The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	1764125	1773590	5394870	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1764125_1765241_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004209695.1|1765237_1767178_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1767254_1767476_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1767801_1768119_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1768149_1770429_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1770550_1770769_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1771122_1771824_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_032432850.1|1771868_1773590_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 2
NZ_CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	2145722	2218958	5394870	integrase,holin,protease,terminase,tail,transposase	Klebsiella_phage(18.52%)	82	2146731:2146746	2208376:2208391
WP_002901758.1|2145722_2146769_+|protease	protease SohB	protease	NA	NA	NA	NA
2146731:2146746	attL	CTGCGCTGGTGGCAGC	NA	NA	NA	NA
WP_002901761.1|2146816_2147068_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|2147474_2150072_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|2150417_2151392_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|2151637_2151805_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_016947418.1|2152193_2154866_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|2154912_2155515_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|2155678_2156446_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|2156581_2156890_+	LapA family protein	NA	NA	NA	NA	NA
WP_002901781.1|2156896_2158066_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|2158257_2158995_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|2158994_2159321_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_002901783.1|2159452_2159671_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|2159946_2160696_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|2160767_2160947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|2161105_2163040_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_004151905.1|2163121_2164279_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004140277.1|2164469_2165258_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_016947419.1|2165456_2165999_-	HutD family protein	NA	NA	NA	NA	NA
WP_004210729.1|2166246_2167626_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|2167670_2168480_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2168481_2169474_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2169473_2170364_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_060591370.1|2170510_2171728_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.4	3.6e-119
WP_071836884.1|2171948_2172188_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	8.8e-22
WP_039110565.1|2172228_2173338_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.2	1.1e-183
WP_039110567.1|2173350_2176389_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	57.0	3.0e-292
WP_012967861.1|2176526_2176682_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_004179600.1|2176690_2176882_-	YebW family protein	NA	NA	NA	NA	NA
WP_022631177.1|2177178_2177487_-	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
WP_136085610.1|2178879_2178978_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_039110572.1|2178995_2179391_-	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	1.4e-48
WP_029503646.1|2179495_2179729_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_023287506.1|2179731_2180268_+	bacteriophage regulatory protein CII	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
WP_020804480.1|2180355_2180544_+	ClpX C4-type zinc finger	NA	NA	NA	NA	NA
WP_023286278.1|2180558_2181467_+	hypothetical protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_032417026.1|2181469_2182219_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_032417027.1|2182226_2182562_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	1.3e-10
WP_039110576.1|2182554_2183340_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	4.8e-64
WP_020804603.1|2183336_2183540_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_020804604.1|2183532_2183787_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_020804600.1|2183783_2184005_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
WP_020804596.1|2184008_2184437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413665.1|2184532_2184832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|2185582_2185816_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_020804595.1|2186194_2186791_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	2.2e-90
WP_020804598.1|2186999_2187296_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_020804605.1|2187292_2187649_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	3.3e-41
WP_039110580.1|2187764_2188586_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.1	9.0e-98
WP_020805457.1|2188920_2189178_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	96.5	5.4e-41
WP_001531258.1|2189339_2190122_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_032441952.1|2190118_2191141_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
WP_031281240.1|2192103_2192403_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_023301209.1|2192399_2192939_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
WP_039110584.1|2192935_2193283_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	69.6	1.6e-35
WP_023313108.1|2193279_2193555_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.8	4.7e-11
WP_004218558.1|2194513_2194759_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_008807832.1|2195621_2196614_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	35.3	1.3e-29
WP_004190663.1|2196591_2197899_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_008807834.1|2197898_2199299_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
WP_039110586.1|2199282_2200395_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.1	2.5e-111
WP_004227000.1|2200635_2200812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032423789.1|2200925_2201711_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.7e-66
WP_004190653.1|2201721_2202675_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_129321712.1|2202683_2202956_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_023300922.1|2202996_2203392_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_004190649.1|2203393_2203648_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_040246471.1|2203657_2203891_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	4.4e-10
WP_004217344.1|2203877_2204261_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_039110587.1|2204262_2204814_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	2.3e-28
WP_004190640.1|2204810_2205203_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_031591823.1|2205226_2206399_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_008807841.1|2206452_2206935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807842.1|2207072_2207279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|2207355_2207712_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_032416607.1|2207822_2208191_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	3.3e-15
WP_039110591.1|2208264_2211147_+|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	1.7e-98
2208376:2208391	attR	GCTGCCACCAGCGCAG	NA	NA	NA	NA
WP_039110593.1|2211146_2211611_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	1.5e-57
WP_039110595.1|2211791_2212274_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.6	4.1e-82
WP_004152651.1|2212283_2212664_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_039110596.1|2212660_2215729_+	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
WP_087831371.1|2215823_2218958_+	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	32.3	1.7e-104
>prophage 3
NZ_CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	2495704	2506591	5394870		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2495704_2496325_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004224682.1|2496317_2497583_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002903955.1|2497594_2498497_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|2498757_2499519_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2499539_2500400_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|2500697_2500958_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|2501044_2502133_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_060591377.1|2502163_2503429_-	MFS transporter	NA	NA	NA	NA	NA
WP_032433071.1|2503483_2506591_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 4
NZ_CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	3372218	3417151	5394870	integrase,holin,lysis,portal,protease,tail,terminase,head,capsid,transposase	Enterobacteria_phage(28.21%)	50	3376509:3376526	3426699:3426716
WP_039817873.1|3372218_3373979_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	83.3	6.7e-50
WP_039817875.1|3374056_3377134_-	kinase	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
3376509:3376526	attL	GCCACATTATCGCCGGGC	NA	NA	NA	NA
WP_039817877.1|3377130_3377511_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	3.6e-57
WP_004864228.1|3377523_3378000_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177132.1|3377986_3378460_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_039817884.1|3378480_3381870_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	1.5e-303
WP_039817888.1|3381930_3382164_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	45.8	3.2e-08
WP_039817891.1|3382297_3383797_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_039817893.1|3383793_3384549_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.9e-34
WP_039817895.1|3384653_3384959_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	8.1e-28
WP_039817897.1|3384961_3385366_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	1.7e-33
WP_039817900.1|3385396_3386101_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	7.2e-80
WP_039817902.1|3386157_3386505_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.1	4.0e-31
WP_039817904.1|3386501_3386951_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	1.9e-62
WP_004884319.1|3386947_3387286_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	6.4e-42
WP_039817908.1|3387297_3387624_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	68.5	1.2e-40
WP_004886697.1|3387962_3389180_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.4	3.9e-182
WP_039817990.1|3389189_3390038_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	1.0e-128
WP_039817913.1|3390050_3391358_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.4	4.3e-211
WP_039817916.1|3391357_3393100_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.6	2.0e-139
WP_039817917.1|3393053_3393518_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.8	6.3e-48
WP_039817918.1|3393700_3394042_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
WP_039817920.1|3394097_3394343_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	65.4	1.2e-18
WP_039817921.1|3394542_3394938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039817923.1|3395727_3396066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039817926.1|3396140_3396605_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	62.9	1.6e-43
WP_039817927.1|3396601_3397132_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	80.0	3.2e-80
WP_004151282.1|3397134_3397383_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_039817933.1|3398090_3398669_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_039817935.1|3398682_3399663_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	6.4e-135
WP_039817937.1|3399675_3400053_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.2	6.7e-48
WP_039817939.1|3400062_3400872_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	3.5e-110
WP_039817942.1|3400868_3401783_-	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	59.6	3.1e-30
WP_071557781.1|3401739_3401952_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_039817948.1|3402189_3402651_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	6.4e-69
WP_001191665.1|3402685_3402928_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_023317570.1|3403025_3403721_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
WP_039817950.1|3404434_3405352_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.5	1.5e-45
WP_039817952.1|3405441_3405741_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	7.2e-13
WP_039817954.1|3405740_3406526_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.1e-60
WP_023317564.1|3406653_3406809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184757.1|3407995_3408223_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_023317562.1|3408224_3409217_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	86.9	1.1e-174
WP_004227143.1|3409509_3410310_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_020477091.1|3410895_3411591_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004212965.1|3411891_3412128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023286672.1|3412326_3413268_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004180456.1|3413346_3414297_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_002911729.1|3414403_3415321_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000059620.1|3415888_3417151_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	1.1e-73
3426699:3426716	attR	GCCCGGCGATAATGTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	3529431	3542748	5394870	transposase	Escherichia_phage(22.22%)	12	NA	NA
WP_039819511.1|3529431_3530436_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_004144151.1|3530835_3530958_+	small membrane protein	NA	NA	NA	NA	NA
WP_077255456.1|3531649_3531754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039819538.1|3531968_3532976_-	acyltransferase	NA	NA	NA	NA	NA
WP_039819510.1|3533368_3534535_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_039819508.1|3534714_3535269_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_004175259.1|3535283_3536174_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819507.1|3536205_3537075_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
WP_039819536.1|3537088_3538153_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_039819506.1|3538307_3539678_-	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_004180506.1|3539699_3541115_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_000043543.1|3541341_3542748_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 6
NZ_CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	3586091	3592996	5394870	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|3586091_3587570_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|3587566_3588289_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_039819857.1|3588607_3589969_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	1.1e-206
WP_004151134.1|3590211_3591108_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_039819854.1|3591348_3592122_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
WP_004180551.1|3592132_3592996_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 7
NZ_CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	3985621	4073595	5394870	holin,portal,terminase,tRNA,tail,transposase	Klebsiella_phage(23.91%)	83	NA	NA
WP_004149335.1|3985621_3986896_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913892.1|3986987_3988109_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_004149336.1|3988135_3989131_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_002913894.1|3989407_3990574_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_004144312.1|3991057_3991489_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
WP_023278780.1|3991649_3993974_-	peptidoglycan glycosyltransferase PbpC	NA	NA	NA	NA	NA
WP_032433426.1|3993974_3998924_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_002913950.1|3999129_3999987_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_004180898.1|4000213_4001056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002913952.1|4001126_4001903_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_004185110.1|4002002_4003289_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
WP_002913954.1|4003359_4003560_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002913956.1|4003561_4003897_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004149343.1|4003898_4005749_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
WP_004174835.1|4005764_4006280_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002913979.1|4006354_4006678_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_032433428.1|4006695_4007082_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_032433430.1|4007108_4008323_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	4.2e-35
WP_002913993.1|4008501_4008993_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_002913994.1|4009227_4009962_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_002913995.1|4010082_4010886_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_021440564.1|4010932_4011769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004185122.1|4011868_4012849_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_004151988.1|4012839_4013478_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_002914002.1|4013602_4014880_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_004144329.1|4014876_4016013_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_002914015.1|4016095_4016929_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_032433432.1|4016928_4018365_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_032433434.1|4018434_4021710_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_004174823.1|4021822_4023019_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197379.1|4023092_4023515_+	DoxX family protein	NA	NA	NA	NA	NA
WP_002914027.1|4023570_4024824_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
WP_023313485.1|4025149_4026340_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|4026414_4026753_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_004149357.1|4026818_4028156_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_002914033.1|4028142_4028829_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002914044.1|4028858_4030280_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_032433436.1|4030870_4034758_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_032433438.1|4034933_4036550_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_004890375.1|4036546_4037089_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_002914050.1|4037118_4037754_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004144349.1|4037967_4038816_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_123677158.1|4039249_4040491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060591401.1|4040501_4040705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060591404.1|4040742_4040946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060591409.1|4043455_4046524_-	kinase	NA	A0A286S259	Klebsiella_phage	65.7	0.0e+00
WP_048291625.1|4046520_4046907_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
WP_038433285.1|4046914_4047397_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
WP_071839934.1|4047383_4047857_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.8	6.6e-53
WP_060591412.1|4047856_4050553_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.1	3.0e-198
WP_040190022.1|4050533_4050851_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_025714420.1|4050871_4051267_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
WP_023304948.1|4051309_4051792_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_020804325.1|4051799_4052198_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_048291628.1|4052194_4052746_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
WP_060591414.1|4052735_4053029_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014228572.1|4053021_4053348_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	1.4e-33
WP_000608644.1|4055460_4056723_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_157948105.1|4056904_4057105_-	hypothetical protein	NA	K7PKX4	Enterobacterial_phage	78.5	2.3e-23
WP_060591419.1|4057049_4058549_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.2	1.2e-246
WP_020317294.1|4058545_4058761_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_060591422.1|4058757_4060866_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.0	0.0e+00
WP_014228567.1|4060865_4061357_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_048985257.1|4061674_4061920_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	58.0	8.8e-17
WP_048985255.1|4061990_4062290_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_060591425.1|4062370_4062562_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	94.6	2.6e-24
WP_060591427.1|4062512_4062788_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	91.0	2.4e-07
WP_040241913.1|4062784_4063129_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	1.8e-39
WP_004884314.1|4063125_4063665_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	6.7e-102
WP_060591429.1|4063667_4064015_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	71.0	1.5e-38
WP_060591432.1|4064159_4065212_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	80.1	7.8e-171
WP_060591433.1|4065362_4065554_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	87.3	5.8e-24
WP_060591437.1|4065732_4066137_-	antitermination protein	NA	S5M7R9	Escherichia_phage	53.2	1.6e-31
WP_060591454.1|4066126_4066771_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.2	3.4e-84
WP_172426593.1|4066767_4067385_-	recombination protein NinG	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_029498819.1|4067381_4068353_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	60.7	7.8e-109
WP_060591468.1|4068349_4069879_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	6.6e-203
WP_004104272.1|4069871_4070147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333906.1|4070629_4071160_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	61.8	7.9e-55
WP_048333908.1|4071188_4071449_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	42.0	1.2e-08
WP_048333964.1|4071554_4072259_+	helix-turn-helix domain-containing protein	NA	G8C7U1	Escherichia_phage	60.1	3.7e-68
WP_048333909.1|4072316_4073351_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	43.2	3.9e-74
WP_048333910.1|4073388_4073595_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	56.7	5.1e-10
>prophage 8
NZ_CP024429	Klebsiella pneumoniae strain DA48896 chromosome, complete genome	5394870	4651633	4691607	5394870	integrase,holin,lysis,head,portal,plate,terminase,tRNA,tail,capsid	Erwinia_phage(24.44%)	50	4661125:4661140	4692144:4692159
WP_002916879.1|4651633_4652647_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|4652884_4653100_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002917631.1|4653211_4654957_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|4655175_4657017_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|4657116_4657623_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_023343301.1|4657981_4658200_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_032433542.1|4658293_4658701_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	1.2e-26
WP_032433545.1|4658741_4659902_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.6	8.3e-174
WP_023343304.1|4659901_4660381_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	80.9	1.3e-69
WP_032433547.1|4660397_4662836_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	2.1e-299
4661125:4661140	attL	GCAATGATGGCATTTA	NA	NA	NA	NA
WP_014343413.1|4662828_4662948_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_004195711.1|4662980_4663256_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_032433549.1|4663316_4663832_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	1.2e-68
WP_019724797.1|4663845_4665027_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
WP_032433550.1|4665136_4666216_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.3	4.7e-30
WP_032433551.1|4666227_4666956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125116968.1|4666961_4669292_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.8	7.2e-108
WP_076026137.1|4669227_4669815_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	56.8	4.1e-52
WP_032433553.1|4669822_4670731_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
WP_014343405.1|4670735_4671083_-	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_015959011.1|4671079_4671721_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
WP_045326985.1|4672063_4673107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032433555.1|4673435_4673885_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.7e-48
WP_032433558.1|4673877_4674345_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	9.1e-63
WP_032427129.1|4674307_4674466_-	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	74.0	3.8e-13
WP_032433560.1|4674440_4674872_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	1.1e-41
WP_032433563.1|4674868_4675366_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	84.8	4.8e-78
WP_032433564.1|4675352_4675643_-|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
WP_019725382.1|4675647_4675851_-|tail	tail protein X	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_009309691.1|4675850_4676357_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_072196895.1|4676453_4677173_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	78.2	3.1e-94
WP_025710540.1|4677200_4678259_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
WP_032433566.1|4678332_4679187_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	9.6e-127
WP_009309687.1|4679352_4681122_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
WP_032433567.1|4681121_4682165_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
WP_032433569.1|4682677_4682872_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	4.7e-13
WP_032433571.1|4682870_4683302_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	93.7	2.9e-71
WP_032433573.1|4683440_4684391_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	8.7e-36
WP_071557792.1|4684368_4684677_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.1	2.4e-11
WP_162897204.1|4684713_4684869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048292468.1|4685297_4685738_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	3.4e-67
WP_072198081.1|4685856_4687926_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.4	0.0e+00
WP_032433578.1|4688074_4688296_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	5.5e-34
WP_032433580.1|4688295_4688523_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.9e-30
WP_032433585.1|4688590_4688929_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_023343330.1|4688892_4689093_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	8.1e-29
WP_039818858.1|4689100_4689610_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	8.9e-88
WP_001630878.1|4689640_4689904_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_032433588.1|4690033_4690609_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
WP_032433590.1|4690608_4691607_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	4.5e-192
4692144:4692159	attR	TAAATGCCATCATTGC	NA	NA	NA	NA
>prophage 1
NZ_CP024430	Klebsiella pneumoniae strain DA48896 plasmid p48896_1, complete sequence	131243	2663	66870	131243	protease,integrase,transposase	Escherichia_phage(44.44%)	57	17523:17582	64215:65037
WP_001067855.1|2663_3368_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|3824_4382_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|4564_5425_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000480968.1|6145_6982_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|6981_7785_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|7845_8661_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|8990_9167_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|9348_10353_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|13042_13879_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|13878_14682_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_051120014.1|14646_15264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000134999.1|15504_16146_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
17523:17582	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|17574_18279_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_053897648.1|18303_19860_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
WP_000227969.1|20457_21534_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015063455.1|22915_23332_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261276.1|23328_23559_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000493378.1|24132_24483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|24533_25277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|25273_26050_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|26107_26365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|26493_26598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|27132_27999_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|28175_28445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|28859_30065_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000064120.1|30064_31039_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|31120_32392_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|32391_32823_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_023300763.1|33228_34716_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
WP_001067858.1|39438_40143_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000239590.1|40851_41727_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|41773_42106_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_042651131.1|44939_45200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012600012.1|45423_45603_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	60.3	6.8e-11
WP_011977766.1|47516_47852_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|48024_48306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|48359_48971_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_011977825.1|48967_49129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145103.1|49155_50148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000075580.1|50196_50352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|50492_51197_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072094655.1|51545_52949_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|52982_54197_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|54457_55222_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|55364_55631_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_022631163.1|56499_57753_+	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	29.7	3.0e-12
WP_001206356.1|57828_58620_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|58625_58916_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|59027_59525_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001067855.1|60166_60871_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|60950_61451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|61600_62242_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|62385_63090_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|63517_64222_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|65532_65934_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
64215:65037	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCAAAAATAGTCCTTCAGTGGGACGAAATGATCCGGACCGCTGGCTCCCTGAAGCTGGGCAAAGTACAGGCTTCAGTGCTGGTCCGTTCATTGCTGAAAAGTGAACGTCCTTCCGGACTGACTCAGGCAATCATTGAAGTGGGGCGCATCAACAAAACGCTGTATCTGCTTAATTATATTGATGATGAAGATTACCGCCGGCGCATTCTGACCCAGCTTAATCGGGGAGAAAGTCGCCATGCCGTTGCCAGAGCCATCTGTCACGGTCAAAAAGGTGAGATAAGAAAACGATATACCGACGGTCAGGAAGATCAACTGGGCGCACTGGGGCTGGTCACTAACGCCGTCGTGTTATGGAACACTATTTATATGCAGGCAGCCCTGGATCATCTCCGGGCGCAGGGTGAAACACTGAATGATGAAGATATCGCACGCCTCTCCCCGCTTTGCCACGGACATATCAATATGCTCGGCCATTATTCCTTCACGCTGGCAGAACTGGTGACCAAAGGACATCTGAGACCATTAAAAGAGGCGTCAGAGGCAGAAAACGTTGCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAAT	NA	NA	NA	NA
WP_000557619.1|65866_66124_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|66216_66870_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP024431	Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence	114815	3853	52495	114815	integrase,transposase	Stx2-converting_phage(26.32%)	57	8664:8680	30152:30168
WP_015632444.1|3853_5443_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.1	1.9e-189
WP_032495749.1|5483_5822_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.8	7.6e-27
WP_015632445.1|5818_6226_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_016162081.1|6301_6559_+	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	41.5	1.2e-05
WP_016162080.1|6570_6822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632446.1|6862_8791_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
8664:8680	attL	CGCCGGAAACGCTGGTC	NA	NA	NA	NA
WP_016162079.1|8793_9105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632448.1|9500_9833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632449.1|10103_10424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162076.1|10477_10711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632450.1|11402_11840_-	antirestriction protein	NA	NA	NA	NA	NA
WP_015632451.1|12009_12870_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.6	2.8e-17
WP_032441934.1|12943_13123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162075.1|13266_13626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632453.1|14219_14657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632454.1|14784_15273_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015632455.1|15269_15728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632456.1|15880_16309_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_015632457.1|16301_17282_-	partitioning protein	NA	A0A0A7NPX4	Enterobacteria_phage	49.4	2.3e-76
WP_015632458.1|17642_17825_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	48.3	2.0e-05
WP_015632459.1|17850_18294_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	33.8	4.6e-16
WP_016162072.1|18635_18863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162071.1|19292_19550_+	helix-turn-helix transcriptional regulator	NA	H2DE32	Erwinia_phage	56.4	5.1e-07
WP_015632462.1|19753_20320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632463.1|20361_20706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632464.1|20850_21156_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_015632465.1|21155_21374_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_015632466.1|21559_22585_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015632467.1|23528_23960_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
WP_016162068.1|23959_25231_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	2.6e-152
WP_004098982.1|25642_26518_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197649.1|27150_27777_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_006788217.1|27896_28076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632375.1|28523_29318_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_032495756.1|29310_29472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162067.1|29515_30520_-	hypothetical protein	NA	NA	NA	NA	NA
30152:30168	attR	GACCAGCGTTTCCGGCG	NA	NA	NA	NA
WP_024191724.1|30584_30896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632378.1|30944_31259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162066.1|31814_32384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568023.1|32524_33553_+	Abi family protein	NA	NA	NA	NA	NA
WP_001568022.1|33697_36502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162847634.1|36910_37060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839879.1|37086_38679_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
WP_004189161.1|38709_39060_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_015632382.1|39056_39497_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_001531258.1|40177_40960_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_032441952.1|40956_41979_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
WP_001568019.1|43008_44736_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001568018.1|45181_45430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632385.1|45426_45999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568016.1|46029_46524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568014.1|46756_47065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|47558_48107_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|48153_48588_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001567368.1|48858_50262_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_060591614.1|50290_50923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253394.1|51148_52495_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP024433	Klebsiella pneumoniae strain DA48896 plasmid p48896_4, complete sequence	55118	5471	47460	55118	head,tail,capsid,terminase,portal	Klebsiella_phage(81.25%)	51	NA	NA
WP_065519969.1|5471_6932_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	52.9	2.7e-97
WP_048993688.1|7011_7977_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.6	1.5e-155
WP_023339381.1|7979_9143_-	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
WP_039814609.1|9850_11764_+	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.4	0.0e+00
WP_039814612.1|11818_12619_-	hypothetical protein	NA	O64341	Escherichia_phage	78.1	3.2e-116
WP_039814615.1|12615_12846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161956551.1|12842_13181_-	host cell division inhibitor Icd-like protein	NA	Q77WP0	Escherichia_phage	79.5	1.7e-26
WP_072040876.1|13585_14011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077256350.1|14149_15142_-	hypothetical protein	NA	A0A2H5BFZ4	Vibrio_phage	40.8	1.4e-23
WP_039814626.1|15476_15827_-	hypothetical protein	NA	O64343	Escherichia_phage	77.6	5.1e-50
WP_039814628.1|15823_16120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106418127.1|16112_20117_-	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
WP_048292304.1|20367_20976_-	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.6	1.3e-104
WP_032408972.1|21056_21266_+	Cro/Cl family transcriptional regulator	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
WP_032408971.1|21255_21993_+	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
WP_048292305.1|22404_23013_+	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.5	3.0e-98
WP_023339397.1|23613_23859_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
WP_048292306.1|23851_24178_+	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	1.1e-51
WP_023339395.1|24198_24426_+	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
WP_023339393.1|24777_25065_-	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
WP_023339392.1|25064_25373_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_023339391.1|25543_25765_+	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
WP_032408967.1|25776_26004_+	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
WP_048292307.1|26321_27383_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	92.9	1.0e-170
WP_023339388.1|27441_27753_+	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
WP_048292308.1|27749_28241_+	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	4.1e-82
WP_040118545.1|28257_28734_+	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
WP_117037470.1|28681_28876_+	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	89.5	1.5e-19
WP_032408961.1|28987_29287_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
WP_053090680.1|29456_30518_+	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	38.3	8.8e-37
WP_072072213.1|30501_30864_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	94.2	2.4e-63
WP_032408958.1|30860_31145_+	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	3.1e-05
WP_077256079.1|31141_31573_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	7.6e-40
WP_032408957.1|31989_32424_+|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
WP_032408956.1|32458_34168_+|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
WP_064168720.1|34340_35600_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	3.1e-222
WP_087749692.1|35636_36557_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.6	3.6e-148
WP_087749693.1|36634_37921_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	86.0	1.8e-206
WP_087749694.1|37980_38268_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	2.5e-18
WP_023339902.1|38248_38566_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	5.8e-45
WP_087749695.1|38562_38901_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_017880258.1|38881_39271_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_017898997.1|39267_39669_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014228913.1|39700_40162_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|40219_40585_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_106418128.1|40817_44174_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.3	0.0e+00
WP_017898999.1|44173_44512_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
WP_020803197.1|44508_45264_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
WP_039814703.1|45265_45976_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
WP_052285794.1|46022_46850_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	44.0	1.3e-08
WP_032447254.1|46866_47460_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
