The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021281	Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) chromosome, complete genome	3588028	217082	270004	3588028	transposase,integrase,protease	Pseudomonas_phage(66.67%)	45	226807:226823	234492:234508
WP_011212825.1|217082_218291_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	47.8	7.5e-93
WP_011212826.1|218517_219342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212827.1|219328_220291_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_011212828.1|220621_222562_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	34.9	1.8e-56
WP_011212829.1|222558_225057_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011212831.1|225907_226774_+|transposase	transposase	transposase	NA	NA	NA	NA
226807:226823	attL	CTTTGTTGGGGTAGAGC	NA	NA	NA	NA
WP_161538216.1|226964_230150_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011212833.1|230377_231244_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025519216.1|231248_231812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212835.1|232138_232519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080019877.1|232597_233128_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	47.3	2.9e-33
WP_011212836.1|233536_234403_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011212837.1|234694_235798_+	nucleoside hydrolase	NA	NA	NA	NA	NA
234492:234508	attR	CTTTGTTGGGGTAGAGC	NA	NA	NA	NA
WP_129461912.1|240013_240265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212842.1|240637_241153_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_192876287.1|241473_241647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212844.1|242041_242356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212845.1|242650_244087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212846.1|244347_245094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212847.1|245441_246320_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_011212848.1|246349_247432_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011212849.1|247546_248308_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_010945919.1|248288_248501_-	ParD-like family protein	NA	NA	NA	NA	NA
WP_011212850.1|248677_249157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212851.1|249392_250370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212852.1|250498_250918_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_011212853.1|251342_252116_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011212854.1|252197_252653_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_011212855.1|252820_253705_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011212856.1|253971_254382_-	peptide chain release factor-like protein	NA	NA	NA	NA	NA
WP_011212857.1|254482_255208_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_011212858.1|255204_255891_-	MCE family protein	NA	NA	NA	NA	NA
WP_011212859.1|255958_256714_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011212860.1|256979_257546_-	F-box protein	NA	NA	NA	NA	NA
WP_080019879.1|257735_258461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212862.1|258590_259451_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011212863.1|259561_260611_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_011212864.1|260600_261437_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_011212865.1|261433_262876_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_011212866.1|262872_264021_+	MFS transporter	NA	NA	NA	NA	NA
WP_011212867.1|264017_265250_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_011212868.1|265407_266550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025519229.1|267089_268064_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011212870.1|268168_268987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011212871.1|269161_270004_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 2
NZ_CP021281	Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) chromosome, complete genome	3588028	782852	853853	3588028	tRNA,transposase,holin	uncultured_virus(14.29%)	56	NA	NA
WP_010946555.1|782852_783938_+|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
WP_010946556.1|783963_784257_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_042233480.1|784282_785428_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011213249.1|785436_786876_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011213250.1|787200_788982_-	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	35.8	3.0e-13
WP_011213251.1|789023_789677_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011213252.1|789890_790355_-	DoxX family protein	NA	NA	NA	NA	NA
WP_011213253.1|790351_791131_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_011213254.1|791123_791993_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_011213255.1|791998_792253_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_011213256.1|792589_793615_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011213257.1|793730_795947_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011213258.1|795988_796753_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_011213259.1|796789_797062_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_011213260.1|797054_798368_+	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	27.7	5.6e-17
WP_011213261.1|798387_799203_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_011213262.1|799195_800023_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010946414.1|800320_800587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213263.1|800841_801594_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011213264.1|801731_804473_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_025519356.1|804737_805949_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011213266.1|806016_806589_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011213267.1|806581_807508_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.6e-18
WP_025519358.1|807522_808641_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011213269.1|808710_810030_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_010946424.1|812064_812355_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	48.9	1.5e-18
WP_011213271.1|812382_814029_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.1	4.1e-174
WP_011213272.1|814151_814592_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_011213273.1|814848_816966_+	fused MFS/spermidine synthase	NA	NA	NA	NA	NA
WP_011213274.1|817299_819180_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.2	6.0e-97
WP_011213275.1|819313_821122_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.8e-13
WP_011213276.1|821210_825494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213277.1|825851_827561_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	30.1	6.6e-10
WP_080019926.1|827722_830572_+	Dot/Icm T4SS effector AnkX	NA	A0A2L2DMI5	Acanthamoeba_polyphaga_mimivirus	22.7	1.6e-08
WP_080019927.1|830578_832291_-|holin	T4SS effector phosphocholine hydrolase Lem3	holin	NA	NA	NA	NA
WP_010946434.1|832377_834684_-	bifunctional SulP family inorganic anion transporter/carbonic anhydrase	NA	NA	NA	NA	NA
WP_011213280.1|834873_835725_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	53.9	8.8e-72
WP_010946436.1|835742_837110_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011213281.1|837121_837772_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011213282.1|837952_839137_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	1.0e-41
WP_011213283.1|839223_840246_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	62.7	3.8e-13
WP_011213284.1|840288_841962_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	28.9	1.1e-44
WP_010946441.1|842003_842615_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011213285.1|842724_843162_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_011213286.1|843161_843587_+	transporter	NA	NA	NA	NA	NA
WP_011213287.1|843626_844799_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011213288.1|844855_845830_-	DotI/IcmL/TraM family protein	NA	NA	NA	NA	NA
WP_011213289.1|845842_846802_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_014841157.1|847091_847901_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011213291.1|847900_849112_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_011213292.1|849138_849834_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_011213293.1|849833_851834_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_021437009.1|852218_852527_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_104411335.1|852616_853346_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.8	1.5e-24
WP_021437011.1|853322_853565_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_129316974.1|853580_853853_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP021281	Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) chromosome, complete genome	3588028	995390	1002230	3588028		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|995390_996167_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|996159_997194_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|997171_997750_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|997783_998509_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|998505_999015_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|998995_999565_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|999561_1000089_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|1000102_1001065_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|1001432_1002230_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 4
NZ_CP021281	Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) chromosome, complete genome	3588028	1260588	1266525	3588028		Staphylococcus_phage(50.0%)	6	NA	NA
WP_011213534.1|1260588_1261662_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	9.5e-31
WP_011213535.1|1261646_1262261_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	4.6e-22
WP_011213536.1|1262257_1263466_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.0	1.0e-97
WP_010946914.1|1263473_1263941_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1264066_1265704_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1265700_1266525_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 5
NZ_CP021281	Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) chromosome, complete genome	3588028	1989360	2061064	3588028	tRNA,transposase,integrase,protease	Tupanvirus(18.18%)	58	1994803:1994862	2044513:2044575
WP_010947570.1|1989360_1989798_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_010947571.1|1990015_1990798_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011214098.1|1990906_1991866_-	glutathione synthase	NA	NA	NA	NA	NA
WP_011214099.1|1991865_1993161_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_010946556.1|1993319_1993613_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_010946555.1|1993638_1994724_-|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
1994803:1994862	attL	CACTGGATTGCTTCGTCGCTACGCTCCTCGCAACGACGGTCCCAAAAATCGTACCGTACA	NA	NA	NA	NA
WP_011214101.1|1995176_1996073_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011214102.1|1996076_1996358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021437159.1|1996344_1996695_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_011214104.1|1996728_1997391_-	Dot/Icm T4SS effector Lem14	NA	NA	NA	NA	NA
WP_011214105.1|1997760_1999398_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_014841922.1|1999450_2000089_+	uridine kinase	NA	A0A2K9L178	Tupanvirus	36.7	1.7e-27
WP_027229338.1|2000202_2000991_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_106128440.1|2001442_2004652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214109.1|2004789_2005416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214110.1|2005698_2008833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214111.1|2009405_2011280_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011214112.1|2011537_2011816_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	49.4	2.5e-15
WP_010947583.1|2011944_2014395_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.2	5.1e-213
WP_172407122.1|2014628_2015909_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.2	1.9e-134
WP_010947585.1|2016043_2016688_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.5	1.2e-57
WP_010947586.1|2016690_2018022_-	trigger factor	NA	NA	NA	NA	NA
WP_011214115.1|2018892_2020119_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011214116.1|2020241_2022092_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.8	5.6e-71
WP_011214117.1|2022119_2022794_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	33.8	7.5e-26
WP_011214118.1|2022783_2023176_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011214119.1|2023187_2023943_-	signal peptidase I	NA	NA	NA	NA	NA
WP_010947592.1|2024050_2025883_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	2.8e-22
WP_011214120.1|2026077_2027094_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011214121.1|2027168_2028308_+	GspL family type II secretion system protein LspL	NA	NA	NA	NA	NA
WP_011214122.1|2028304_2028775_+	GspM family type II secretion system protein LspM	NA	NA	NA	NA	NA
WP_011214123.1|2028878_2029412_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011214124.1|2029686_2031012_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_014844191.1|2031275_2034506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214126.1|2035384_2036917_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_011214128.1|2038092_2038533_-	VOC family protein	NA	NA	NA	NA	NA
WP_010947600.1|2038766_2039294_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.8	1.7e-20
WP_011214129.1|2039530_2040748_+	Dot/Icm T4SS effector LegC2/YlfB	NA	NA	NA	NA	NA
WP_011214130.1|2041069_2041384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214131.1|2041548_2042658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214132.1|2043088_2044174_+|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
WP_010946556.1|2044199_2044493_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011214133.1|2044670_2044946_-	acylphosphatase	NA	NA	NA	NA	NA
2044513:2044575	attR	CACTGGATTGCTTCGTCGCTACGCTCCTCGCAACGACGGTCCCAAAAATCGTACCGTACAGAG	NA	NA	NA	NA
WP_011214134.1|2045102_2045456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214135.1|2045637_2046969_-	Lpg1888 family Dot/Icm type IV secretion system effector	NA	NA	NA	NA	NA
WP_011214136.1|2047197_2048163_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	46.6	1.9e-78
WP_080020008.1|2048226_2049948_-	Dot/Icm T4SS effector LegLC8	NA	NA	NA	NA	NA
WP_013101554.1|2050059_2050326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214139.1|2050379_2050799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214140.1|2050808_2052089_-	MFS transporter	NA	NA	NA	NA	NA
WP_011214141.1|2052565_2053846_+	chloride channel protein	NA	NA	NA	NA	NA
WP_021437098.1|2054044_2054260_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011214143.1|2054428_2055535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011214144.1|2055736_2056240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011214145.1|2056503_2056983_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011214146.1|2057002_2058808_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011214148.1|2060384_2060720_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_021437102.1|2060743_2061064_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	39.1	3.0e-09
>prophage 6
NZ_CP021281	Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) chromosome, complete genome	3588028	2208521	2218644	3588028		Bacillus_phage(16.67%)	7	NA	NA
WP_011214266.1|2208521_2210210_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_011214267.1|2210341_2211349_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011214268.1|2211472_2212798_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.8e-47
WP_011214269.1|2212816_2213965_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	7.6e-127
WP_011214270.1|2214173_2215286_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	1.7e-51
WP_010947740.1|2215381_2216521_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_011214271.1|2216709_2218644_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.4	3.8e-147
>prophage 7
NZ_CP021281	Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) chromosome, complete genome	3588028	2337440	2403810	3588028	transposase	Vibrio_phage(20.0%)	60	NA	NA
WP_010947782.1|2337440_2338892_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2338962_2340483_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2341330_2341705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2341902_2343510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2343512_2344004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2344014_2344851_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2345443_2346535_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2346766_2352712_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2352732_2354625_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2354689_2355154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2355157_2357878_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2357883_2359269_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2359265_2359688_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2359677_2360460_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2360452_2362264_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2362263_2362932_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2362947_2363943_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2363939_2364548_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2364544_2364880_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_010947801.1|2367437_2367788_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2367801_2369088_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2369089_2369803_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2369805_2370369_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2370372_2370666_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2370667_2370970_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2370984_2371221_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2371234_2371612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2371559_2372444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2372616_2373297_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2373445_2374120_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2374568_2375141_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2375124_2375622_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2375614_2376202_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2376206_2378342_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2378360_2379242_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2379348_2379495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2379686_2379863_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2380032_2380530_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2380519_2381299_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2381291_2382146_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2382160_2382454_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2382643_2383165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2383469_2383928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2384501_2384729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2384886_2385408_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_060871595.1|2385579_2386134_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2386567_2386768_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2386861_2387245_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2387298_2388252_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_011213396.1|2388806_2389982_-|transposase	ISL3-like element ISLpn11 family transposase	transposase	A9YX10	Burkholderia_phage	22.9	3.2e-16
WP_192876284.1|2390047_2391805_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_015961262.1|2392124_2392436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947832.1|2393174_2393384_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	63.9	8.3e-16
WP_015961263.1|2393623_2395030_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.1	2.4e-58
WP_015961264.1|2395186_2396098_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_011946955.1|2396369_2396771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015961265.1|2396786_2397869_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_015961266.1|2397902_2398652_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	43.8	1.5e-19
WP_015961268.1|2399393_2401346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021437119.1|2403546_2403810_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP021281	Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) chromosome, complete genome	3588028	2734357	2742603	3588028	tRNA,transposase,integrase	Moraxella_phage(16.67%)	7	2738514:2738526	2743459:2743471
WP_015961445.1|2734357_2735359_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	3.4e-91
WP_010948064.1|2735563_2735803_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014842313.1|2736005_2736449_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.2	1.1e-20
WP_015961446.1|2736457_2738191_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_014844507.1|2738277_2740143_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2738514:2738526	attL	TATTGAAGAAGCA	NA	NA	NA	NA
WP_011213396.1|2740483_2741659_-|transposase	ISL3-like element ISLpn11 family transposase	transposase	A9YX10	Burkholderia_phage	22.9	3.2e-16
WP_032831057.1|2741724_2742603_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	46.7	5.9e-71
2743459:2743471	attR	TGCTTCTTCAATA	NA	NA	NA	NA
