The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021286	Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) chromosome, complete genome	3508676	217217	270139	3508676	integrase,transposase,protease	Pseudomonas_phage(66.67%)	43	226942:226958	234627:234643
WP_011212825.1|217217_218426_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	47.8	7.5e-93
WP_011212826.1|218652_219477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212827.1|219463_220426_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_011212828.1|220756_222697_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	34.9	1.8e-56
WP_011212829.1|222693_225192_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011212831.1|226042_226909_+|transposase	transposase	transposase	NA	NA	NA	NA
226942:226958	attL	CTTTGTTGGGGTAGAGC	NA	NA	NA	NA
WP_011212832.1|227099_230285_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011212833.1|230512_231379_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025519216.1|231383_231947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212835.1|232273_232654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080019877.1|232732_233263_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	47.3	2.9e-33
WP_011212836.1|233671_234538_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011212837.1|234829_235933_+	nucleoside hydrolase	NA	NA	NA	NA	NA
234627:234643	attR	CTTTGTTGGGGTAGAGC	NA	NA	NA	NA
WP_011212842.1|240772_241288_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_162470335.1|241612_241783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212844.1|242177_242492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212845.1|242786_244223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212846.1|244483_245230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212847.1|245577_246456_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_011212848.1|246485_247568_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011212849.1|247682_248444_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_010945919.1|248424_248637_-	ParD-like family protein	NA	NA	NA	NA	NA
WP_011212850.1|248813_249293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212851.1|249528_250506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212852.1|250634_251054_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_011212853.1|251478_252252_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011212854.1|252333_252789_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_011212856.1|254106_254517_-	peptide chain release factor-like protein	NA	NA	NA	NA	NA
WP_011212857.1|254617_255343_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_011212858.1|255339_256026_-	MCE family protein	NA	NA	NA	NA	NA
WP_011212859.1|256093_256849_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011212860.1|257114_257681_-	F-box protein	NA	NA	NA	NA	NA
WP_080019879.1|257870_258596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212862.1|258725_259586_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011212863.1|259696_260746_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_011212864.1|260735_261572_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_011212865.1|261568_263011_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_011212866.1|263007_264156_+	MFS transporter	NA	NA	NA	NA	NA
WP_011212867.1|264152_265385_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_011212868.1|265542_266685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025519229.1|267224_268199_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011212870.1|268303_269122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212871.1|269296_270139_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 2
NZ_CP021286	Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) chromosome, complete genome	3508676	1003512	1010352	3508676		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|1003512_1004289_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|1004281_1005316_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|1005293_1005872_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|1005905_1006631_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|1006627_1007137_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|1007117_1007687_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|1007683_1008211_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|1008224_1009187_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|1009554_1010352_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 3
NZ_CP021286	Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) chromosome, complete genome	3508676	1268434	1274371	3508676		Staphylococcus_phage(50.0%)	6	NA	NA
WP_038838075.1|1268434_1269508_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.5	2.3e-29
WP_027265743.1|1269492_1270107_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	6.0e-22
WP_011215282.1|1270103_1271312_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	3.1e-99
WP_010946914.1|1271319_1271787_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1271912_1273550_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_027265741.1|1273546_1274371_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	3.0e-53
>prophage 4
NZ_CP021286	Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) chromosome, complete genome	3508676	1997191	2068894	3508676	tRNA,transposase,protease,integrase	Tupanvirus(10.0%)	57	2002634:2002693	2052343:2052405
WP_010947570.1|1997191_1997629_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_010947571.1|1997846_1998629_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011214098.1|1998737_1999697_-	glutathione synthase	NA	NA	NA	NA	NA
WP_011214099.1|1999696_2000992_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_010946556.1|2001150_2001444_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_010946555.1|2001469_2002555_-|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
2002634:2002693	attL	CACTGGATTGCTTCGTCGCTACGCTCCTCGCAACGACGGTCCCAAAAATCGTACCGTACA	NA	NA	NA	NA
WP_011214101.1|2003007_2003904_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011214102.1|2003907_2004189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021437159.1|2004175_2004526_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_011214104.1|2004559_2005222_-	Dot/Icm T4SS effector Lem14	NA	NA	NA	NA	NA
WP_011214105.1|2005591_2007229_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_014841922.1|2007281_2007920_+	uridine kinase	NA	A0A2K9L178	Tupanvirus	36.7	1.7e-27
WP_027229338.1|2008033_2008822_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_080454273.1|2009273_2012114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214109.1|2012620_2013247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214110.1|2013529_2016664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214111.1|2017236_2019111_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011214112.1|2019368_2019647_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	49.4	2.5e-15
WP_010947583.1|2019775_2022226_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.2	5.1e-213
WP_172407122.1|2022459_2023740_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.2	1.9e-134
WP_010947585.1|2023874_2024519_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.5	1.2e-57
WP_010947586.1|2024521_2025853_-	trigger factor	NA	NA	NA	NA	NA
WP_011214115.1|2026723_2027950_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011214117.1|2029949_2030624_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	33.8	7.5e-26
WP_011214118.1|2030613_2031006_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011214119.1|2031017_2031773_-	signal peptidase I	NA	NA	NA	NA	NA
WP_010947592.1|2031880_2033713_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	2.8e-22
WP_011214120.1|2033907_2034924_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011214121.1|2034998_2036138_+	GspL family type II secretion system protein LspL	NA	NA	NA	NA	NA
WP_011214122.1|2036134_2036605_+	GspM family type II secretion system protein LspM	NA	NA	NA	NA	NA
WP_011214123.1|2036708_2037242_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011214124.1|2037516_2038842_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_011214126.1|2043213_2044746_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_014844192.1|2044766_2045831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214128.1|2045922_2046363_-	VOC family protein	NA	NA	NA	NA	NA
WP_010947600.1|2046596_2047124_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.8	1.7e-20
WP_011214129.1|2047360_2048578_+	Dot/Icm T4SS effector LegC2/YlfB	NA	NA	NA	NA	NA
WP_011214130.1|2048899_2049214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214131.1|2049378_2050488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214132.1|2050918_2052004_+|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
WP_010946556.1|2052029_2052323_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011214133.1|2052500_2052776_-	acylphosphatase	NA	NA	NA	NA	NA
2052343:2052405	attR	CACTGGATTGCTTCGTCGCTACGCTCCTCGCAACGACGGTCCCAAAAATCGTACCGTACAGAG	NA	NA	NA	NA
WP_011214134.1|2052932_2053286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214135.1|2053467_2054799_-	Lpg1888 family Dot/Icm type IV secretion system effector	NA	NA	NA	NA	NA
WP_011214136.1|2055027_2055993_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	46.6	1.9e-78
WP_080020008.1|2056056_2057778_-	Dot/Icm T4SS effector LegLC8	NA	NA	NA	NA	NA
WP_013101554.1|2057889_2058156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214139.1|2058209_2058629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214140.1|2058638_2059919_-	MFS transporter	NA	NA	NA	NA	NA
WP_011214141.1|2060395_2061676_+	chloride channel protein	NA	NA	NA	NA	NA
WP_021437098.1|2061874_2062090_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011214143.1|2062258_2063365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214144.1|2063566_2064070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214145.1|2064333_2064813_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011214146.1|2064832_2066638_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011214148.1|2068214_2068550_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_021437102.1|2068573_2068894_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	39.1	3.0e-09
>prophage 5
NZ_CP021286	Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) chromosome, complete genome	3508676	2216348	2226471	3508676		Bacillus_phage(16.67%)	7	NA	NA
WP_011214266.1|2216348_2218037_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_011214267.1|2218168_2219176_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011214268.1|2219299_2220625_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.8e-47
WP_011214269.1|2220643_2221792_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	7.6e-127
WP_011214270.1|2222000_2223113_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	1.7e-51
WP_010947740.1|2223208_2224348_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_011214271.1|2224536_2226471_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.4	3.8e-147
>prophage 6
NZ_CP021286	Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) chromosome, complete genome	3508676	2269877	2336243	3508676	transposase	Vibrio_phage(20.0%)	58	NA	NA
WP_010947782.1|2269877_2271329_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2271399_2272920_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2273767_2274142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2274339_2275947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2275949_2276441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2276451_2277288_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2277880_2278972_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2279203_2285149_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2285169_2287062_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2287126_2287591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2287594_2290315_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2290320_2291706_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2291702_2292125_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2292114_2292897_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_015444243.1|2294699_2295368_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2295383_2296379_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2296375_2296984_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2296980_2297316_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2297308_2299861_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2299872_2300223_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2300236_2301523_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2301524_2302238_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2302240_2302804_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2302807_2303101_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2303102_2303405_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2303419_2303656_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2303669_2304047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2303994_2304879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2305051_2305732_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2305880_2306555_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2307003_2307576_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2307559_2308057_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2308049_2308637_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947815.1|2310794_2311676_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2311782_2311929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2312120_2312297_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2312466_2312964_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2312953_2313733_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2313725_2314580_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2314594_2314888_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2315077_2315599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2315903_2316362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2316935_2317163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2317320_2317842_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_059431417.1|2318013_2318568_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2319001_2319202_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2319295_2319679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2319732_2320686_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_011213396.1|2321240_2322416_-|transposase	ISL3-like element ISLpn11 family transposase	transposase	A9YX10	Burkholderia_phage	22.9	3.2e-16
WP_015961262.1|2324557_2324869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947832.1|2325607_2325817_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	63.9	8.3e-16
WP_015961263.1|2326056_2327463_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.1	2.4e-58
WP_015961264.1|2327619_2328531_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_011946955.1|2328802_2329204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015961265.1|2329219_2330302_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_015961266.1|2330335_2331085_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	43.8	1.5e-19
WP_015961268.1|2331826_2333779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021437119.1|2335979_2336243_-|transposase	transposase	transposase	NA	NA	NA	NA
