The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021267	Legionella pneumophila subsp. pneumophila strain Burlington 1 (D-7841) chromosome, complete genome	3404198	922906	929746	3404198		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|922906_923683_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|923675_924710_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|924687_925266_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|925299_926025_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|926021_926531_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|926511_927081_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|927077_927605_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|927618_928581_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|928948_929746_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP021267	Legionella pneumophila subsp. pneumophila strain Burlington 1 (D-7841) chromosome, complete genome	3404198	1312127	1318064	3404198		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1312127_1313201_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1313185_1313800_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1313796_1315005_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1315012_1315480_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1315605_1317243_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1317239_1318064_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP021267	Legionella pneumophila subsp. pneumophila strain Burlington 1 (D-7841) chromosome, complete genome	3404198	2221602	2231726	3404198		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2221602_2223291_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2223422_2224430_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2224553_2225879_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2225897_2227046_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2227254_2228367_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2228462_2229602_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2229791_2231726_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP021267	Legionella pneumophila subsp. pneumophila strain Burlington 1 (D-7841) chromosome, complete genome	3404198	2273554	2328579	3404198	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2273554_2275006_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2275076_2276597_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2277444_2277819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2278016_2279624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2279626_2280118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2280128_2280965_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2281557_2282649_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2282880_2288826_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2288846_2290739_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2290803_2291268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2291271_2293992_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2293997_2295383_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2295379_2295802_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2295791_2296574_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2296566_2298378_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2298377_2299046_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2299061_2300057_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2300053_2300662_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2300658_2300994_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2300986_2303539_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2303550_2303901_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2303914_2305201_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2305202_2305916_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2305918_2306482_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2306485_2306779_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2306780_2307083_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2307097_2307334_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2307347_2307725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2307672_2308557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2308729_2309410_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2309558_2310233_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2310681_2311254_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2311237_2311735_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2311727_2312315_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2312319_2314455_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2314473_2315355_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2315461_2315608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2315799_2315976_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2316145_2316643_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2316632_2317412_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2317404_2318259_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2318273_2318567_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2318756_2319278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2319582_2320041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2320614_2320842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2320999_2321521_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2321692_2322247_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2322680_2322881_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2322974_2323358_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2323411_2324365_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2324874_2326293_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2326325_2327501_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2327553_2328579_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP021267	Legionella pneumophila subsp. pneumophila strain Burlington 1 (D-7841) chromosome, complete genome	3404198	2625729	2688998	3404198	protease,integrase,tRNA,transposase	Erysipelothrix_phage(18.75%)	57	2631637:2631683	2687669:2687715
WP_010948063.1|2625729_2626731_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2626935_2627175_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2627377_2627821_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2627829_2629563_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2629649_2631515_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2631637:2631683	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2631773_2632901_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2633281_2633467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2633459_2634236_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2634369_2635185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2635226_2636537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2636666_2638148_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2638301_2638544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2638778_2638973_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2639000_2642276_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2642268_2642931_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2642950_2644906_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2644923_2647956_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2648031_2649831_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2649827_2650511_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2650712_2651597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2651616_2651928_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2651944_2652217_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2652244_2653210_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2653221_2653599_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2653595_2653895_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2653891_2656426_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2656422_2657121_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2657117_2657993_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2657995_2658403_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2658408_2659656_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2659667_2660408_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2660430_2660643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2660647_2662030_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2662026_2663916_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2663912_2664458_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2664454_2664619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2664611_2666798_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2666927_2668523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2668832_2670695_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2670691_2671045_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2671438_2671783_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2671782_2672508_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2672507_2672945_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2673192_2674254_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2674676_2676311_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2676265_2676658_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2677139_2677382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2677624_2679565_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2679644_2680496_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2680492_2681101_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2681908_2682313_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2682270_2682396_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2682520_2683573_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_161499102.1|2683579_2684743_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2684826_2685873_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2685874_2686939_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2687822_2688998_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2687669:2687715	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
