232	231362	3892138		Brazilian_cedratvirus(33.33%)	6	NA	NA
WP_106470759.1|225232_226015_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.2	1.7e-08
WP_106470760.1|226111_226939_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.4	5.6e-15
WP_106470761.1|226942_227953_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106470762.1|227949_229251_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106470763.1|229300_229636_-	GYD domain-containing protein	NA	NA	NA	NA	NA
WP_106470764.1|229820_231362_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	43.2	7.9e-79
>prophage 19
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	237905	249054	3892138		Streptococcus_phage(25.0%)	8	NA	NA
WP_106470770.1|237905_239729_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.5	8.6e-24
WP_106470771.1|239762_241382_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.6	1.8e-33
WP_106470772.1|241495_243115_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_106470773.1|243129_243801_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_106470774.1|243797_245249_-	glucose-6-phosphate dehydrogenase	NA	A0A1D8KIX9	Synechococcus_phage	37.2	1.6e-73
WP_106470775.1|245392_245683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473888.1|245820_246090_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_106470776.1|246288_249054_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.2	2.2e-95
>prophage 20
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	255302	262389	3892138		Vibrio_phage(33.33%)	6	NA	NA
WP_106470782.1|255302_255983_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	25.9	8.2e-12
WP_106473890.1|256012_257038_-	patatin	NA	NA	NA	NA	NA
WP_106470783.1|257146_257920_-	3-hydroxybutyrate dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.8	1.0e-10
WP_106470784.1|258358_260074_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106470785.1|260177_260801_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106470786.1|260865_262389_+	acyl--CoA ligase	NA	A0A2K9KZV5	Tupanvirus	23.4	7.4e-21
>prophage 21
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	268252	269743	3892138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106470794.1|268252_269743_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	29.3	3.6e-36
>prophage 22
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	273352	274075	3892138		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_106470799.1|273352_274075_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.5	1.1e-06
>prophage 23
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	278491	280844	3892138		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_106470805.1|278491_280135_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	2.0e-152
WP_106470806.1|280160_280844_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.4	9.7e-13
>prophage 24
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	307732	349379	3892138	terminase,transposase,capsid,holin	Klosneuvirus(12.5%)	41	NA	NA
WP_106470826.1|307732_309391_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.1	1.4e-57
WP_106470827.1|309390_310050_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_106470828.1|310049_311507_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_106470829.1|311503_313066_-|holin	choline-sulfatase	holin	A0A1V0SA98	Catovirus	23.4	1.8e-14
WP_106473897.1|313062_313632_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_106473898.1|313736_314597_-	DMT family transporter	NA	NA	NA	NA	NA
WP_106470830.1|314690_315290_-	amino acid transporter	NA	NA	NA	NA	NA
WP_106470831.1|315378_316257_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_106470832.1|316355_317048_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_106470833.1|317102_317843_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_106470834.1|317932_319705_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_106470835.1|319765_320500_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_106470836.1|320601_322260_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
WP_106470837.1|322267_323047_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_106470838.1|323111_324890_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_106470839.1|324933_325857_-	DMT family transporter	NA	NA	NA	NA	NA
WP_106470840.1|325853_326666_-	YmdB family metallophosphoesterase	NA	NA	NA	NA	NA
WP_106470841.1|326776_327001_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_106470842.1|327032_327587_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_106470843.1|327583_328978_-	magnesium transporter	NA	NA	NA	NA	NA
WP_106470844.1|329108_330422_+	guanine deaminase	NA	NA	NA	NA	NA
WP_106470845.1|330431_330749_-	arsenate reductase	NA	NA	NA	NA	NA
WP_106470846.1|330988_331195_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	1.8e-10
WP_106473899.1|331258_332167_-	FAD-dependent thymidylate synthase	NA	M4QT16	Loktanella_phage	60.8	2.6e-98
WP_106473900.1|332342_332771_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_106473901.1|332737_333493_+	DUF1194 domain-containing protein	NA	NA	NA	NA	NA
WP_106473902.1|333489_333981_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106473903.1|334044_334272_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_106470847.1|334307_334709_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106470848.1|334815_336018_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_106470849.1|336025_336436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470850.1|336462_337827_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_106470851.1|338012_338942_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_106470852.1|339073_339967_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_106470853.1|339963_340575_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_106470854.1|340741_342697_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	39.2	1.6e-113
WP_149615428.1|344774_344921_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_106470855.1|345274_346505_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	57.3	2.3e-81
WP_106470856.1|346747_347254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470857.1|347498_348761_+|capsid	phage major capsid protein	capsid	G8EXZ9	Synechococcus_phage	27.1	7.3e-14
WP_149615429.1|348980_349379_+|terminase	P27 family phage terminase small subunit	terminase	A0A0U2C0X7	Paracoccus_phage	40.3	2.8e-12
>prophage 25
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	363084	363366	3892138		Geobacillus_virus(100.0%)	1	NA	NA
WP_106470873.1|363084_363366_-	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	38.6	4.8e-11
>prophage 26
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	366957	368313	3892138		Hokovirus(100.0%)	1	NA	NA
WP_106470877.1|366957_368313_-	cytochrome P450	NA	A0A1V0SF03	Hokovirus	27.6	2.5e-12
>prophage 27
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	378513	379272	3892138		Synechococcus_phage(100.0%)	1	NA	NA
WP_106470883.1|378513_379272_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	40.9	1.1e-44
>prophage 28
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	386674	391569	3892138		Synechococcus_phage(25.0%)	7	NA	NA
WP_106470892.1|386674_387271_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	4.8e-24
WP_106470893.1|387267_388314_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	42.0	1.5e-57
WP_106470894.1|388760_389027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470895.1|389028_389700_+	SOS response-associated peptidase	NA	A0A2D1GMM4	Marinobacter_phage	31.6	6.8e-11
WP_106470896.1|389732_389984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615433.1|390289_390640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470897.1|391260_391569_-	hypothetical protein	NA	A0A1B0T6F7	Thiobacimonas_phage	40.4	9.7e-13
>prophage 29
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	397718	401996	3892138		Paracoccus_phage(100.0%)	3	NA	NA
WP_106470907.1|397718_400904_-	hypothetical protein	NA	A0A0U2C146	Paracoccus_phage	42.0	1.2e-129
WP_106470908.1|400900_401317_-	hypothetical protein	NA	A0A0U2C0Z1	Paracoccus_phage	50.0	2.8e-31
WP_106470909.1|401321_401996_-	hypothetical protein	NA	A0A0U2C133	Paracoccus_phage	33.3	7.3e-21
>prophage 30
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	405990	429696	3892138	head,tail,protease,terminase,capsid,integrase,portal	Emiliania_huxleyi_virus(31.25%)	34	413675:413692	433778:433795
WP_106470914.1|405990_406395_-	hypothetical protein	NA	A0A141GEW6	Brucella_phage	44.1	1.6e-23
WP_106470915.1|406394_406799_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_106470916.1|406795_407131_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_106470917.1|407127_407703_-	hypothetical protein	NA	A0A141GEW4	Brucella_phage	41.1	2.8e-37
WP_106473909.1|407707_407890_-	hypothetical protein	NA	A0A2H4JDE5	uncultured_Caudovirales_phage	44.4	5.7e-05
WP_106470918.1|407949_409149_-|capsid	phage major capsid protein	capsid	A0A0U2C0U7	Paracoccus_phage	61.5	3.0e-126
WP_106470919.1|409182_409857_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	53.3	1.2e-47
WP_106473910.1|409840_410950_-|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	58.4	5.6e-119
WP_106470920.1|411048_412764_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	45.7	1.5e-131
WP_106473911.1|412756_413215_-	hypothetical protein	NA	I3ULZ5	Rhodobacter_phage	42.0	1.0e-21
413675:413692	attL	ACCAGTTCACCCACACCG	NA	NA	NA	NA
WP_106470921.1|414277_415081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106470922.1|415508_417227_-	hypothetical protein	NA	G8DGC0	Emiliania_huxleyi_virus	55.1	3.2e-174
WP_106470923.1|417223_417631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149615440.1|417630_417846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106470924.1|417842_418925_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_106470925.1|419177_419414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106470926.1|419406_419628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106470927.1|419757_420111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106470928.1|420107_420557_-	hypothetical protein	NA	G8DGB3	Emiliania_huxleyi_virus	51.5	2.4e-28
WP_149615441.1|420711_421599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470930.1|422050_422497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615442.1|422623_422995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470932.1|422994_423210_+	hypothetical protein	NA	G8DH83	Emiliania_huxleyi_virus	42.0	5.5e-07
WP_106470933.1|423206_423500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470934.1|423496_423763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470935.1|423844_424141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470936.1|424137_424407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470937.1|424399_426454_+	DNA methyltransferase	NA	A0A1X9HVK8	Ruegeria_phage	72.5	3.3e-274
WP_106473912.1|426594_426798_+	hypothetical protein	NA	G8DH77	Emiliania_huxleyi_virus	67.2	1.3e-18
WP_106470938.1|427116_427353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470939.1|427349_427589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106473913.1|427654_427828_+	helix-turn-helix domain-containing protein	NA	I3UM25	Rhodobacter_phage	67.3	7.8e-12
WP_106470940.1|427830_428928_+|integrase	site-specific integrase	integrase	G8DH71	Emiliania_huxleyi_virus	47.2	3.2e-90
WP_106470941.1|429027_429696_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	35.0	1.0e-14
433778:433795	attR	CGGTGTGGGTGAACTGGT	NA	NA	NA	NA
>prophage 31
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	433292	435443	3892138		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_106473914.1|433292_435443_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	1.7e-34
>prophage 32
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	440842	441628	3892138		Bacillus_virus(100.0%)	1	NA	NA
WP_106470948.1|440842_441628_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	4.6e-35
>prophage 33
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	448689	450309	3892138		Tetraselmis_virus(100.0%)	1	NA	NA
WP_106470954.1|448689_450309_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	49.7	1.1e-142
>prophage 34
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	453368	454430	3892138	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_149615444.1|453368_454430_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	56.1	1.9e-39
>prophage 35
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	464856	467955	3892138	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_106470969.1|464856_467955_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	32.8	9.5e-124
>prophage 36
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	472322	474179	3892138		Bacillus_phage(100.0%)	1	NA	NA
WP_106470974.1|472322_474179_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	1.5e-44
>prophage 37
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	490685	498518	3892138	tRNA	uncultured_virus(33.33%)	5	NA	NA
WP_106473921.1|490685_493211_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	1.2e-92
WP_106470987.1|493221_493629_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_106470988.1|493855_494620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106470989.1|494705_497120_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	49.2	2.9e-205
WP_106470990.1|497387_498518_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	53.5	1.2e-103
>prophage 38
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	508456	509560	3892138		Tupanvirus(100.0%)	1	NA	NA
WP_106473923.1|508456_509560_-	class II histone deacetylase	NA	A0A2K9L473	Tupanvirus	33.3	2.2e-22
>prophage 39
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	519123	521838	3892138	tRNA	Escherichia_phage(33.33%)	4	NA	NA
WP_106471010.1|519123_519720_+	thymidine kinase	NA	A8R997	Escherichia_phage	55.8	6.4e-53
WP_106471011.1|519729_520656_-	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	29.9	5.5e-11
WP_106471012.1|520679_521030_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_106471013.1|521022_521838_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.1	8.0e-22
>prophage 40
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	525849	531048	3892138		Rhizobium_phage(33.33%)	4	NA	NA
WP_106471019.1|525849_526836_+	cobaltochelatase subunit CobS	NA	L7TKP0	Rhizobium_phage	34.3	4.5e-35
WP_149615446.1|526835_527342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471020.1|527338_529207_+	cobaltochelatase subunit CobT	NA	J9Q7G6	Salmonella_phage	27.3	5.3e-13
WP_106473924.1|529257_531048_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	33.4	2.0e-81
>prophage 41
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	559081	563271	3892138	holin	Bacillus_phage(50.0%)	2	NA	NA
WP_106473928.1|559081_561493_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.4e-114
WP_106473929.1|561645_563271_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.3	6.6e-52
>prophage 42
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	567399	568473	3892138		Mycoplasma_phage(100.0%)	1	NA	NA
WP_106471045.1|567399_568473_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	1.8e-21
>prophage 43
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	585723	587229	3892138		Catovirus(100.0%)	1	NA	NA
WP_106471056.1|585723_587229_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	6.7e-75
>prophage 44
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	595427	600340	3892138		Erwinia_phage(50.0%)	6	NA	NA
WP_106471064.1|595427_595889_-	NUDIX hydrolase	NA	A0A2H4IB87	Erwinia_phage	38.1	9.4e-12
WP_106471065.1|596000_596759_-	EcsC family protein	NA	NA	NA	NA	NA
WP_106473931.1|596790_597288_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_106471066.1|597364_597970_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_106471067.1|597969_598608_+	CatB-related O-acetyltransferase	NA	NA	NA	NA	NA
WP_106471068.1|598711_600340_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	5.6e-91
>prophage 45
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	603636	604176	3892138		Klosneuvirus(100.0%)	1	NA	NA
WP_106473933.1|603636_604176_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.1	3.4e-29
>prophage 46
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	608002	609265	3892138		Tupanvirus(100.0%)	1	NA	NA
WP_106471074.1|608002_609265_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.3	1.0e-28
>prophage 47
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	616635	627328	3892138		Thermus_phage(25.0%)	11	NA	NA
WP_106471081.1|616635_617790_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	42.9	1.7e-25
WP_106471082.1|617972_620525_+	type I DNA topoisomerase	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	31.6	1.9e-101
WP_106471083.1|620564_621161_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106471084.1|621226_621652_+	glyoxalase	NA	NA	NA	NA	NA
WP_106471085.1|621743_622448_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_106471086.1|622447_623089_+	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_106471087.1|623152_623971_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	51.5	5.4e-18
WP_106471088.1|624309_624552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471089.1|624655_624856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471090.1|624886_625744_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_106471091.1|625933_627328_+	type II and III secretion system protein family protein	NA	D0U174	Enterobacteria_phage	24.6	2.7e-09
>prophage 48
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	641616	648668	3892138	tRNA	Enterococcus_phage(33.33%)	6	NA	NA
WP_106473937.1|641616_642519_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.6	9.4e-32
WP_106473938.1|642566_642872_-	chorismate mutase	NA	NA	NA	NA	NA
WP_106471105.1|642932_644609_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_106471106.1|644789_645368_-	sulfurase	NA	NA	NA	NA	NA
WP_106471107.1|645452_647369_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	42.8	4.3e-119
WP_106473939.1|647447_648668_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1HHJ8	Acanthocystis_turfacea_Chlorella_virus	32.2	1.6e-10
>prophage 49
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	654859	655888	3892138		Bacillus_phage(100.0%)	1	NA	NA
WP_106471116.1|654859_655888_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.3	1.2e-06
>prophage 50
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	659886	662032	3892138		Bacillus_virus(50.0%)	2	NA	NA
WP_106473941.1|659886_660960_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.5	9.5e-15
WP_106471122.1|660952_662032_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.9	1.6e-09
>prophage 51
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	666474	667182	3892138		Planktothrix_phage(100.0%)	1	NA	NA
WP_106471125.1|666474_667182_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.5e-37
>prophage 52
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	674798	677237	3892138	tRNA	Synechococcus_phage(100.0%)	4	NA	NA
WP_106471133.1|674798_675716_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	27.8	6.9e-06
WP_106471134.1|675719_676223_-	peptide deformylase	NA	NA	NA	NA	NA
WP_106471135.1|676219_676717_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.0	8.0e-17
WP_106471136.1|676718_677237_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	49.2	4.9e-25
>prophage 53
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	699354	702125	3892138		Geobacillus_phage(50.0%)	4	NA	NA
WP_106471161.1|699354_700170_-	glycoside hydrolase family 25 protein	NA	A0A1U9WQS3	Geobacillus_phage	35.9	1.2e-20
WP_106471162.1|700539_700926_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_106471163.1|700938_701160_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_106471164.1|701321_702125_+	P-loop NTPase	NA	D3JZ99	Mycobacterium_phage	32.9	1.3e-05
>prophage 54
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	710380	714103	3892138		Catovirus(50.0%)	2	NA	NA
WP_106471172.1|710380_711394_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	28.9	8.4e-29
WP_106471173.1|711484_714103_-	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	37.7	9.8e-122
>prophage 55
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	726878	727898	3892138		Hokovirus(100.0%)	1	NA	NA
WP_106471186.1|726878_727898_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	33.8	7.1e-44
>prophage 56
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	735407	737729	3892138	protease	Agrobacterium_phage(100.0%)	1	NA	NA
WP_106471193.1|735407_737729_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.8	1.2e-171
>prophage 57
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	752763	774996	3892138	tRNA	Mycoplasma_phage(25.0%)	21	NA	NA
WP_106471205.1|752763_753849_-	histidinol-phosphate transaminase	NA	A0A1X7BZP2	Faustovirus	26.8	7.9e-17
WP_106471206.1|753910_754600_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_106471207.1|754596_755685_-	ATP phosphoribosyltransferase regulatory subunit	NA	A0A2K9L6G5	Tupanvirus	22.4	3.3e-07
WP_106471208.1|755684_757325_-|tRNA	histidine--tRNA ligase	tRNA	A0A1V0S921	Catovirus	31.5	5.4e-09
WP_106471209.1|757405_757867_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106471210.1|757977_759405_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1C9C5E2	Heterosigma_akashiwo_virus	31.2	5.5e-42
WP_106471211.1|759457_759889_-	DUF1489 domain-containing protein	NA	NA	NA	NA	NA
WP_106471212.1|760019_762503_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	M4QT32	Loktanella_phage	61.2	4.3e-284
WP_106471213.1|762670_763021_-	RidA family protein	NA	NA	NA	NA	NA
WP_106471214.1|763037_764138_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_106471215.1|764134_765163_-	histone deacetylase family protein	NA	A0A2K9L4C2	Tupanvirus	33.5	3.1e-31
WP_106471216.1|765159_765639_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_106471217.1|765635_766565_-	3-keto-5-aminohexanoate cleavage protein	NA	A0A1V0SL81	Klosneuvirus	25.7	1.8e-17
WP_106471218.1|766566_767904_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.3	1.3e-21
WP_106471219.1|767905_768982_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.0	3.3e-23
WP_106473950.1|769036_770173_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_106471220.1|770223_771015_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_106471221.1|771014_771881_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	25.5	3.8e-06
WP_106471222.1|771976_772957_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106471223.1|772981_773989_-	ATP-binding cassette domain-containing protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	27.0	1.2e-06
WP_106471224.1|773985_774996_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.2	7.6e-06
>prophage 58
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	787926	789555	3892138		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_106471236.1|787926_789555_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.2	1.9e-06
>prophage 59
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	816709	817873	3892138		uncultured_phage(100.0%)	1	NA	NA
WP_106471260.1|816709_817873_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	34.4	1.1e-13
>prophage 60
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	821655	823086	3892138		Gordonia_phage(100.0%)	1	NA	NA
WP_106471265.1|821655_823086_-	exodeoxyribonuclease VII large subunit	NA	A0A160DF99	Gordonia_phage	36.0	1.0e-32
>prophage 61
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	826633	828055	3892138		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_106471269.1|826633_828055_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.1	5.8e-28
>prophage 62
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	837254	838547	3892138		Pandoravirus(100.0%)	1	NA	NA
WP_106471280.1|837254_838547_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	32.4	4.0e-52
>prophage 63
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	850056	856335	3892138		Moraxella_phage(50.0%)	4	NA	NA
WP_106471290.1|850056_851397_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	1.2e-30
WP_106471291.1|851539_853063_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_106471292.1|853236_853413_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_106471293.1|853533_856335_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	34.7	4.8e-42
>prophage 64
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	874017	874566	3892138		Agrobacterium_phage(100.0%)	1	NA	NA
WP_106471316.1|874017_874566_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.4e-14
>prophage 65
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	892512	893532	3892138		Bacillus_phage(100.0%)	1	NA	NA
WP_106471328.1|892512_893532_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.2	3.7e-16
>prophage 66
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	897029	898427	3892138		Bacillus_phage(100.0%)	1	NA	NA
WP_106471333.1|897029_898427_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.3	7.8e-17
>prophage 67
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	908312	909815	3892138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106471345.1|908312_909815_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	1.2e-15
>prophage 68
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	917341	918358	3892138	holin	Planktothrix_phage(100.0%)	1	NA	NA
WP_106471350.1|917341_918358_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G9BWD6	Planktothrix_phage	40.2	1.1e-28
>prophage 69
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	931487	933203	3892138	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_106471362.1|931487_933203_+|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	33.4	1.1e-81
>prophage 70
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	936574	937060	3892138		Acinetobacter_phage(100.0%)	1	NA	NA
WP_106471365.1|936574_937060_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	37.7	4.6e-17
>prophage 71
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	944829	949840	3892138		Pandoravirus(33.33%)	5	NA	NA
WP_106471373.1|944829_945525_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	29.9	1.0e-17
WP_106471374.1|945679_947173_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	37.9	1.1e-74
WP_106471375.1|947283_948318_+	alanine racemase	NA	NA	NA	NA	NA
WP_106471376.1|948314_949097_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106471377.1|949093_949840_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.7	2.4e-09
>prophage 72
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	953236	953821	3892138		Agrobacterium_phage(100.0%)	1	NA	NA
WP_106471383.1|953236_953821_-	HNH endonuclease	NA	A0A223W0A5	Agrobacterium_phage	42.6	3.9e-31
>prophage 73
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	960356	973790	3892138	tRNA	uncultured_Mediterranean_phage(57.14%)	16	NA	NA
WP_106471391.1|960356_961724_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	35.0	6.6e-45
WP_106471392.1|962057_963569_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.3	1.4e-51
WP_106471393.1|963748_964006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106473960.1|964070_964727_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_106471394.1|964805_965588_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	34.8	1.4e-31
WP_106471395.1|965584_966232_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	43.9	3.8e-27
WP_106473961.1|966290_967451_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_106471396.1|967524_967857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471397.1|967863_968709_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_106473962.1|968914_969985_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	7.5e-28
WP_106471398.1|970083_970929_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_149615457.1|970938_971325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471400.1|971331_972000_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_106471401.1|972216_972432_+	Sec-independent protein translocase TatA	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	53.2	4.0e-05
WP_106471402.1|972438_972909_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_106471403.1|972905_973790_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	37.8	1.2e-36
>prophage 74
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	984565	1026321	3892138	transposase,integrase	Burkholderia_virus(14.29%)	38	1014921:1014937	1031265:1031281
WP_106471414.1|984565_985039_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106470855.1|985182_986413_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	57.3	2.3e-81
WP_106471415.1|987791_989666_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_106471416.1|989812_990382_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_106471417.1|990435_991986_-	acetolactate synthase large subunit	NA	NA	NA	NA	NA
WP_106471418.1|992076_993294_-	CoA transferase	NA	NA	NA	NA	NA
WP_106471419.1|993290_994067_-	CoA synthetase	NA	NA	NA	NA	NA
WP_106471420.1|994063_994876_-	CoA synthetase	NA	NA	NA	NA	NA
WP_106471421.1|994948_996985_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_106471422.1|997047_998211_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_106471423.1|998261_999305_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_106471424.1|999372_1000059_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106471425.1|1000103_1002296_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_106473963.1|1002287_1003112_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_106471426.1|1003114_1004464_+	Ktr system potassium transporter B	NA	NA	NA	NA	NA
WP_106471427.1|1004545_1004857_+	ETC complex I subunit	NA	NA	NA	NA	NA
WP_106471428.1|1004879_1007225_-	bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase	NA	NA	NA	NA	NA
WP_106473964.1|1007221_1007653_-	RidA family protein	NA	NA	NA	NA	NA
WP_106471429.1|1007673_1008363_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.7	3.6e-07
WP_106471430.1|1008359_1009109_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	24.4	1.2e-08
WP_106471431.1|1009101_1010085_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106471432.1|1010081_1011002_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106471433.1|1011056_1012193_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106471434.1|1012243_1013731_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_106471435.1|1013741_1014188_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_106471436.1|1014218_1015835_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	32.2	9.2e-46
1014921:1014937	attL	CGCCTCCATCGCCGCCA	NA	NA	NA	NA
WP_106471437.1|1015838_1016285_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_106471438.1|1016322_1017474_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_106471439.1|1017556_1018360_-	enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_106471440.1|1018356_1018836_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106471441.1|1018832_1019591_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_106473965.1|1019779_1020916_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_106471442.1|1021038_1021308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471443.1|1021469_1022558_+|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	38.0	3.7e-30
WP_106471444.1|1022403_1023618_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.9	4.8e-39
WP_149615458.1|1024376_1024832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615459.1|1024753_1025161_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106471446.1|1025149_1026321_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	38.5	7.1e-48
1031265:1031281	attR	TGGCGGCGATGGAGGCG	NA	NA	NA	NA
>prophage 75
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1043574	1045200	3892138		Hepacivirus(100.0%)	1	NA	NA
WP_106471466.1|1043574_1045200_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	27.0	5.3e-41
>prophage 76
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1052470	1053109	3892138		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_106471473.1|1052470_1053109_-	SOS response-associated peptidase	NA	V9IQW7	Stenotrophomonas_phage	38.7	3.7e-22
>prophage 77
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1057590	1060440	3892138		Mycobacterium_phage(100.0%)	1	NA	NA
WP_106471482.1|1057590_1060440_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	44.9	2.0e-80
>prophage 78
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1067873	1080756	3892138	tRNA	Ochrobactrum_phage(14.29%)	16	NA	NA
WP_106471488.1|1067873_1068413_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	58.1	5.3e-22
WP_106471489.1|1068632_1068902_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_106471490.1|1069145_1070237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106471491.1|1070319_1070826_-	DUF1643 domain-containing protein	NA	A0A0U1W068	Pseudomonas_phage	43.9	3.9e-27
WP_106471492.1|1070822_1071731_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_106471493.1|1071858_1072491_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	37.1	1.3e-19
WP_106471494.1|1072581_1073688_+	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	30.5	2.8e-30
WP_106471495.1|1073894_1074344_+	YtoQ family protein	NA	NA	NA	NA	NA
WP_106471496.1|1074396_1074996_-	HD family hydrolase	NA	A0A0K1Y6I9	Rhodobacter_phage	45.3	5.1e-18
WP_106471497.1|1075211_1075520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471498.1|1075663_1077058_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.7	2.9e-40
WP_106471499.1|1077390_1077732_+	DUF2853 family protein	NA	NA	NA	NA	NA
WP_106471500.1|1078009_1078432_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_106471501.1|1078431_1078701_-	YciI family protein	NA	NA	NA	NA	NA
WP_106471502.1|1078702_1079662_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_106471503.1|1079658_1080756_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.7	2.4e-61
>prophage 79
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1106571	1118316	3892138		Klosneuvirus(20.0%)	9	NA	NA
WP_106471530.1|1106571_1107426_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	33.3	3.0e-35
WP_106471531.1|1107485_1109423_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_106471532.1|1109504_1111109_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	52.4	1.9e-19
WP_106471533.1|1111186_1111693_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_106471534.1|1111778_1112942_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_106471535.1|1113048_1114293_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	25.1	8.2e-18
WP_106471536.1|1114324_1115011_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_106471537.1|1115135_1116491_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	30.5	1.7e-24
WP_106471538.1|1116492_1118316_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.9	7.8e-102
>prophage 80
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1125561	1127382	3892138		Bacillus_virus(100.0%)	1	NA	NA
WP_106471546.1|1125561_1127382_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.1	7.3e-15
>prophage 81
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1140246	1141629	3892138		Mycoplasma_phage(100.0%)	1	NA	NA
WP_106471558.1|1140246_1141629_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	33.1	1.4e-31
>prophage 82
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1169549	1172797	3892138		Hepacivirus(50.0%)	2	NA	NA
WP_106471585.1|1169549_1171172_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	24.6	6.2e-34
WP_106471586.1|1171180_1172797_-	hypothetical protein	NA	A0A1V0S9M4	Catovirus	27.8	5.6e-51
>prophage 83
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1199083	1199842	3892138		Indivirus(100.0%)	1	NA	NA
WP_106473974.1|1199083_1199842_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	21.9	2.6e-06
>prophage 84
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1205503	1270586	3892138	head,transposase,protease,integrase	Agrobacterium_phage(13.33%)	59	1202454:1202470	1270763:1270779
1202454:1202470	attL	CACAGCAGCGCCCCGGC	NA	NA	NA	NA
WP_106473975.1|1205503_1206115_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	40.9	1.9e-28
WP_106473976.1|1206147_1207317_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	32.3	7.1e-40
WP_106471619.1|1208308_1208569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106471620.1|1208603_1210040_-	hypothetical protein	NA	J7FA77	Agrobacterium_phage	37.0	7.9e-49
WP_106471621.1|1210036_1210687_-	hypothetical protein	NA	A0A2I7QS52	Vibrio_phage	44.5	3.9e-19
WP_106471622.1|1210686_1211103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106471623.1|1211099_1211573_-|head,protease	HK97 family phage prohead protease	head,protease	J7FAG0	Agrobacterium_phage	47.9	5.8e-25
WP_106471624.1|1211569_1211815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149615464.1|1211801_1212029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106471626.1|1213546_1215169_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	26.0	1.2e-08
WP_106471627.1|1215367_1217164_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.8	9.3e-55
WP_106471629.1|1217421_1218846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106471630.1|1219070_1220534_-	amidohydrolase	NA	NA	NA	NA	NA
WP_106471631.1|1220922_1221579_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	45.2	3.0e-19
WP_149615465.1|1221575_1221899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106471633.1|1222041_1222188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471634.1|1223304_1224195_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106471635.1|1224316_1226398_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_149615466.1|1226478_1228254_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.4	3.1e-34
WP_106471637.1|1228102_1230004_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	42.5	2.3e-27
WP_106473977.1|1229988_1230825_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_106471638.1|1231788_1232832_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_106471639.1|1233383_1234367_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106471640.1|1234537_1235314_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_106471641.1|1235406_1236396_+	BMP family protein	NA	NA	NA	NA	NA
WP_106471642.1|1236459_1237986_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	1.6e-07
WP_106471643.1|1237988_1239098_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106471644.1|1239087_1240026_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106471646.1|1240827_1241238_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_106471647.1|1241768_1242023_+	addiction module antitoxin	NA	NA	NA	NA	NA
WP_106471648.1|1242027_1242345_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_106471649.1|1242689_1243076_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_106471446.1|1243272_1244443_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	38.5	7.1e-48
WP_106471650.1|1245085_1245985_-	EamA family transporter	NA	NA	NA	NA	NA
WP_106471651.1|1246068_1246551_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106471652.1|1248757_1252408_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_149615467.1|1252747_1253092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106471654.1|1253314_1253506_+	DUF4169 family protein	NA	NA	NA	NA	NA
WP_106471655.1|1253502_1253718_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106471656.1|1253763_1254912_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_106471657.1|1255029_1258473_+	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_106471658.1|1258825_1259065_-	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_106471659.1|1259232_1259820_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_106471660.1|1259874_1260513_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_149615468.1|1260517_1260940_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_106471662.1|1261043_1261430_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_106471663.1|1261563_1262286_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_106471664.1|1262288_1262738_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_106471665.1|1262857_1263619_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_106471666.1|1263630_1263945_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_106473978.1|1263955_1264426_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_106473979.1|1264629_1265046_-	YHS domain protein	NA	NA	NA	NA	NA
WP_106471667.1|1265232_1265565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106471668.1|1265661_1266432_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_106471669.1|1266716_1267763_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106471670.1|1267759_1267978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106471671.1|1267987_1268344_-	hypothetical protein	NA	A0A240F4W3	Ochrobactrum_phage	48.6	5.4e-23
WP_106471672.1|1268340_1269273_-	DUF5131 family protein	NA	Q8W6F1	Sinorhizobium_phage	48.0	2.2e-68
WP_106471673.1|1269269_1270586_-	ParB N-terminal domain-containing protein	NA	A0A0U2C144	Paracoccus_phage	39.6	3.4e-38
1270763:1270779	attR	CACAGCAGCGCCCCGGC	NA	NA	NA	NA
>prophage 85
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1274660	1304831	3892138	tail,plate,terminase,capsid,portal	Escherichia_phage(20.0%)	40	NA	NA
WP_106471685.1|1274660_1275287_+	helix-turn-helix domain-containing protein	NA	A0A068CE61	Rhizobium_phage	44.4	2.1e-14
WP_106471686.1|1275283_1275565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471687.1|1275940_1276495_+	hypothetical protein	NA	A0A1B0UYW1	Roseobacter_phage	48.2	1.8e-17
WP_106473980.1|1276885_1277158_+	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	85.6	1.7e-32
WP_106471688.1|1277161_1277551_+	DUF1064 domain-containing protein	NA	A0A1X9HVJ6	Ruegeria_phage	68.0	3.4e-39
WP_106471689.1|1277547_1278186_+	DNA methyltransferase	NA	F8TVB4	EBPR_siphovirus	54.7	5.6e-63
WP_106471690.1|1278175_1278616_+	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	40.7	8.4e-18
WP_106473981.1|1278648_1279365_+	glycoside hydrolase family 108 protein	NA	A0A1X9HX89	Ruegeria_phage	52.8	1.0e-57
WP_106471691.1|1279366_1279591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471692.1|1279590_1280016_+	hypothetical protein	NA	A0A1X9HVL7	Ruegeria_phage	51.1	4.6e-29
WP_106471693.1|1280138_1280678_+	DNA-packaging protein	NA	A0A193GYK5	Enterobacter_phage	46.6	3.1e-30
WP_106471694.1|1280674_1282645_+|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	60.2	3.2e-218
WP_149615472.1|1282647_1283178_+	hypothetical protein	NA	A0A1W6JT65	Escherichia_phage	41.4	9.8e-29
WP_106471696.1|1283177_1284767_+|portal	phage portal protein	portal	A0A193GYC1	Enterobacter_phage	51.7	1.8e-139
WP_106471697.1|1284771_1286763_+|capsid	phage major capsid protein	capsid	D5LH01	Escherichia_phage	52.9	1.1e-181
WP_106471698.1|1286823_1287036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471699.1|1287039_1287375_+	hypothetical protein	NA	R9TMM0	Vibrio_phage	32.0	3.6e-05
WP_149615473.1|1287361_1287895_+|tail	phage tail protein	tail	D5LGZ7	Escherichia_phage	43.4	6.6e-33
WP_106471701.1|1288289_1288817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471702.1|1288871_1289210_+|plate	phage baseplate protein	plate	V5YTB2	Pseudomonas_phage	60.4	2.1e-32
WP_106471703.1|1289206_1290109_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	52.5	9.0e-75
WP_106473982.1|1290110_1290671_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	33.7	3.6e-21
WP_106471704.1|1290670_1291627_+	DUF2793 domain-containing protein	NA	A0A0A1IV74	Pseudomonas_phage	52.3	2.9e-07
WP_106471705.1|1291636_1292251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471706.1|1292281_1292665_+	hypothetical protein	NA	A0A1B1INQ1	uncultured_Mediterranean_phage	37.2	6.4e-14
WP_106471707.1|1292667_1293156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471708.1|1293157_1294771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471709.1|1294773_1295094_+|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_149615474.1|1295120_1296488_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	29.4	4.9e-24
WP_106471711.1|1296640_1297828_+|tail	phage tail protein	tail	V5YTI0	Pseudomonas_phage	59.2	1.4e-144
WP_106471712.1|1297827_1298334_+|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	55.4	4.0e-48
WP_106471713.1|1298346_1298631_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	39.8	2.6e-12
WP_149615475.1|1298543_1298762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471714.1|1298751_1301070_+|tail	phage tail tape measure protein	tail	A0A088F717	Idiomarinaceae_phage	28.5	7.3e-20
WP_106471715.1|1301072_1301486_+|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	54.8	4.3e-32
WP_106471716.1|1301448_1301673_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	58.3	1.4e-08
WP_106471717.1|1301663_1302671_+	late control protein D	NA	A0A1B2LRT8	Wolbachia_phage	30.6	1.5e-30
WP_106471718.1|1302740_1303100_+	nuclease	NA	A0A127AWE6	Bacillus_phage	38.8	7.1e-07
WP_149615476.1|1303102_1303363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471720.1|1303697_1304831_-	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	31.9	4.1e-40
>prophage 86
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1316216	1317605	3892138		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_106471732.1|1316216_1317605_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.4	3.4e-41
>prophage 87
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1348663	1350403	3892138		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106471762.1|1348663_1350403_+	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.4	6.1e-11
>prophage 88
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1354809	1358094	3892138		Bacillus_phage(50.0%)	3	NA	NA
WP_106471767.1|1354809_1355814_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.4	2.4e-12
WP_106471768.1|1355810_1356584_+	L-iditol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_106471769.1|1356612_1358094_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.5	1.3e-43
>prophage 89
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1365125	1365923	3892138		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_106471775.1|1365125_1365923_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.9	1.3e-13
>prophage 90
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1381511	1382585	3892138	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_106471793.1|1381511_1382585_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	2.6e-28
>prophage 91
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1402443	1403675	3892138	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_106470855.1|1402443_1403675_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	57.3	2.3e-81
>prophage 92
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1408095	1410107	3892138		Planktothrix_phage(50.0%)	2	NA	NA
WP_106471813.1|1408095_1409115_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.0	2.7e-19
WP_106471814.1|1409111_1410107_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	4.0e-07
>prophage 93
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1419422	1423607	3892138		Planktothrix_phage(50.0%)	4	NA	NA
WP_106473992.1|1419422_1420181_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	6.7e-31
WP_106473993.1|1420215_1421316_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106473994.1|1421320_1422493_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_106471819.1|1422593_1423607_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.1	1.2e-62
>prophage 94
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1432998	1434609	3892138		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_106471829.1|1432998_1434609_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	6.2e-10
>prophage 95
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1439397	1441020	3892138	holin	Catovirus(100.0%)	1	NA	NA
WP_106473997.1|1439397_1441020_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.9	5.8e-56
>prophage 96
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1448119	1449631	3892138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106473998.1|1448119_1449631_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	5.3e-19
>prophage 97
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1460053	1460764	3892138		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_106471851.1|1460053_1460764_+	RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	31.0	1.2e-10
>prophage 98
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1468193	1472709	3892138		Cedratvirus(33.33%)	5	NA	NA
WP_106474000.1|1468193_1469219_+	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	26.4	4.4e-09
WP_106471859.1|1469215_1470214_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.1	1.0e-18
WP_106471861.1|1470213_1470867_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_106471862.1|1471561_1472239_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_106471863.1|1472235_1472709_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	40.8	1.2e-09
>prophage 99
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1475878	1477336	3892138		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_106474001.1|1475878_1477336_-	two-component sensor histidine kinase	NA	B5LWA6	Feldmannia_species_virus	30.0	9.3e-05
>prophage 100
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1485523	1485751	3892138		Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_106471874.1|1485523_1485751_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	65.3	4.3e-18
>prophage 101
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1498565	1503555	3892138	transposase	Rhizobium_phage(66.67%)	6	NA	NA
WP_106471885.1|1498565_1499036_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	43.0	1.1e-28
WP_106471886.1|1499051_1499999_+	hypothetical protein	NA	R9TP69	Rhizobium_phage	33.8	8.6e-36
WP_149615493.1|1499995_1500940_+	DUF2968 domain-containing protein	NA	NA	NA	NA	NA
WP_106471887.1|1501273_1501753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615494.1|1501767_1502304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471888.1|1502340_1503555_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.3	1.2e-37
>prophage 102
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1511363	1512992	3892138		Rhizobium_phage(100.0%)	1	NA	NA
WP_106474003.1|1511363_1512992_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	36.6	5.8e-80
>prophage 103
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1520220	1521659	3892138		Staphylococcus_phage(100.0%)	2	NA	NA
WP_106471902.1|1520220_1520949_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	7.9e-13
WP_106471903.1|1520948_1521659_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	7.2e-19
>prophage 104
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1528922	1536678	3892138		Thermoanaerobacterium_phage(16.67%)	7	NA	NA
WP_106471910.1|1528922_1529489_+	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	40.6	4.7e-05
WP_106471911.1|1529578_1530766_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	9.8e-29
WP_106474004.1|1530777_1531806_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	64.7	5.9e-14
WP_106471912.1|1531862_1532819_+	cysteine synthase family protein	NA	NA	NA	NA	NA
WP_106471913.1|1532825_1534115_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	52.9	9.4e-126
WP_106471914.1|1534179_1536012_-	response regulator	NA	A0A1V0SGX0	Hokovirus	33.2	8.0e-46
WP_106471915.1|1536084_1536678_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A1V0SEH9	Indivirus	27.1	3.0e-10
>prophage 105
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1541014	1544790	3892138		Halomonas_phage(50.0%)	3	NA	NA
WP_106471920.1|1541014_1541650_-	ParA family protein	NA	B0ZSI1	Halomonas_phage	34.4	4.9e-19
WP_106471921.1|1541780_1542479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106471922.1|1542501_1544790_-	hypothetical protein	NA	X2KUH8	Vibrio_phage	48.2	1.7e-05
>prophage 106
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1551393	1557330	3892138	transposase	Tupanvirus(33.33%)	7	NA	NA
WP_106471929.1|1551393_1553049_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.5	7.5e-43
WP_106471930.1|1553841_1554390_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_106471931.1|1554510_1554825_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_106471932.1|1555005_1555212_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	54.0	7.1e-12
WP_106471933.1|1555403_1555961_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_106471934.1|1555970_1556624_-	arylesterase	NA	NA	NA	NA	NA
WP_106471935.1|1556616_1557330_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.7	2.2e-31
>prophage 107
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1561058	1565583	3892138	tRNA	Escherichia_phage(50.0%)	4	NA	NA
WP_106471939.1|1561058_1562384_-|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	36.7	3.1e-15
WP_106471940.1|1562449_1562878_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_106471941.1|1562988_1563912_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_106471942.1|1563924_1565583_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	40.6	1.2e-101
>prophage 108
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1579229	1580932	3892138		Caulobacter_phage(50.0%)	2	NA	NA
WP_106471953.1|1579229_1579685_-	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	52.2	1.8e-31
WP_106471954.1|1579735_1580932_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.2	7.6e-37
>prophage 109
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1627094	1629284	3892138		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_106471992.1|1627094_1629284_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	26.8	1.5e-11
>prophage 110
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1639497	1641663	3892138		Ralstonia_phage(100.0%)	1	NA	NA
WP_106472001.1|1639497_1641663_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	9.5e-30
>prophage 111
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1646436	1649142	3892138		Enterobacteria_phage(100.0%)	1	NA	NA
WP_106472004.1|1646436_1649142_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.6e-82
>prophage 112
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1681229	1684470	3892138		Tetraselmis_virus(50.0%)	3	NA	NA
WP_106472037.1|1681229_1682753_-	2-polyprenylphenol 6-hydroxylase	NA	A0A2P0VMP1	Tetraselmis_virus	24.9	2.5e-16
WP_106472038.1|1682756_1683521_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_106472039.1|1683618_1684470_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	31.6	9.5e-26
>prophage 113
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1687920	1693251	3892138		Rhizobium_phage(50.0%)	4	NA	NA
WP_106472043.1|1687920_1689039_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	43.5	1.6e-68
WP_106472044.1|1689035_1690139_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_106472045.1|1690135_1690756_+	LysE family translocator	NA	NA	NA	NA	NA
WP_106472046.1|1690833_1693251_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.0	1.0e-109
>prophage 114
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1709426	1711004	3892138		Planktothrix_phage(100.0%)	1	NA	NA
WP_106472051.1|1709426_1711004_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	7.7e-21
>prophage 115
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1728690	1734405	3892138		Brazilian_cedratvirus(33.33%)	4	NA	NA
WP_106472064.1|1728690_1729509_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.4e-18
WP_106472065.1|1729605_1731576_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	21.2	1.1e-27
WP_106472066.1|1731799_1733707_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_106472067.1|1733703_1734405_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.4	1.5e-21
>prophage 116
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1740309	1744990	3892138		Tupanvirus(50.0%)	4	NA	NA
WP_106472072.1|1740309_1741365_+	saccharopine dehydrogenase	NA	A0A2K9L078	Tupanvirus	36.1	1.3e-61
WP_106472073.1|1741466_1741784_-	DUF3775 domain-containing protein	NA	NA	NA	NA	NA
WP_106472074.1|1741892_1743131_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_106472075.1|1743127_1744990_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.2	4.7e-110
>prophage 117
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1749850	1753966	3892138		Megavirus(50.0%)	4	NA	NA
WP_106472078.1|1749850_1751203_-	insulinase family protein	NA	A0A2P1EIE5	Megavirus	29.6	8.0e-19
WP_106472079.1|1751317_1751836_-	DUF3035 domain-containing protein	NA	NA	NA	NA	NA
WP_106472080.1|1751865_1752372_-	signal peptidase II	NA	NA	NA	NA	NA
WP_106472081.1|1752376_1753966_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.6	1.4e-70
>prophage 118
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1771005	1771863	3892138		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_106472099.1|1771005_1771863_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	34.2	2.6e-23
>prophage 119
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1777137	1778190	3892138		Planktothrix_phage(100.0%)	1	NA	NA
WP_106472106.1|1777137_1778190_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.5	2.1e-22
>prophage 120
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1783525	1784638	3892138		Catovirus(100.0%)	1	NA	NA
WP_106472111.1|1783525_1784638_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.0	3.3e-26
>prophage 121
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1799341	1807546	3892138		Planktothrix_phage(33.33%)	8	NA	NA
WP_106472124.1|1799341_1800121_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	1.5e-14
WP_106472125.1|1800189_1801041_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_106472126.1|1801172_1801523_+	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_106472127.1|1801651_1802887_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_106472128.1|1802920_1803730_-	poly(3-hydroxyalkanoate) depolymerase	NA	A0A1L7N183	Ralstonia_phage	50.4	6.8e-66
WP_106472129.1|1803733_1805401_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_106472130.1|1805422_1805890_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_106472131.1|1805911_1807546_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.0	4.5e-32
>prophage 122
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1816817	1817282	3892138		Synechococcus_phage(100.0%)	1	NA	NA
WP_106472141.1|1816817_1817282_-	Hsp20 family protein	NA	E3SKK3	Synechococcus_phage	36.2	5.2e-18
>prophage 123
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1832852	1833539	3892138		Bradyrhizobium_phage(100.0%)	1	NA	NA
WP_106472158.1|1832852_1833539_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	51.1	8.4e-57
>prophage 124
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1841595	1843311	3892138		Natrialba_phage(50.0%)	2	NA	NA
WP_106472164.1|1841595_1842405_+	ParA family protein	NA	Q8JL10	Natrialba_phage	30.7	5.1e-21
WP_106472165.1|1842426_1843311_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.3	2.7e-15
>prophage 125
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1847607	1850256	3892138		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_106472171.1|1847607_1850256_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.2	3.5e-18
>prophage 126
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1856467	1864237	3892138	tRNA	Feldmannia_species_virus(25.0%)	7	NA	NA
WP_106472177.1|1856467_1857763_+	fused response regulator/phosphatase	NA	B5LWA6	Feldmannia_species_virus	27.0	5.7e-06
WP_106472178.1|1857767_1858229_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_106472179.1|1858304_1859246_+	molecular chaperone Hsp33	NA	NA	NA	NA	NA
WP_106472180.1|1859238_1859835_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_106472181.1|1859831_1860983_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	43.5	2.6e-50
WP_106472182.1|1861154_1863002_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	6.2e-30
WP_106472183.1|1862998_1864237_+	class I SAM-dependent RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	36.8	1.6e-10
>prophage 127
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1870076	1870337	3892138		Rhizobium_phage(100.0%)	1	NA	NA
WP_106472191.1|1870076_1870337_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	46.1	3.1e-12
>prophage 128
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1877216	1879715	3892138		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_106472200.1|1877216_1879715_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.4	5.6e-18
>prophage 129
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1887383	1890835	3892138		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_106472205.1|1887383_1887998_+	ribonuclease D	NA	K7XYU9	uncultured_Mediterranean_phage	32.8	1.3e-11
WP_106472206.1|1887994_1888954_+	KpsF/GutQ family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_106472207.1|1888963_1889563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106472208.1|1889567_1890077_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_106472209.1|1890076_1890835_+	LPS export ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.0	2.7e-16
>prophage 130
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1897581	1899455	3892138		Tupanvirus(50.0%)	2	NA	NA
WP_106472215.1|1897581_1898565_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	33.2	7.3e-46
WP_106472216.1|1898561_1899455_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.4	2.4e-64
>prophage 131
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1903954	1907908	3892138		Chrysanthemum_virus(33.33%)	3	NA	NA
WP_106472222.1|1903954_1904557_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2P1JHW7	Chrysanthemum_virus	28.8	2.9e-05
WP_106472223.1|1904774_1906682_+	molecular chaperone DnaK	NA	A0A2P1ELQ7	Moumouvirus	50.3	7.6e-156
WP_106472224.1|1906756_1907908_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	31.2	2.0e-18
>prophage 132
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1911276	1912116	3892138		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106472229.1|1911276_1912116_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	24.7	5.3e-05
>prophage 133
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1916648	1920980	3892138		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_106472235.1|1916648_1918238_-	5-guanidino-2-oxopentanoate decarboxylase	NA	E5EQ70	Micromonas_sp._RCC1109_virus	25.0	8.5e-20
WP_106472236.1|1918234_1919422_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_106472237.1|1919418_1920060_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106474031.1|1920275_1920980_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.4	2.3e-09
>prophage 134
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1925615	1928724	3892138	integrase	Bacillus_phage(50.0%)	4	1917226:1917242	1933068:1933084
1917226:1917242	attL	GCGCGATCCGCGCGGGC	NA	NA	NA	NA
WP_106472244.1|1925615_1926374_-	HNH endonuclease	NA	A0A0A0RV62	Bacillus_phage	43.7	3.8e-10
WP_106472245.1|1926515_1926734_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_149615505.1|1927009_1927519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106472247.1|1927515_1928724_-|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	25.5	2.6e-16
1933068:1933084	attR	GCGCGATCCGCGCGGGC	NA	NA	NA	NA
>prophage 135
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1939147	1940428	3892138		Mamastrovirus(100.0%)	1	NA	NA
WP_106472258.1|1939147_1940428_-	5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH	NA	A9ZMK9	Mamastrovirus	34.5	2.2e-18
>prophage 136
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1946441	1946567	3892138	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_106474033.1|1946441_1946567_+|transposase	transposase	transposase	S5WIN0	Leptospira_phage	56.1	4.9e-08
>prophage 137
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1952580	1953537	3892138		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_106472268.1|1952580_1953537_-	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	28.5	1.4e-25
>prophage 138
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1959740	1961504	3892138		Planktothrix_phage(100.0%)	1	NA	NA
WP_106472275.1|1959740_1961504_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.2e-22
>prophage 139
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1966240	1970151	3892138	transposase	Bacillus_virus(50.0%)	4	NA	NA
WP_106472278.1|1966240_1966990_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.5	3.5e-24
WP_106474035.1|1966986_1967814_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_106472279.1|1967859_1968849_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106472280.1|1969530_1970151_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.8	1.5e-36
>prophage 140
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1976533	1978431	3892138		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_106472286.1|1976533_1977475_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	6.9e-09
WP_106472287.1|1977471_1978431_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.1	2.0e-16
>prophage 141
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	1982422	1989747	3892138		Hepacivirus(25.0%)	6	NA	NA
WP_106472291.1|1982422_1983970_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	25.9	4.0e-38
WP_106474036.1|1983969_1985124_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_106472292.1|1985179_1986343_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106472293.1|1986386_1988228_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	27.5	1.5e-63
WP_106472294.1|1988218_1988980_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	8.8e-15
WP_106472295.1|1988976_1989747_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.6	1.9e-12
>prophage 142
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2001749	2003450	3892138		Bacillus_virus(100.0%)	1	NA	NA
WP_106472306.1|2001749_2003450_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.2	4.1e-28
>prophage 143
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2013342	2014380	3892138		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_106474039.1|2013342_2014380_+	phosphate ABC transporter substrate-binding protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	49.8	1.9e-89
>prophage 144
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2018696	2025237	3892138	protease	Bacillus_phage(33.33%)	7	NA	NA
WP_106472315.1|2018696_2019386_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	37.2	2.5e-40
WP_106472316.1|2019396_2020290_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_106472317.1|2020326_2021133_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_106472318.1|2021168_2022149_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_106472319.1|2022160_2022505_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	39.6	1.2e-11
WP_106472320.1|2022600_2023296_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_106472321.1|2023551_2025237_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	36.0	7.4e-30
>prophage 145
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2029367	2035067	3892138	integrase	Sinorhizobium_phage(50.0%)	5	2029347:2029365	2045111:2045129
2029347:2029365	attL	TCCTGCACGGCTCACCACT	NA	NA	NA	NA
WP_106472325.1|2029367_2030486_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	35.6	1.2e-44
WP_106472326.1|2030672_2030912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106472327.1|2031050_2031473_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_149615510.1|2031448_2031808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106472329.1|2031863_2035067_+	site-specific DNA-methyltransferase	NA	G8I4P9	Mycobacterium_phage	25.3	1.8e-21
2045111:2045129	attR	TCCTGCACGGCTCACCACT	NA	NA	NA	NA
>prophage 146
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2048107	2054343	3892138		Tupanvirus(50.0%)	3	NA	NA
WP_106472336.1|2048107_2048869_-	hypothetical protein	NA	A0A2K9L4V2	Tupanvirus	34.8	1.4e-12
WP_106472337.1|2049466_2050933_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_106472338.1|2050929_2054343_+	DNA polymerase III subunit alpha	NA	A0A096XUX6	Cronobacter_phage	31.8	4.8e-60
>prophage 147
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2060257	2066023	3892138		Pelagibacter_phage(33.33%)	6	NA	NA
WP_007818122.1|2060257_2060464_+	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	63.2	1.3e-05
WP_106472346.1|2060686_2061541_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_106472347.1|2061584_2063171_-	NAD(P)-binding protein	NA	A0A1V0S9M4	Catovirus	28.4	8.5e-44
WP_106472348.1|2063237_2063696_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106472349.1|2063835_2064954_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_106472350.1|2065000_2066023_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	43.8	1.1e-15
>prophage 148
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2074338	2074662	3892138		Roseobacter_phage(100.0%)	1	NA	NA
WP_106472358.1|2074338_2074662_-	hypothetical protein	NA	F4YXP2	Roseobacter_phage	55.0	4.4e-16
>prophage 149
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2087883	2091290	3892138		Tupanvirus(50.0%)	2	NA	NA
WP_106472374.1|2087883_2090007_+	elongation factor G	NA	A0A2K9L6L3	Tupanvirus	23.3	5.5e-38
WP_106472375.1|2090114_2091290_+	elongation factor Tu	NA	A0A146JG10	Tokyovirus	29.1	1.3e-17
>prophage 150
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2106314	2112429	3892138		Tupanvirus(33.33%)	7	NA	NA
WP_106472400.1|2106314_2106974_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	34.5	1.4e-05
WP_106472401.1|2107159_2107528_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_106472402.1|2107540_2107933_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_106474045.1|2108048_2109065_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_106472403.1|2109184_2109604_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_106472404.1|2109730_2111113_+	PDZ domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	32.6	3.3e-12
WP_106472405.1|2111118_2112429_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	7.2e-73
>prophage 151
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2115500	2123592	3892138		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_106472410.1|2115500_2116520_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	44.0	1.3e-74
WP_106472411.1|2116646_2117915_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_106472412.1|2117916_2119224_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106472413.1|2119236_2120028_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	2.4e-31
WP_106472414.1|2120141_2120639_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_106472415.1|2120623_2121319_-	ferredoxin	NA	NA	NA	NA	NA
WP_106472416.1|2121331_2122066_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_106472417.1|2122062_2123592_-	AAA family ATPase	NA	B2ZYA4	Ralstonia_phage	24.6	5.0e-09
>prophage 152
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2144380	2152848	3892138		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_106474047.1|2144380_2148517_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.9	5.8e-28
WP_106472438.1|2148609_2152848_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	5.5e-66
>prophage 153
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2166764	2168570	3892138		Mycoplasma_phage(100.0%)	1	NA	NA
WP_106472447.1|2166764_2168570_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	28.4	5.9e-09
>prophage 154
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2176527	2177754	3892138		Oenococcus_phage(100.0%)	1	NA	NA
WP_106472453.1|2176527_2177754_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	33.2	5.5e-43
>prophage 155
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2196679	2197861	3892138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106472470.1|2196679_2197861_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	49.1	1.0e-94
>prophage 156
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2231862	2238852	3892138		Vibrio_phage(25.0%)	6	NA	NA
WP_106472505.1|2231862_2233503_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.3	4.0e-20
WP_106472506.1|2233599_2234832_+	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	24.3	1.2e-24
WP_106472507.1|2234922_2236134_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	31.3	1.3e-41
WP_106472508.1|2236154_2236595_+	TrgA family protein	NA	NA	NA	NA	NA
WP_106472509.1|2236623_2237751_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_106472510.1|2237817_2238852_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	37.0	9.4e-44
>prophage 157
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2242971	2244297	3892138		Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_106472514.1|2242971_2244297_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	50.7	1.8e-116
>prophage 158
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2247956	2254465	3892138	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_106471446.1|2247956_2249127_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	38.5	7.1e-48
WP_149615516.1|2250280_2250934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106472519.1|2250955_2254465_-	DUF3883 domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	29.6	3.1e-54
>prophage 159
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2263877	2268061	3892138		Mycoplasma_phage(50.0%)	4	NA	NA
WP_106472526.1|2263877_2264912_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	48.4	4.3e-20
WP_106472527.1|2265229_2266486_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_106472528.1|2266478_2267195_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106472529.1|2267212_2268061_+	transketolase	NA	A0A0P0YMZ3	Yellowstone_lake_phycodnavirus	31.7	9.2e-13
>prophage 160
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2277570	2282564	3892138	transposase	Burkholderia_virus(50.0%)	4	NA	NA
WP_106472537.1|2277570_2278801_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	57.3	1.0e-81
WP_106474059.1|2279019_2279964_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_106472538.1|2279891_2280908_+	transporter	NA	NA	NA	NA	NA
WP_106472539.1|2280971_2282564_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	47.3	1.5e-133
>prophage 161
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2290945	2291665	3892138		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_106472546.1|2290945_2291665_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.1	1.2e-16
>prophage 162
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2296998	2299224	3892138		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_106472551.1|2296998_2299224_+	response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	30.7	3.0e-10
>prophage 163
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2313506	2316233	3892138		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_106472561.1|2313506_2316233_+	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	2.7e-13
>prophage 164
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2340013	2344088	3892138		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_149615560.1|2340013_2341006_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.1e-09
WP_106472579.1|2341055_2342531_+	leucyl aminopeptidase	NA	NA	NA	NA	NA
WP_106474066.1|2342672_2343155_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106472580.1|2343335_2344088_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	1.5e-11
>prophage 165
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2348675	2349698	3892138		Bacillus_virus(100.0%)	1	NA	NA
WP_106472585.1|2348675_2349698_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.6	4.1e-15
>prophage 166
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2360330	2362288	3892138		Bacillus_virus(50.0%)	2	NA	NA
WP_106472595.1|2360330_2361311_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	9.6e-14
WP_106472596.1|2361307_2362288_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.7	3.8e-10
>prophage 167
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2368332	2369073	3892138		Mollivirus(100.0%)	1	NA	NA
WP_106472598.1|2368332_2369073_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	34.7	3.2e-09
>prophage 168
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2375627	2380163	3892138		Pandoravirus(50.0%)	4	NA	NA
WP_106472606.1|2375627_2376731_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	41.6	4.5e-68
WP_106474071.1|2376962_2377940_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_106472607.1|2377915_2379472_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_106472608.1|2379458_2380163_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.0	7.9e-18
>prophage 169
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2384057	2386250	3892138		uncultured_virus(100.0%)	1	NA	NA
WP_106472612.1|2384057_2386250_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	27.6	5.6e-54
>prophage 170
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2397263	2399810	3892138	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_106472623.1|2397263_2399810_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	36.6	2.2e-155
>prophage 171
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2403172	2404273	3892138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106472626.1|2403172_2404273_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.6	1.4e-34
>prophage 172
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2409260	2410793	3892138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106472632.1|2409260_2410793_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	7.7e-18
>prophage 173
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2416931	2417846	3892138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106472640.1|2416931_2417846_+	co-chaperone YbbN	NA	A0A1X9I9P5	Staphylococcus_phage	34.6	1.2e-10
>prophage 174
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2425643	2426510	3892138	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_106472648.1|2425643_2426510_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	54.6	1.5e-74
>prophage 175
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2433159	2435760	3892138		Pithovirus(50.0%)	3	NA	NA
WP_106472653.1|2433159_2434101_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.2	5.2e-17
WP_106472654.1|2434097_2434859_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106472655.1|2434962_2435760_+	S49 family peptidase	NA	A0A2I7QTH6	Vibrio_phage	29.9	2.1e-11
>prophage 176
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2457756	2459738	3892138		Bacillus_virus(100.0%)	2	NA	NA
WP_106472677.1|2457756_2458722_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.1	3.4e-11
WP_106472678.1|2458718_2459738_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.6	1.5e-14
>prophage 177
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2466654	2467428	3892138		Bacillus_phage(100.0%)	1	NA	NA
WP_106474085.1|2466654_2467428_+	uracil-DNA glycosylase	NA	A0A127AW33	Bacillus_phage	31.2	2.7e-11
>prophage 178
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2474144	2480546	3892138		Ralstonia_phage(33.33%)	7	NA	NA
WP_106472689.1|2474144_2474588_-	NUDIX hydrolase	NA	A0A1L7N1W6	Ralstonia_phage	34.5	1.4e-07
WP_106472690.1|2474584_2475406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106474086.1|2475561_2476116_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_106474087.1|2476198_2477158_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	38.2	9.3e-38
WP_106472691.1|2477301_2479020_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_106474088.1|2479140_2480079_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_106472692.1|2480081_2480546_+	hypothetical protein	NA	A0A1L5C299	Pseudoalteromonas_phage	37.1	1.5e-09
>prophage 179
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2491070	2491532	3892138		Salmonella_phage(100.0%)	1	NA	NA
WP_106472705.1|2491070_2491532_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.5	3.8e-37
>prophage 180
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2496048	2498220	3892138		Bordetella_phage(100.0%)	1	NA	NA
WP_106472713.1|2496048_2498220_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	36.7	7.6e-11
>prophage 181
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2501735	2503774	3892138		Dishui_lake_phycodnavirus(50.0%)	2	NA	NA
WP_106472719.1|2501735_2502434_+	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	35.0	3.6e-15
WP_106474091.1|2502457_2503774_-	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	31.7	1.3e-29
>prophage 182
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2511659	2515790	3892138		Staphylococcus_phage(50.0%)	3	NA	NA
WP_106472726.1|2511659_2513258_-	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	48.8	7.8e-138
WP_106472727.1|2513480_2514176_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_106472728.1|2514191_2515790_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	25.9	1.6e-10
>prophage 183
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2525511	2529834	3892138		Bacillus_virus(50.0%)	3	NA	NA
WP_106472739.1|2525511_2527863_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	40.0	1.3e-88
WP_106472740.1|2527930_2528518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106472375.1|2528658_2529834_+	elongation factor Tu	NA	A0A146JG10	Tokyovirus	29.1	1.3e-17
>prophage 184
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2536664	2537468	3892138		Bacillus_virus(100.0%)	1	NA	NA
WP_106472747.1|2536664_2537468_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	9.9e-25
>prophage 185
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2542485	2548549	3892138		Bacillus_phage(66.67%)	4	NA	NA
WP_106472752.1|2542485_2545116_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.1	3.0e-09
WP_106472753.1|2545112_2546258_+	response regulator	NA	NA	NA	NA	NA
WP_106472754.1|2546219_2546978_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.8	5.9e-27
WP_106474098.1|2547322_2548549_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	56.2	2.6e-125
>prophage 186
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2556013	2556955	3892138		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_106472761.1|2556013_2556955_-	D-glycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.2	2.6e-16
>prophage 187
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2581761	2583757	3892138		uncultured_virus(100.0%)	2	NA	NA
WP_106472779.1|2581761_2582049_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	54.9	1.1e-18
WP_106472780.1|2582110_2583757_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.6	3.1e-174
>prophage 188
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2588412	2594869	3892138		Tetraselmis_virus(20.0%)	8	NA	NA
WP_106472786.1|2588412_2588901_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.1	8.4e-19
WP_106472787.1|2588982_2589207_-	YdcH family protein	NA	NA	NA	NA	NA
WP_106474102.1|2589372_2589786_+	Hsp20 family protein	NA	H8ZNE8	Synechococcus_phage	39.8	3.9e-17
WP_106472788.1|2589789_2590014_+	DUF1150 family protein	NA	NA	NA	NA	NA
WP_106472789.1|2590010_2590892_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_106472790.1|2590884_2591748_+	hypothetical protein	NA	A0A1V0SAK9	Catovirus	26.8	1.2e-12
WP_106472791.1|2592056_2593769_-	bifunctional sulfate adenylyltransferase/adenylylsulfate kinase	NA	A0A2K9L0F0	Tupanvirus	42.1	4.6e-120
WP_106472792.1|2593924_2594869_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.4	8.8e-65
>prophage 189
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2600310	2600715	3892138		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_106472798.1|2600310_2600715_-	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	40.6	1.4e-14
>prophage 190
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2610317	2610551	3892138		Vibrio_phage(100.0%)	1	NA	NA
WP_106472808.1|2610317_2610551_+	acyl carrier protein	NA	A0A2I7RIC8	Vibrio_phage	41.8	1.5e-05
>prophage 191
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2615225	2634006	3892138	head,tail,protease,capsid,portal	Paracoccus_phage(25.0%)	22	NA	NA
WP_106472814.1|2615225_2616452_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	41.8	6.7e-73
WP_106472815.1|2616587_2617775_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	36.9	1.0e-57
WP_106472816.1|2617767_2618004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106472817.1|2618038_2618596_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	48.3	2.4e-33
WP_106472818.1|2618641_2619820_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	39.0	6.7e-70
WP_106472819.1|2619992_2620592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106472820.1|2620588_2620927_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_106472821.1|2620923_2621337_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_106472822.1|2621360_2621774_+|tail	phage major tail protein, TP901-1 family	tail	A0A1J0GVL1	Pseudoalteromonas_phage	31.9	4.5e-05
WP_106472823.1|2621777_2622098_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_106472824.1|2622094_2622298_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_106472825.1|2622290_2622953_+|tail	phage tail tape measure protein	tail	A0A1B2AQ26	Escherichia_phage	32.1	9.7e-10
WP_106472826.1|2622974_2623607_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	49.8	8.5e-56
WP_106472827.1|2623606_2624494_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	41.0	5.8e-58
WP_106472828.1|2624490_2624940_+	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	45.0	1.3e-26
WP_106472829.1|2624939_2628869_+	host specificity protein	NA	A0A0B5A7K5	Paracoccus_phage	38.3	9.3e-217
WP_106472830.1|2628868_2629165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106472831.1|2629227_2629749_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_106472832.1|2629833_2631441_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	28.4	1.3e-31
WP_106474103.1|2631368_2632385_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_106472833.1|2632478_2633375_+	DMT family transporter	NA	NA	NA	NA	NA
WP_106472834.1|2633457_2634006_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	52.7	4.5e-45
>prophage 192
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2647870	2651413	3892138		Mycoplasma_phage(50.0%)	4	NA	NA
WP_106472847.1|2647870_2648941_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	43.6	7.8e-17
WP_106472848.1|2648937_2649792_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106472849.1|2649791_2650604_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106472850.1|2650642_2651413_+	3-oxoacyl-ACP reductase FabG	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.3	1.7e-10
>prophage 193
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2664774	2666121	3892138		Bacillus_phage(100.0%)	1	NA	NA
WP_106472869.1|2664774_2666121_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.3	9.3e-84
>prophage 194
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2669206	2670331	3892138		Mycoplasma_phage(100.0%)	1	NA	NA
WP_106472873.1|2669206_2670331_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.6	9.3e-21
>prophage 195
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2675169	2676270	3892138		Mycoplasma_phage(100.0%)	1	NA	NA
WP_106472877.1|2675169_2676270_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	29.0	4.1e-21
>prophage 196
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2682608	2684870	3892138		Lactococcus_phage(100.0%)	1	NA	NA
WP_106472884.1|2682608_2684870_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	30.5	3.2e-52
>prophage 197
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2689650	2690493	3892138		Synechococcus_phage(100.0%)	1	NA	NA
WP_106472890.1|2689650_2690493_+	LOG family protein	NA	A0A1D8KU27	Synechococcus_phage	34.0	2.7e-12
>prophage 198
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2703309	2708889	3892138		Cedratvirus(33.33%)	4	NA	NA
WP_106472902.1|2703309_2704905_+	phosphoglycerate dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	39.3	7.0e-46
WP_106472903.1|2705099_2705828_+	serine/threonine protein phosphatase	NA	A0A1V0EF12	Caulobacter_phage	35.5	3.1e-25
WP_106472904.1|2705831_2707283_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_106472905.1|2707275_2708889_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	1.2e-21
>prophage 199
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2739498	2740404	3892138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106472926.1|2739498_2740404_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	2.9e-20
>prophage 200
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2758302	2759112	3892138		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_106472945.1|2758302_2759112_+	CbbQ/NirQ/NorQ/GpvN family protein	NA	A0A2H4N7N3	Lake_Baikal_phage	28.8	2.1e-14
>prophage 201
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2773398	2774463	3892138		Planktothrix_phage(100.0%)	1	NA	NA
WP_106472956.1|2773398_2774463_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.5	1.6e-25
>prophage 202
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2787969	2790237	3892138		Escherichia_phage(100.0%)	1	NA	NA
WP_106472967.1|2787969_2790237_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	30.6	2.7e-59
>prophage 203
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2793518	2795327	3892138		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_106472972.1|2793518_2795327_-	hypothetical protein	NA	A0A2D2W2Q1	Stenotrophomonas_phage	32.7	3.7e-11
>prophage 204
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2810553	2813294	3892138		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_106472983.1|2810553_2812014_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	32.1	1.9e-50
WP_106472984.1|2812243_2812795_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.2	9.1e-38
WP_106472985.1|2812787_2813294_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.4	3.3e-42
>prophage 205
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2830765	2832202	3892138		environmental_Halophage(100.0%)	1	NA	NA
WP_106473001.1|2830765_2832202_+	purine permease	NA	H9YQ34	environmental_Halophage	35.3	1.7e-06
>prophage 206
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2836305	2840048	3892138		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_106473004.1|2836305_2838051_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	7.6e-46
WP_106473005.1|2838545_2840048_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.0	8.3e-25
>prophage 207
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2859914	2863392	3892138		Planktothrix_phage(50.0%)	3	NA	NA
WP_106473021.1|2859914_2860691_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	8.4e-21
WP_106473022.1|2860692_2861754_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_106473023.1|2861838_2863392_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.0	3.9e-25
>prophage 208
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2872449	2883248	3892138		Stenotrophomonas_phage(20.0%)	8	NA	NA
WP_106473031.1|2872449_2875044_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	31.0	2.3e-38
WP_106474121.1|2875223_2875919_+	cell wall hydrolase	NA	A0A1B0UXM4	Roseobacter_phage	45.5	6.8e-22
WP_106473032.1|2876076_2877015_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_106473033.1|2877011_2878028_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.5	9.0e-23
WP_106473034.1|2878020_2879367_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_106473035.1|2879370_2880759_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_106473036.1|2880896_2882393_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-25
WP_106473037.1|2882414_2883248_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.1	1.3e-48
>prophage 209
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2890791	2898072	3892138		Klosneuvirus(20.0%)	5	NA	NA
WP_106473044.1|2890791_2891967_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.4	6.8e-14
WP_106473045.1|2892047_2892974_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	27.3	1.6e-18
WP_106473046.1|2893020_2894520_-	inorganic phosphate transporter	NA	V5LQA0	Emiliania_huxleyi_virus	30.1	1.6e-15
WP_106473047.1|2894849_2895599_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	35.5	3.9e-07
WP_106474124.1|2895603_2898072_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.0	2.2e-30
>prophage 210
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2903075	2915084	3892138		Bacillus_phage(25.0%)	11	NA	NA
WP_106474125.1|2903075_2903777_-	NAD-dependent deacylase	NA	S5M4R0	Bacillus_phage	30.5	2.3e-17
WP_106474126.1|2903880_2904333_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_106473053.1|2904329_2905295_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106473054.1|2905382_2905691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473055.1|2906064_2907864_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	1.6e-22
WP_106473056.1|2907939_2908698_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_106473057.1|2908775_2909144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106473058.1|2909229_2910525_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.2	1.0e-100
WP_106473059.1|2910703_2911465_+	NAD kinase	NA	NA	NA	NA	NA
WP_106473060.1|2911703_2913134_-	amidase	NA	NA	NA	NA	NA
WP_106473061.1|2913194_2915084_-	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	31.9	1.7e-59
>prophage 211
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2918159	2919479	3892138		Geobacillus_virus(100.0%)	1	NA	NA
WP_106473064.1|2918159_2919479_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	38.9	2.0e-62
>prophage 212
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2923310	2924936	3892138		Catovirus(100.0%)	1	NA	NA
WP_106473069.1|2923310_2924936_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	20.3	3.0e-12
>prophage 213
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2943782	2950485	3892138	protease	Bacillus_phage(33.33%)	5	NA	NA
WP_106473083.1|2943782_2947193_+	double-strand break repair helicase AddA	NA	U5PSZ2	Bacillus_phage	50.9	2.6e-05
WP_106473084.1|2947230_2947551_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	50.0	3.2e-19
WP_106473085.1|2947604_2948525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473086.1|2948623_2949181_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_106473087.1|2949177_2950485_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	27.8	6.1e-40
>prophage 214
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2960837	2962312	3892138	transposase	Burkholderia_virus(50.0%)	2	NA	NA
WP_106473101.1|2960837_2961401_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.7	3.3e-51
WP_106473102.1|2961370_2962312_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	20.4	9.6e-11
>prophage 215
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2982484	2983459	3892138		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_106473119.1|2982484_2983459_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	1.3e-07
>prophage 216
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	2992813	2994522	3892138		Bacillus_phage(50.0%)	2	NA	NA
WP_106473130.1|2992813_2993515_+	response regulator	NA	W8CYM9	Bacillus_phage	37.9	8.3e-36
WP_106473131.1|2993595_2994522_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.0	1.4e-43
>prophage 217
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3011369	3013404	3892138		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_106473147.1|3011369_3012341_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.2	8.7e-84
WP_106473148.1|3012330_3013404_-	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	61.5	3.3e-124
>prophage 218
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3033155	3037197	3892138		Staphylococcus_phage(50.0%)	4	NA	NA
WP_106473165.1|3033155_3033632_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.1	1.5e-28
WP_106473166.1|3033713_3034571_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_106473167.1|3034570_3035755_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_106473168.1|3035865_3037197_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	37.1	2.0e-54
>prophage 219
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3041744	3048086	3892138		Bacillus_phage(33.33%)	7	NA	NA
WP_106473173.1|3041744_3043469_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	26.7	1.6e-27
WP_106473174.1|3043465_3044767_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_106473175.1|3044838_3045300_+	RidA family protein	NA	M1IDR7	Acanthocystis_turfacea_Chlorella_virus	39.7	1.4e-26
WP_106473176.1|3045296_3046070_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_106473177.1|3046100_3047288_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_106473178.1|3047284_3047581_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_106473179.1|3047597_3048086_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	40.8	1.4e-18
>prophage 220
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3064427	3069935	3892138		Microbacterium_phage(50.0%)	5	NA	NA
WP_106473198.1|3064427_3066587_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.5	9.2e-142
WP_106473199.1|3066701_3067319_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_106473200.1|3067315_3068305_-	adenosine kinase	NA	NA	NA	NA	NA
WP_106473201.1|3068301_3068946_-	endonuclease III	NA	NA	NA	NA	NA
WP_106474135.1|3069083_3069935_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.6	4.7e-17
>prophage 221
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3075141	3079844	3892138		Pseudomonas_phage(50.0%)	4	NA	NA
WP_106473209.1|3075141_3077124_-	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	43.3	5.1e-22
WP_106473210.1|3077244_3078117_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_106473211.1|3078222_3079095_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_106473212.1|3079094_3079844_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.1	1.3e-26
>prophage 222
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3092513	3096744	3892138		Bacillus_virus(50.0%)	4	NA	NA
WP_106473223.1|3092513_3093290_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	43.6	3.0e-34
WP_106473224.1|3093286_3094555_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_106473225.1|3094753_3095551_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106473226.1|3095658_3096744_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	40.0	3.3e-23
>prophage 223
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3108974	3109937	3892138		Bacillus_virus(100.0%)	1	NA	NA
WP_106473235.1|3108974_3109937_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	1.6e-16
>prophage 224
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3130612	3131242	3892138		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_106473255.1|3130612_3131242_-	queuosine precursor transporter	NA	A0A1B1IR19	uncultured_Mediterranean_phage	35.0	1.8e-05
>prophage 225
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3135002	3140663	3892138		Diadromus_pulchellus_ascovirus(50.0%)	4	NA	NA
WP_106473260.1|3135002_3137045_+	DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	40.7	9.2e-75
WP_106473261.1|3137073_3137868_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_106473262.1|3137786_3138296_-	VOC family protein	NA	NA	NA	NA	NA
WP_106473263.1|3138323_3140663_-	response regulator	NA	A0A1V0SGX0	Hokovirus	33.3	2.2e-48
>prophage 226
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3166658	3167420	3892138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106473284.1|3166658_3167420_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.5e-19
>prophage 227
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3180046	3182896	3892138		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_106473294.1|3180046_3182896_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	50.7	5.6e-264
>prophage 228
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3190376	3197130	3892138	tRNA,holin	Klosneuvirus(25.0%)	6	NA	NA
WP_106473301.1|3190376_3193325_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	30.1	3.8e-21
WP_106473302.1|3193375_3193831_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.3	4.9e-13
WP_106473303.1|3193964_3194663_-|holin	phosphatidylcholine synthase	holin	NA	NA	NA	NA
WP_106473304.1|3194702_3195632_-	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	29.2	5.7e-16
WP_106473305.1|3195628_3196327_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_106473306.1|3196476_3197130_-	fructose-6-phosphate aldolase	NA	A0A127KMN5	Cyanophage	48.1	1.0e-48
>prophage 229
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3212722	3213709	3892138		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_106473320.1|3212722_3213709_+	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	26.8	1.7e-18
>prophage 230
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3219776	3220904	3892138		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_106474143.1|3219776_3220904_+	alanine--glyoxylate aminotransferase family protein	NA	A0A0N9QIZ2	Chrysochromulina_ericina_virus	40.4	2.3e-72
>prophage 231
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3225657	3230828	3892138		Halovirus(33.33%)	6	NA	NA
WP_106473330.1|3225657_3226833_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	1.9e-40
WP_106473331.1|3227018_3227498_+	GatB/YqeY domain-containing protein	NA	A0A2I7SAL1	Vibrio_phage	30.0	6.1e-06
WP_106473332.1|3227537_3228344_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_106473333.1|3228340_3229225_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_106473334.1|3229277_3229997_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_106474144.1|3230033_3230828_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.1	1.5e-28
>prophage 232
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3242796	3243408	3892138		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_106473342.1|3242796_3243408_+	N-acetylmuramidase	NA	G8DH66	Emiliania_huxleyi_virus	58.8	6.1e-59
>prophage 233
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3250709	3260778	3892138		Acinetobacter_phage(50.0%)	5	NA	NA
WP_106473350.1|3250709_3252227_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	3.1e-19
WP_106473351.1|3252223_3253174_-	xanthine dehydrogenase accessory protein XdhC	NA	NA	NA	NA	NA
WP_106473352.1|3253163_3255506_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	50.6	3.4e-214
WP_106473353.1|3255502_3256909_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	45.0	1.3e-96
WP_106473354.1|3257262_3260778_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	34.1	3.8e-177
>prophage 234
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3280780	3281548	3892138		Bacillus_virus(100.0%)	1	NA	NA
WP_106473372.1|3280780_3281548_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.4e-28
>prophage 235
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3296784	3301781	3892138		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_106473388.1|3296784_3299667_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	60.3	0.0e+00
WP_106473389.1|3299734_3300319_+	VOC family protein	NA	NA	NA	NA	NA
WP_106473390.1|3300320_3300722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473391.1|3300908_3301781_-	3-hydroxyisobutyrate dehydrogenase	NA	A0A077SLF7	Escherichia_phage	31.3	1.8e-19
>prophage 236
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3309101	3309608	3892138		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_106473399.1|3309101_3309608_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.6	4.3e-34
>prophage 237
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3327295	3329047	3892138		Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_106474149.1|3327295_3329047_-	acetolactate synthase 3 large subunit	NA	G8DDL3	Micromonas_pusilla_virus	28.4	7.9e-51
>prophage 238
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3357319	3358793	3892138		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_106473438.1|3357319_3358111_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.9	1.8e-34
WP_106473439.1|3358103_3358793_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	42.4	3.0e-38
>prophage 239
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3363748	3367724	3892138		Indivirus(33.33%)	6	NA	NA
WP_106473443.1|3363748_3364336_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	35.7	3.9e-18
WP_106473444.1|3364518_3365646_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	37.0	5.8e-47
WP_106473445.1|3365647_3366199_+	6,7-dimethyl-8-ribityllumazine synthase	NA	NA	NA	NA	NA
WP_106473446.1|3366195_3366678_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_106473447.1|3366730_3367057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106473448.1|3367292_3367724_+	MmcB family DNA repair protein	NA	A0A1C3NFG6	Phage_NCTB	32.2	7.7e-08
>prophage 240
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3371668	3382382	3892138	tRNA,integrase	Flavobacterium_phage(25.0%)	10	3376172:3376191	3394682:3394701
WP_106473452.1|3371668_3373336_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	32.7	3.7e-05
WP_106473453.1|3374153_3374402_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106473454.1|3374398_3375004_+	DUF882 domain-containing protein	NA	A0A223VZI6	Agrobacterium_phage	46.4	1.0e-10
WP_149615545.1|3375023_3376724_+	hypothetical protein	NA	NA	NA	NA	NA
3376172:3376191	attL	CAACGAAGCCGACGAAGGCG	NA	NA	NA	NA
WP_149615546.1|3376734_3377220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473456.1|3377324_3378356_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	42.5	2.7e-67
WP_106473457.1|3378435_3379458_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_106473458.1|3379489_3380314_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_106473459.1|3380387_3380888_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_106474154.1|3380969_3382382_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	33.9	1.1e-05
3394682:3394701	attR	CAACGAAGCCGACGAAGGCG	NA	NA	NA	NA
>prophage 241
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3387234	3389892	3892138		Tupanvirus(50.0%)	2	NA	NA
WP_106473464.1|3387234_3387918_-	adenylate kinase	NA	A0A2K9L833	Tupanvirus	41.4	2.9e-09
WP_106473465.1|3387930_3389892_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.8	1.6e-84
>prophage 242
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3396718	3398248	3892138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106473469.1|3396718_3398248_+	malonyl-CoA synthase	NA	A0A2H4PQM9	Staphylococcus_phage	28.3	3.1e-35
>prophage 243
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3403700	3404657	3892138		Mycobacterium_phage(100.0%)	1	NA	NA
WP_106473472.1|3403700_3404657_-	tyrosine recombinase	NA	A0A0F6SJK8	Mycobacterium_phage	29.7	5.0e-15
>prophage 244
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3409258	3412648	3892138		Paracoccus_phage(33.33%)	3	NA	NA
WP_106473477.1|3409258_3409762_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	81.8	1.5e-50
WP_106473478.1|3409966_3410551_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	50.4	4.4e-30
WP_106473479.1|3410560_3412648_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.6	1.2e-10
>prophage 245
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3419443	3420178	3892138		Flavobacterium_phage(100.0%)	1	NA	NA
WP_106473486.1|3419443_3420178_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	37.0	6.3e-18
>prophage 246
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3431677	3434588	3892138		Roseobacter_phage(50.0%)	2	NA	NA
WP_106473496.1|3431677_3432397_+	response regulator transcription factor	NA	F4YXP8	Roseobacter_phage	51.6	5.2e-17
WP_106474158.1|3432467_3434588_+	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	38.8	2.3e-113
>prophage 247
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3455324	3456389	3892138		Roseobacter_phage(100.0%)	1	NA	NA
WP_106473518.1|3455324_3456389_+	DUF2793 domain-containing protein	NA	F4YXU6	Roseobacter_phage	31.9	2.6e-20
>prophage 248
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3460298	3472762	3892138		Powai_lake_megavirus(20.0%)	14	NA	NA
WP_106473523.1|3460298_3461381_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	32.7	1.3e-22
WP_106473524.1|3461377_3461968_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_106473525.1|3461967_3462621_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_106473526.1|3462788_3463250_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_106473527.1|3463358_3464402_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X6WFP1	Pacmanvirus	24.5	2.3e-13
WP_106473528.1|3464418_3465942_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_106473529.1|3465934_3466126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106474162.1|3466181_3466934_+	Fe-S cluster assembly ATPase SufC	NA	G3M9Y6	Bacillus_virus	27.7	3.8e-10
WP_106473530.1|3466936_3468217_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_106473531.1|3468216_3468702_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_106473532.1|3468698_3469289_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_106473533.1|3469281_3470502_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.6	5.3e-94
WP_106473534.1|3470859_3471765_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106473535.1|3471859_3472762_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	28.3	1.6e-15
>prophage 249
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3489513	3494901	3892138		Mycoplasma_phage(50.0%)	6	NA	NA
WP_106473548.1|3489513_3490638_-	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.1	1.7e-22
WP_106473549.1|3490732_3491752_-	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106473550.1|3492025_3492625_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_106473551.1|3492815_3493073_+	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_106473552.1|3493077_3493491_-	trigger factor	NA	NA	NA	NA	NA
WP_106473553.1|3493587_3494901_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.6	1.3e-18
>prophage 250
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3498790	3500239	3892138		Klosneuvirus(100.0%)	1	NA	NA
WP_106473556.1|3498790_3500239_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	2.5e-90
>prophage 251
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3504618	3508501	3892138	tRNA	Mycobacterium_phage(50.0%)	2	NA	NA
WP_106474168.1|3504618_3505686_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.1e-115
WP_106473559.1|3505846_3508501_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.4	1.9e-72
>prophage 252
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3514260	3518514	3892138		Deep-sea_thermophilic_phage(50.0%)	4	NA	NA
WP_106473564.1|3514260_3514959_-	transcriptional repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	35.2	2.9e-12
WP_106473565.1|3515041_3516214_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_106473566.1|3516210_3516684_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_106473567.1|3517491_3518514_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.7	6.0e-43
>prophage 253
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3525945	3531414	3892138		Lactococcus_phage(33.33%)	3	NA	NA
WP_106474169.1|3525945_3526491_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	39.3	1.2e-05
WP_106473575.1|3526490_3526955_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	37.1	5.2e-10
WP_106473576.1|3527754_3531414_+	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	56.4	0.0e+00
>prophage 254
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3549572	3555621	3892138		Mycobacterium_phage(40.0%)	6	NA	NA
WP_106473586.1|3549572_3550553_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	70.6	2.1e-130
WP_106473587.1|3550560_3552693_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	1.1e-195
WP_106473588.1|3552674_3553091_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	34.4	6.5e-12
WP_106473589.1|3553095_3553317_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	50.7	3.7e-14
WP_106473590.1|3554107_3554971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106473591.1|3555021_3555621_-	HNH endonuclease	NA	K4FCE1	Escherichia_phage	34.0	2.4e-07
>prophage 255
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3559817	3560750	3892138	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_106473594.1|3559817_3560750_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.4	4.1e-46
>prophage 256
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3575797	3577882	3892138		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_106473599.1|3575797_3577882_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.3	8.6e-20
>prophage 257
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3587321	3588206	3892138		Caulobacter_virus(100.0%)	1	NA	NA
WP_106473603.1|3587321_3588206_+	DUF1738 domain-containing protein	NA	K4JTS1	Caulobacter_virus	46.0	1.2e-52
>prophage 258
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3601871	3603005	3892138		Bacillus_phage(100.0%)	1	NA	NA
WP_106474177.1|3601871_3603005_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	56.4	9.7e-26
>prophage 259
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3606095	3606674	3892138		Bacillus_phage(100.0%)	1	NA	NA
WP_106473617.1|3606095_3606674_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	53.9	9.0e-20
>prophage 260
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3641703	3643071	3892138		Bacillus_phage(100.0%)	1	NA	NA
WP_106473643.1|3641703_3643071_-	peptidoglycan DD-metalloendopeptidase family protein	NA	S5M424	Bacillus_phage	41.7	9.0e-18
>prophage 261
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3650651	3662960	3892138		Klosneuvirus(20.0%)	14	NA	NA
WP_106474181.1|3650651_3651230_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	30.1	5.1e-15
WP_106473647.1|3651262_3651703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473648.1|3651899_3653294_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_106473649.1|3653365_3653707_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	37.2	9.1e-12
WP_106473650.1|3653703_3654762_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_106473651.1|3654758_3655190_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_106473652.1|3655186_3655525_-	DUF952 domain-containing protein	NA	NA	NA	NA	NA
WP_106473653.1|3655656_3657234_+	multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase	NA	A0A2R8FDL9	Cedratvirus	28.6	6.9e-38
WP_106473654.1|3657237_3659004_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_106473655.1|3659137_3659875_-	Bax inhibitor-1/YccA family protein	NA	A0A1S5WLC9	Cowpox_virus	26.6	6.1e-05
WP_106473656.1|3660037_3660259_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_106473657.1|3660380_3661268_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106473658.1|3661241_3662234_-	NADPH:quinone oxidoreductase family protein	NA	NA	NA	NA	NA
WP_106473659.1|3662576_3662960_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	45.5	3.9e-19
>prophage 262
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3668550	3670530	3892138	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_106473667.1|3668550_3670530_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.5	7.9e-116
>prophage 263
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3685545	3693579	3892138		Bacillus_phage(25.0%)	6	NA	NA
WP_106473675.1|3685545_3687357_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.7	4.8e-59
WP_106473676.1|3687496_3689392_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.5	2.7e-20
WP_106473677.1|3689407_3690331_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	29.3	5.7e-24
WP_106473678.1|3690337_3691174_-	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_149615557.1|3691317_3691932_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_106473679.1|3691941_3693579_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	7.5e-19
>prophage 264
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3701325	3703170	3892138		Tupanvirus(100.0%)	1	NA	NA
WP_106473686.1|3701325_3703170_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.9e-73
>prophage 265
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3711057	3712674	3892138		Pandoravirus(50.0%)	2	NA	NA
WP_106473693.1|3711057_3711504_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	48.1	1.4e-07
WP_106473694.1|3711987_3712674_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	31.1	6.3e-12
>prophage 266
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3717042	3719472	3892138		Streptococcus_phage(100.0%)	1	NA	NA
WP_106473699.1|3717042_3719472_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.1	1.3e-104
>prophage 267
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3727886	3729764	3892138		Bacillus_virus(50.0%)	2	NA	NA
WP_106474193.1|3727886_3728969_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	7.6e-28
WP_106473707.1|3728984_3729764_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.1	2.1e-11
>prophage 268
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3743323	3747207	3892138		Bacillus_virus(33.33%)	4	NA	NA
WP_106473720.1|3743323_3744118_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.5	8.9e-18
WP_106473721.1|3744139_3744817_-	hypothetical protein	NA	A0A1D8KGH6	Synechococcus_phage	27.1	1.1e-13
WP_149615558.1|3744863_3745688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473723.1|3745881_3747207_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.4	3.9e-18
>prophage 269
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3756062	3756719	3892138		Planktothrix_phage(100.0%)	1	NA	NA
WP_106474196.1|3756062_3756719_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	1.9e-26
>prophage 270
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3763822	3765382	3892138		Hokovirus(100.0%)	1	NA	NA
WP_106473735.1|3763822_3765382_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.2	3.4e-13
>prophage 271
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3772667	3775599	3892138		uncultured_virus(50.0%)	4	NA	NA
WP_106473742.1|3772667_3773216_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.7	1.7e-12
WP_106473743.1|3773308_3773755_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_106473744.1|3773799_3775101_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_106473745.1|3775125_3775599_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	43.2	3.9e-13
>prophage 272
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3794102	3795329	3892138		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_106474198.1|3794102_3795329_-	aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.1	1.2e-16
>prophage 273
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3801030	3810090	3892138		Staphylococcus_phage(33.33%)	8	NA	NA
WP_106473766.1|3801030_3802743_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	1.8e-23
WP_106473767.1|3802795_3803566_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.3e-05
WP_106473768.1|3803575_3804448_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_106473769.1|3804453_3806430_-	acetoacetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	23.1	1.3e-17
WP_106474199.1|3806426_3807602_-	serine hydrolase	NA	A0A2P1JQM9	Mycobacterium_phage	28.6	3.0e-06
WP_106474200.1|3807664_3808474_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_106473770.1|3808630_3809332_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	6.2e-07
WP_106473771.1|3809331_3810090_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.3	2.3e-15
>prophage 274
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3822874	3823630	3892138		Aeromonas_phage(100.0%)	1	NA	NA
WP_106473785.1|3822874_3823630_+	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	26.8	2.1e-08
>prophage 275
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3828469	3830906	3892138		Streptococcus_phage(100.0%)	2	NA	NA
WP_106473792.1|3828469_3829735_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.9	2.1e-93
WP_106473793.1|3829799_3830906_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.7	2.6e-52
>prophage 276
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3846369	3847857	3892138		Mycoplasma_phage(100.0%)	1	NA	NA
WP_106473813.1|3846369_3847857_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.9	1.4e-45
>prophage 277
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3863669	3878936	3892138	tRNA	Streptococcus_phage(16.67%)	14	NA	NA
WP_106473828.1|3863669_3864947_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	61.7	4.4e-144
WP_106473829.1|3864943_3865894_-	DMT family transporter	NA	NA	NA	NA	NA
WP_106473830.1|3866006_3867047_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_106473831.1|3867043_3867466_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_106474205.1|3867834_3869139_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	9.4e-49
WP_106473832.1|3869147_3869984_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_106473833.1|3870066_3870777_-	endonuclease	NA	NA	NA	NA	NA
WP_106473834.1|3870867_3871746_+	DMT family transporter	NA	NA	NA	NA	NA
WP_106473835.1|3871748_3873167_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	39.9	2.1e-49
WP_106473836.1|3873236_3873686_+	cupin domain-containing protein	NA	A0A291ATU0	Pandoravirus	46.2	2.7e-24
WP_106473837.1|3873707_3874832_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_106473838.1|3874895_3876149_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	35.6	9.6e-59
WP_106473839.1|3876269_3877025_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_106473840.1|3877124_3878936_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.5	3.4e-33
>prophage 278
NZ_CP027665	Rhodobacteraceae bacterium SH-1 chromosome, complete genome	3892138	3883580	3891564	3892138		Bacillus_phage(33.33%)	10	NA	NA
WP_106473846.1|3883580_3883883_+	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	37.4	2.3e-11
WP_106473847.1|3883905_3884733_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106473848.1|3884925_3886017_+	2'-deoxycytidine 5'-triphosphate deaminase	NA	NA	NA	NA	NA
WP_106474207.1|3886013_3887090_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	31.9	5.2e-37
WP_106473849.1|3887110_3887578_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_106473850.1|3887701_3888115_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_149615559.1|3888131_3888515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473852.1|3888535_3888964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473853.1|3888968_3889373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106473854.1|3889581_3891564_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.2	1.8e-35
>prophage 1
NZ_CP043619	Rhodobacteraceae bacterium SH-1 plasmid p1, complete sequence	167434	22118	85071	167434	transposase,integrase	Bacillus_phage(15.38%)	57	80436:80495	86659:86834
WP_149615585.1|22118_23636_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JGQ6	uncultured_Caudovirales_phage	22.7	1.1e-11
WP_149615586.1|24956_25157_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_149615587.1|25199_25931_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_149615588.1|25932_26415_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_007803406.1|26411_27806_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_007803405.1|27849_28767_-	cytochrome c	NA	NA	NA	NA	NA
WP_007803403.1|28769_29363_-	cytochrome c	NA	NA	NA	NA	NA
WP_007803401.1|29732_30191_-	cytochrome c	NA	NA	NA	NA	NA
WP_149615589.1|30219_30780_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_043754567.1|30935_31238_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_009807485.1|31521_33651_+	suppressor for copper-sensitivity B precursor	NA	NA	NA	NA	NA
WP_149615590.1|33679_34831_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_009807484.1|34827_35301_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_009807483.1|35297_35864_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_149615591.1|35872_37873_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_009807481.1|37938_38130_-	membrane protein	NA	NA	NA	NA	NA
WP_149615592.1|38179_39646_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_078523120.1|39645_40368_-	response regulator	NA	W8CYM9	Bacillus_phage	38.8	2.6e-32
WP_146681743.1|40877_42228_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	31.0	6.2e-11
WP_149615593.1|42635_43502_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_149615594.1|43498_44509_+	TniQ family protein	NA	NA	NA	NA	NA
WP_078523268.1|44525_45137_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	28.1	9.2e-15
WP_078523244.1|45184_46069_-	DUF1403 family protein	NA	NA	NA	NA	NA
WP_149615595.1|46226_47324_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_149615596.1|47330_47666_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_149615686.1|47662_47920_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_149615687.1|48046_48583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615597.1|48949_50149_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	46.6	7.2e-88
WP_149615598.1|50133_51117_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	27.7	1.2e-24
WP_149615599.1|51357_52413_+	replication initiator RepC	NA	NA	NA	NA	NA
WP_149615600.1|52519_54688_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_149615601.1|56107_57160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615602.1|57914_58319_+	single-stranded DNA-binding protein	NA	Q6V7S6	Burkholderia_virus	42.5	1.5e-16
WP_149615603.1|58579_59542_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149615604.1|59747_61247_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_149615605.1|61308_62832_+	DUF1254 domain-containing protein	NA	M1I2Z8	Paramecium_bursaria_Chlorella_virus	35.1	7.0e-11
WP_149615688.1|62960_63692_+	transporter	NA	NA	NA	NA	NA
WP_149615689.1|63954_64866_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_149615606.1|64941_66141_+	DUF932 domain-containing protein	NA	A0A1V0DX75	Synechococcus_virus	41.2	5.8e-69
WP_149615607.1|66267_66708_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_149615608.1|66818_67337_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_149615609.1|67434_67926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615610.1|68275_69697_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_149615611.1|69693_71520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615690.1|71675_73664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615612.1|73660_74086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615613.1|74274_74496_+	hypothetical protein	NA	U5J9H1	Bacillus_phage	50.0	7.2e-10
WP_149615614.1|74497_74695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615615.1|74769_75189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615616.1|75181_75826_+	antitoxin of toxin-antitoxin stability system	NA	A0A126DJL2	Acinetobacter_phage	31.9	3.5e-20
WP_149615617.1|75854_76058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149615691.1|76076_76676_-	mobile mystery protein B	NA	NA	NA	NA	NA
WP_149615618.1|76678_77140_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_149615619.1|77342_77639_-	hypothetical protein	NA	NA	NA	NA	NA
80436:80495	attL	TAATATGCCGCGTCAGCGTTATGCTGAGTTCTGGGTTTCAAGCTGTTGTTCTGGCGTTTC	NA	NA	NA	NA
WP_149615620.1|80677_83119_+	DEAD/DEAH box helicase family protein	NA	A0A2K9R7J3	Dishui_lake_phycodnavirus	29.8	3.0e-32
WP_149615621.1|83158_84163_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	28.7	9.2e-12
WP_149615692.1|84159_85071_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
86659:86834	attR	GAAACGCCAGAACAACAGCTTGAAACCCAGAACTCAGCATAACGCTGACGCGGCATATTATGTCCTGGATTACCTCGCCCATTCCTTCCCGGTGCAGCTCTACGAGCCTTTCACCGACAGCGAGGGCAACCTCTCGTCGCGCCCCGTCATGCGCGACGGCCAACCGGTGGAGTGCC	NA	NA	NA	NA
>prophage 1
NZ_CP043620	Rhodobacteraceae bacterium SH-1 plasmid p2, complete sequence	78245	0	11441	78245		Rhizobium_phage(20.0%)	12	NA	NA
WP_149615729.1|601_1813_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	29.5	5.7e-24
WP_149615697.1|1993_4162_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_008335991.1|4750_5155_+	single-stranded DNA-binding protein	NA	Q6V7S6	Burkholderia_virus	41.6	1.5e-16
WP_149615730.1|5294_6131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149615698.1|6737_7937_+	DUF932 domain-containing protein	NA	A0A1V0DX75	Synechococcus_virus	41.2	1.7e-68
WP_149615699.1|8065_8506_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_149615700.1|8616_9135_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_149615701.1|9230_9722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615702.1|9732_10110_+	hypothetical protein	NA	U5J9H1	Bacillus_phage	54.1	7.4e-31
WP_149615703.1|10111_10309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615704.1|10384_10804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615705.1|10796_11441_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	37.1	1.1e-29
>prophage 2
NZ_CP043620	Rhodobacteraceae bacterium SH-1 plasmid p2, complete sequence	78245	18218	27201	78245	integrase	Brevibacillus_phage(25.0%)	5	18095:18154	24318:24493
18095:18154	attL	TAATATGCCGCGTCAGCGTTATGCTGAGTTCTGGGTTTCAAGCTGTTGTTCTGGCGTTTC	NA	NA	NA	NA
WP_149615622.1|18218_19745_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.1	1.4e-11
WP_149615692.1|19741_20653_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_149615621.1|20649_21654_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	28.7	9.2e-12
WP_149615620.1|21693_24135_-	DEAD/DEAH box helicase family protein	NA	A0A2K9R7J3	Dishui_lake_phycodnavirus	29.8	3.0e-32
WP_149615709.1|26169_27201_+	DNA primase	NA	A0A0H5AWB1	Pseudomonas_phage	30.7	2.2e-16
24318:24493	attR	GAAACGCCAGAACAACAGCTTGAAACCCAGAACTCAGCATAACGCTGACGCGGCATATTACGTTCTGGACTACCTCGCCCATTCTTTCCCGGTCCAGCTCTACGAGCCTTTCACTGACAGCGAGGGCAACCTCTCGTCGTGCCCCGTCACGCGCGACGGCCAACCGGTGGACTGCC	NA	NA	NA	NA
>prophage 3
NZ_CP043620	Rhodobacteraceae bacterium SH-1 plasmid p2, complete sequence	78245	31264	35350	78245		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_149615714.1|31264_35350_-	restriction endonuclease	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	25.4	1.4e-50
>prophage 4
NZ_CP043620	Rhodobacteraceae bacterium SH-1 plasmid p2, complete sequence	78245	49839	51006	78245		Bacillus_phage(100.0%)	1	NA	NA
WP_149615725.1|49839_51006_-	transglycosylase SLT domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	51.1	2.0e-26
>prophage 5
NZ_CP043620	Rhodobacteraceae bacterium SH-1 plasmid p2, complete sequence	78245	54207	54891	78245		Geobacillus_virus(100.0%)	1	NA	NA
WP_149615731.1|54207_54891_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	55.8	6.3e-20
>prophage 6
NZ_CP043620	Rhodobacteraceae bacterium SH-1 plasmid p2, complete sequence	78245	64925	66299	78245		Planktothrix_phage(100.0%)	1	NA	NA
WP_026155631.1|64925_66299_+	M23 family metallopeptidase	NA	G9BW84	Planktothrix_phage	43.9	9.0e-18
>prophage 7
NZ_CP043620	Rhodobacteraceae bacterium SH-1 plasmid p2, complete sequence	78245	70169	77720	78245		Streptococcus_phage(33.33%)	6	NA	NA
WP_018001712.1|70169_72524_-	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.7	4.2e-116
WP_038068706.1|72706_72991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026155629.1|73016_73682_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_038068700.1|74213_75284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974352.1|75510_76392_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	56.8	3.4e-34
WP_043754416.1|76526_77720_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	53.8	9.6e-117
>prophage 1
NZ_CP043621	Rhodobacteraceae bacterium SH-1 plasmid p3, complete sequence	67363	5580	43346	67363	integrase,transposase	uncultured_Caudovirales_phage(11.11%)	37	31188:31203	39018:39033
WP_149615737.1|5580_6678_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_149615738.1|6834_7614_+	DUF1403 family protein	NA	NA	NA	NA	NA
WP_149615585.1|7859_9377_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JGQ6	uncultured_Caudovirales_phage	22.7	1.1e-11
WP_149615584.1|9345_10209_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_149615583.1|10172_11168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615739.1|12166_13030_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_149615740.1|13026_13854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149615741.1|14152_15331_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_149615742.1|15327_18735_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_149615743.1|18993_20103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615789.1|20358_20529_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_149615744.1|20666_21395_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.6	5.3e-33
WP_149615745.1|21327_22893_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.5	4.6e-18
WP_149615746.1|22985_23288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149615747.1|23265_24222_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_149615748.1|24243_24879_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_149615749.1|24951_25494_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_149615750.1|25523_25886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149615751.1|26021_26975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149615752.1|27132_27642_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_149615753.1|27629_27995_+	copper-binding protein	NA	NA	NA	NA	NA
WP_149615754.1|28064_28757_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_149615790.1|28891_29302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615755.1|29784_30459_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.5	4.9e-25
WP_149615756.1|30502_31501_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	28.0	5.6e-17
31188:31203	attL	AGGAGCTGGGGCTCGC	NA	NA	NA	NA
WP_149615757.1|31497_32442_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_149615791.1|32438_33500_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	29.3	9.1e-10
WP_149615758.1|33782_35486_+	hypothetical protein	NA	Q7Y5U5	Haemophilus_phage	25.0	6.4e-05
WP_114276310.1|35482_35977_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_149615759.1|36442_36655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615760.1|36742_37132_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_149615761.1|37276_39250_+	ParB N-terminal domain-containing protein	NA	A0A0F7L836	uncultured_marine_virus	36.4	6.0e-07
39018:39033	attR	AGGAGCTGGGGCTCGC	NA	NA	NA	NA
WP_149615762.1|39318_39912_+	regulator	NA	NA	NA	NA	NA
WP_149615763.1|40115_40772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615764.1|40856_41099_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_149615765.1|41088_41508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149615766.1|42635_43346_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	34.8	3.8e-28
>prophage 1
NZ_CP043622	Rhodobacteraceae bacterium SH-1 plasmid p4, complete sequence	41166	0	4582	41166		Aurantimonas_phage(100.0%)	3	NA	NA
WP_149615795.1|2579_3479_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_149615796.1|3549_3894_-	stability/partitioning determinant	NA	NA	NA	NA	NA
WP_149615797.1|3895_4582_-	AAA family ATPase	NA	A0A0A8IL09	Aurantimonas_phage	43.6	8.2e-44
>prophage 2
NZ_CP043622	Rhodobacteraceae bacterium SH-1 plasmid p4, complete sequence	41166	10305	20110	41166	transposase	Burkholderia_virus(20.0%)	6	NA	NA
WP_149615824.1|10305_11859_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	27.0	4.8e-07
WP_149615825.1|13380_13986_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	33.8	1.4e-18
WP_149615805.1|14080_16969_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.8	2.3e-180
WP_149615806.1|17205_18105_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149615807.1|18132_19128_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-18
WP_149615808.1|19117_20110_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.7	2.9e-10
>prophage 3
NZ_CP043622	Rhodobacteraceae bacterium SH-1 plasmid p4, complete sequence	41166	33909	37513	41166	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_149615820.1|33909_36813_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.7	2.1e-186
WP_149615821.1|36907_37513_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	33.3	8.8e-18
