The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027569	Megasphaera elsdenii strain NCIMB702410 chromosome, complete genome	2566193	221692	279561	2566193	plate,transposase,tRNA,integrase,holin	Bacillus_virus(16.67%)	51	222636:222651	285880:285895
WP_027895324.1|221692_222949_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	34.7	1.5e-56
222636:222651	attL	ATTTTGATGTCATTGA	NA	NA	NA	NA
WP_027895325.1|223365_224049_-	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_027895326.1|224255_225665_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_051524976.1|225774_226596_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_027895328.1|226783_227335_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_051524977.1|227693_228197_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027895330.1|228325_228604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036220577.1|228714_229185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051524978.1|230034_234354_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_027895332.1|234668_234863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895333.1|235191_235557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895334.1|235582_236539_-	AEC family transporter	NA	NA	NA	NA	NA
WP_027895335.1|236542_237106_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	52.6	1.1e-46
WP_027895336.1|237123_237729_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_036220582.1|238008_238278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014016246.1|238284_239241_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_027895337.1|239644_240295_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027895338.1|240540_241767_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	53.7	3.1e-110
WP_158698416.1|241996_242143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080712304.1|242525_244514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895339.1|247868_248318_-	DUF296 domain-containing protein	NA	NA	NA	NA	NA
WP_027895340.1|249348_252222_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_027895341.1|252441_253977_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_022498026.1|254086_254569_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_014016231.1|254585_255056_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_022498027.1|255245_255632_-	RidA family protein	NA	NA	NA	NA	NA
WP_027895342.1|255711_257121_-	amino acid permease	NA	NA	NA	NA	NA
WP_027895343.1|257134_258355_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_036220583.1|259052_260156_-	MFS transporter	NA	NA	NA	NA	NA
WP_106669691.1|260282_261509_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	55.0	5.1e-113
WP_155266582.1|261621_261768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016224.1|261807_263439_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.8	4.3e-160
WP_014016223.1|263489_263771_-	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	43.5	5.3e-18
WP_014016222.1|263907_264498_-	response regulator	NA	NA	NA	NA	NA
WP_022497769.1|264501_265914_-	ATPase	NA	NA	NA	NA	NA
WP_027895873.1|265941_266952_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.5	1.1e-68
WP_014016219.1|266966_267440_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_014016218.1|267430_268141_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_027895872.1|268124_268595_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_080712327.1|268607_269585_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_014016215.1|269600_270008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895870.1|270468_271971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036220914.1|272420_272603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895868.1|272989_273274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895867.1|273308_273857_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	36.5	4.3e-11
WP_027895866.1|273853_274300_-|holin	phage holin family protein	holin	D2XPZ9	Bacillus_virus	43.3	3.7e-21
WP_027895865.1|274445_274919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895864.1|274971_276012_+|integrase	site-specific integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	32.0	1.2e-43
WP_106669692.1|276868_277855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051525010.1|277820_278495_-	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	2.7e-15
WP_036220894.1|278487_279561_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	35.5	1.6e-49
285880:285895	attR	TCAATGACATCAAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP027569	Megasphaera elsdenii strain NCIMB702410 chromosome, complete genome	2566193	282720	325638	2566193	portal,capsid,terminase,tail,tRNA,head,protease	Clostridium_phage(29.41%)	51	NA	NA
WP_027895859.1|282720_285255_-|tail	phage tail tape measure protein	tail	A0A2I6PER7	Staphylococcus_phage	32.4	2.5e-50
WP_027895858.1|285435_285849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895857.1|285863_286298_-|tail	phage tail tube protein	tail	A0A0A7RVT1	Clostridium_phage	45.9	6.8e-28
WP_027895856.1|286309_287455_-	hypothetical protein	NA	A0A1V0DZX4	Clostridioides_phage	33.9	2.2e-49
WP_027895855.1|287485_287950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036220887.1|287946_288342_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_036220884.1|288331_288688_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_027895854.1|288692_288968_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	34.4	6.0e-06
WP_027895853.1|288977_290105_-|capsid	phage major capsid protein	capsid	A0A2I7SBY4	Paenibacillus_phage	30.3	3.1e-24
WP_027895852.1|290101_290851_-|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	42.0	1.9e-33
WP_051525013.1|290847_292065_-|portal	phage portal protein	portal	A0A0A7S1E7	Clostridium_phage	45.0	1.1e-83
WP_036220880.1|292079_293825_-|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	49.8	6.9e-156
WP_027895850.1|293827_294295_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JH50	uncultured_Caudovirales_phage	32.7	5.4e-15
WP_158698418.1|294372_294627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895849.1|294969_295422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072023510.1|295532_295718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080712325.1|295718_296009_-	hypothetical protein	NA	A8AU00	Listeria_phage	47.3	8.0e-09
WP_051525006.1|295998_296895_-	hypothetical protein	NA	Q0SPI6	Clostridium_phage	39.9	7.1e-40
WP_027895848.1|297061_297466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895847.1|297462_297696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895846.1|297700_298138_-	hypothetical protein	NA	A0A2H4PFU2	Mycobacterium_phage	57.1	4.4e-43
WP_027895845.1|298265_298562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155266579.1|298764_298935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895843.1|299314_299551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036220901.1|299563_299860_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027895841.1|299920_300151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895840.1|300749_300935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895839.1|301068_301410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895838.1|301514_301709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106669693.1|301726_301939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158698419.1|302029_302422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106669695.1|302669_302882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106669696.1|302964_303612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895837.1|303931_304138_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158698420.1|304268_304622_+	helix-turn-helix domain-containing protein	NA	A0A139ZPJ2	Marinitoga_camini_virus	35.7	1.4e-10
WP_027895836.1|304664_305048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895835.1|305173_306172_+	Abi family protein	NA	A0A1Q1PVS3	Staphylococcus_phage	32.4	1.2e-30
WP_072023508.1|306392_307925_+	recombinase family protein	NA	A0A2K9V2Y5	Faecalibacterium_phage	36.4	2.5e-77
WP_027895550.1|313721_315059_-	MFS transporter	NA	NA	NA	NA	NA
WP_014016212.1|315140_315656_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_022497040.1|315671_316184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157868816.1|316343_317504_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027895551.1|317741_318668_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027895552.1|318602_319514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895553.1|319517_320102_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_027895554.1|320267_321197_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.0	3.8e-36
WP_036205187.1|321193_322429_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_027895555.1|322480_323047_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_027895556.1|323036_323453_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_027895557.1|323498_324605_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.9	4.3e-87
WP_014016201.1|324618_325638_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP027569	Megasphaera elsdenii strain NCIMB702410 chromosome, complete genome	2566193	1293156	1327477	2566193	integrase,protease,transposase	Streptococcus_phage(33.33%)	26	1316542:1316570	1335256:1335284
WP_027895404.1|1293156_1295076_+|protease	ATP-dependent protease, Lon family	protease	A0A0R6PGP8	Moraxella_phage	27.1	1.3e-27
WP_014015701.1|1295077_1296406_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	46.2	2.9e-106
WP_014015702.1|1297219_1298407_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	1.8e-14
WP_027895403.1|1298792_1299689_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014015704.1|1299971_1301492_+	L-lactate permease	NA	NA	NA	NA	NA
WP_027895402.1|1302169_1303723_+	propanoyl-CoA transferase Pct	NA	NA	NA	NA	NA
WP_014015706.1|1303719_1304634_+	VOC family protein	NA	NA	NA	NA	NA
WP_014015707.1|1304659_1305436_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_027895401.1|1305457_1306744_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_027895400.1|1306743_1307862_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_106669705.1|1308067_1309216_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_054335782.1|1309493_1309949_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	40.0	2.1e-19
WP_027895699.1|1310112_1311006_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_106669706.1|1311156_1312383_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	55.2	2.3e-113
WP_027895698.1|1312696_1314658_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	3.5e-100
WP_027895697.1|1315150_1316473_+	MFS transporter	NA	NA	NA	NA	NA
1316542:1316570	attL	CGTAGGGGCCGTCCCAAAGGGCGGCCCGC	NA	NA	NA	NA
WP_027895696.1|1316746_1317187_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_027895695.1|1317263_1317692_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_027895694.1|1318000_1318648_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_027895693.1|1318687_1320019_+	anaerobic nitric oxide reductase flavorubredoxin	NA	NA	NA	NA	NA
WP_027895692.1|1320774_1321251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036203056.1|1321403_1322519_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	48.4	5.5e-90
WP_155266567.1|1322661_1323045_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	34.9	9.9e-07
WP_027895371.1|1323142_1324999_-	APC family permease	NA	NA	NA	NA	NA
WP_027895370.1|1325806_1327036_+	iron hydrogenase	NA	NA	NA	NA	NA
WP_072014509.1|1327183_1327477_+|transposase	transposase	transposase	S6AND0	Bacillus_phage	53.0	9.2e-21
1335256:1335284	attR	CGTAGGGGCCGTCCCAAAGGGCGGCCCGC	NA	NA	NA	NA
>prophage 4
NZ_CP027569	Megasphaera elsdenii strain NCIMB702410 chromosome, complete genome	2566193	1640946	1695920	2566193	plate,portal,transposase,capsid,terminase,tail,integrase,protease	Bacteriophage(20.69%)	76	1666915:1666929	1691600:1691614
WP_054335782.1|1640946_1641402_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	40.0	2.1e-19
WP_027895432.1|1641634_1642201_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_155266569.1|1643709_1644960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895435.1|1645059_1646019_+	WYL domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_027895436.1|1646121_1647792_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_027895437.1|1647887_1649417_+	methylmalonyl-CoA carboxyltransferase	NA	NA	NA	NA	NA
WP_027895439.1|1649950_1650358_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_027895440.1|1650734_1651811_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	32.8	7.0e-42
WP_014016479.1|1651917_1652100_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_027895441.1|1652150_1652603_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_027895443.1|1652908_1653946_-	hypothetical protein	NA	A0A1S5SFA1	Streptococcus_phage	30.4	1.6e-27
WP_036220619.1|1653973_1654186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051524981.1|1654206_1655019_-	hypothetical protein	NA	A0A1W6JPJ7	Morganella_phage	56.1	7.6e-41
WP_158698422.1|1655071_1655863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155266571.1|1655808_1655979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051524982.1|1656101_1656281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895446.1|1656454_1656844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155266572.1|1656892_1657459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027895448.1|1657473_1658100_-	helix-turn-helix domain-containing protein	NA	A0A2H4J2S9	uncultured_Caudovirales_phage	34.1	1.0e-24
WP_036220614.1|1658256_1658442_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	39.7	1.1e-06
WP_027895449.1|1658586_1659030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895450.1|1659048_1659279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895451.1|1659515_1660091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051524983.1|1660154_1660640_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027895452.1|1660707_1660971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895453.1|1660986_1661268_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027895455.1|1661492_1661768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016036.1|1661770_1661992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895456.1|1662145_1662889_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.8	1.7e-23
WP_027895489.1|1664173_1664722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895457.1|1664733_1665171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051524984.1|1665410_1666208_+	hypothetical protein	NA	I2E8X7	Clostridium_phage	32.5	1.5e-28
WP_027895458.1|1666478_1666670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895459.1|1666679_1666874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895460.1|1666870_1667326_+	hypothetical protein	NA	NA	NA	NA	NA
1666915:1666929	attL	CGGATACCTCGAAAA	NA	NA	NA	NA
WP_027895461.1|1667322_1667766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895462.1|1668282_1668801_+	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	35.9	1.0e-14
WP_027895463.1|1668797_1670708_+|terminase	terminase	terminase	A0A2K9V2Q8	Faecalibacterium_phage	42.7	2.1e-137
WP_014016048.1|1670716_1670935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895464.1|1670947_1672540_+|portal	phage portal protein	portal	A0A2K9V452	Faecalibacterium_phage	40.3	9.6e-104
WP_027895465.1|1672529_1673600_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	35.2	4.4e-36
WP_027895466.1|1673599_1673935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895467.1|1673947_1675000_+|capsid	phage capsid protein	capsid	A0A0K2FHW2	Achromobacter_phage	25.2	3.2e-07
WP_027895468.1|1675011_1675254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016054.1|1675250_1675577_+	hypothetical protein	NA	A0A0C5AJ53	Bacteriophage	35.6	2.0e-08
WP_014016055.1|1675585_1676101_+	hypothetical protein	NA	A0A067ZG41	Vibrio_phage	33.3	6.2e-12
WP_014016056.1|1676105_1676615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014016057.1|1676607_1676844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895469.1|1676845_1678291_+|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	50.4	4.7e-126
WP_020309999.1|1678303_1678834_+|tail	phage major tail tube protein	tail	A0A2K9V323	Faecalibacterium_phage	37.0	6.8e-22
WP_027895470.1|1678844_1679171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155266573.1|1679191_1679338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036220628.1|1679672_1681928_+|tail	phage tail tape measure protein	tail	D5LGY4	Escherichia_phage	51.9	1.8e-100
WP_027895471.1|1681920_1682124_+|tail	tail protein	tail	A0A2K9V482	Faecalibacterium_phage	51.6	5.4e-12
WP_027895472.1|1682128_1683295_+	phage regulatory protein	NA	A0A0C5AJ59	Bacteriophage	32.0	2.1e-44
WP_027895473.1|1683284_1683749_+|plate	baseplate assembly protein	plate	A0A067ZIM2	Vibrio_phage	27.5	6.8e-10
WP_014016065.1|1683757_1684228_+|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	32.3	7.1e-15
WP_027895474.1|1684238_1684553_+	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	46.1	8.6e-17
WP_027895475.1|1684539_1685655_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	43.8	1.8e-77
WP_027895476.1|1685651_1686293_+|tail	phage tail protein I	tail	A0A2K9V471	Faecalibacterium_phage	39.6	1.1e-18
WP_027895477.1|1686276_1686837_+	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	40.4	1.5e-16
WP_027895478.1|1686845_1687172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080712309.1|1687184_1687997_+	hypothetical protein	NA	J9PUL9	Bacillus_phage	37.3	2.9e-08
WP_051524985.1|1688016_1688328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051524986.1|1688342_1688864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895481.1|1689773_1689980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895482.1|1690171_1691197_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	32.0	4.8e-40
WP_027895483.1|1691235_1691673_+	hypothetical protein	NA	NA	NA	NA	NA
1691600:1691614	attR	CGGATACCTCGAAAA	NA	NA	NA	NA
WP_155266574.1|1691685_1691838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895484.1|1691855_1692095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895485.1|1692091_1692457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895486.1|1692440_1693070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895487.1|1693084_1693471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027895488.1|1693753_1694260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051524987.1|1694391_1694769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036203056.1|1694804_1695920_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	48.4	5.5e-90
>prophage 5
NZ_CP027569	Megasphaera elsdenii strain NCIMB702410 chromosome, complete genome	2566193	1755000	1762231	2566193	protease	Agrobacterium_phage(16.67%)	7	NA	NA
WP_027895124.1|1755000_1755597_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.7	3.1e-55
WP_014016142.1|1755614_1756853_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.5	2.1e-143
WP_027895125.1|1756925_1759259_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.4	3.3e-177
WP_014016144.1|1759258_1759894_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_022497868.1|1760111_1760483_+	thioredoxin	NA	A0A2I2L415	Orpheovirus	30.4	2.1e-09
WP_022497869.1|1760519_1761446_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	39.7	5.6e-56
WP_014016147.1|1761487_1762231_+	hypothetical protein	NA	A0A1S5SEZ8	Streptococcus_phage	34.4	9.5e-22
>prophage 6
NZ_CP027569	Megasphaera elsdenii strain NCIMB702410 chromosome, complete genome	2566193	2239300	2246078	2566193		Bacillus_phage(16.67%)	13	NA	NA
WP_027894632.1|2239300_2239729_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	44.8	1.2e-29
WP_027894631.1|2239756_2240182_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	45.9	3.2e-22
WP_036220316.1|2240357_2240588_+	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	52.4	1.6e-12
WP_027894629.1|2240794_2241175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072023471.1|2241451_2241823_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_027894627.1|2241890_2242070_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027894626.1|2242082_2242892_+	hypothetical protein	NA	Q38330	Lactococcus_phage	49.6	6.8e-66
WP_027894625.1|2242906_2243185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051524930.1|2243181_2243520_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027894623.1|2243605_2243890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027894622.1|2243891_2244881_+	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_080712277.1|2244901_2245528_+	ERF family protein	NA	B6SBX8	Clostridium_virus	66.9	1.5e-39
WP_027894621.1|2245529_2246078_+	hypothetical protein	NA	F7V9C9	Lactobacillus_virus	34.0	5.5e-19
>prophage 7
NZ_CP027569	Megasphaera elsdenii strain NCIMB702410 chromosome, complete genome	2566193	2253988	2261992	2566193		Staphylococcus_phage(14.29%)	13	NA	NA
WP_027894607.1|2253988_2254399_+	hypothetical protein	NA	A0A1W6JPZ1	Staphylococcus_phage	33.6	6.9e-06
WP_027894606.1|2254401_2254911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027894605.1|2255097_2255373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072023469.1|2255365_2255848_+	DUF2829 domain-containing protein	NA	H7BV51	unidentified_phage	54.2	1.3e-19
WP_080712270.1|2255868_2256324_+	HNH endonuclease	NA	A0A0F7IND1	Polaribacter_phage	55.8	5.4e-28
WP_027894603.1|2256325_2256727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155266555.1|2256792_2256933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051524925.1|2256939_2257428_+	dCMP deaminase family protein	NA	A0A222YXY3	Mycobacterium_phage	45.3	4.8e-22
WP_027894601.1|2257399_2257855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027894600.1|2257910_2259023_+	hypothetical protein	NA	A0A0A7S0B8	Clostridium_phage	34.1	1.5e-34
WP_027894598.1|2259547_2259817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027894597.1|2259920_2260412_+	hypothetical protein	NA	A5GYP7	Lactococcus_phage	60.5	3.8e-43
WP_027894596.1|2260453_2261992_+	hypothetical protein	NA	A0A1B1IRS4	uncultured_Mediterranean_phage	37.1	2.0e-29
>prophage 8
NZ_CP027569	Megasphaera elsdenii strain NCIMB702410 chromosome, complete genome	2566193	2435089	2442148	2566193		Synechococcus_phage(33.33%)	6	NA	NA
WP_014016575.1|2435089_2435695_-	IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	53.9	2.0e-49
WP_027895185.1|2435714_2436329_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.3	1.7e-24
WP_022497428.1|2436321_2437386_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D8KLC2	Synechococcus_phage	41.3	9.3e-63
WP_014016572.1|2437366_2438794_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	4.9e-59
WP_014016571.1|2438838_2439333_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.4	6.5e-27
WP_036220526.1|2439616_2442148_+	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	23.3	1.5e-21
