The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027126	Escherichia coli strain AR_0374 chromosome, complete genome	4877957	461805	528950	4877957	portal,protease,terminase,head,tail,integrase,lysis,capsid	Enterobacteria_phage(44.0%)	75	458904:458918	510010:510024
458904:458918	attL	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_001260840.1|461805_462627_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|462726_462810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743960.1|462902_463238_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091838.1|463634_464888_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|464994_465888_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|466022_467243_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|467367_468063_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|468015_469308_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|469466_470081_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|470123_470978_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|470979_471597_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|471607_474031_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_001295396.1|476711_477017_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|477124_477835_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|477837_478398_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|478432_478774_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|478908_479235_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001370501.1|479440_480655_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|480666_481686_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001389342.1|481743_481872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|481873_483154_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_000005552.1|483188_483440_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048286.1|483512_485984_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
WP_001083273.1|486077_486269_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001331023.1|486265_486454_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331024.1|486854_487007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171928.1|486993_487209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|487368_487524_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000362155.1|487789_488209_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|488309_488591_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|488574_489000_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|489071_490142_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|490182_490605_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|490945_492943_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_000625668.1|493006_494284_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019008.1|494414_495296_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957771.1|495292_495985_-	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_001117226.1|495996_497196_-	MFS transporter	NA	NA	NA	NA	NA
WP_122083109.1|497707_497815_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|497859_498072_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|498239_498518_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265040.1|498519_499569_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_000904112.1|499581_499956_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762868.1|499952_500774_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
WP_000562553.1|501673_501805_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506937.1|502171_502600_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|502771_503146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|503397_503613_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001135280.1|503612_504110_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|504326_504509_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|504599_504893_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_032195597.1|505255_505450_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	2.2e-26
WP_000453566.1|505838_506384_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001609942.1|506358_508284_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198150.1|508280_508487_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
WP_094322808.1|508483_510085_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.3	1.8e-307
510010:510024	attR	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_000123295.1|510065_511385_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
WP_001513196.1|511394_511727_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063218.1|511782_512808_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|512849_513245_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|513256_513610_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975054.1|513621_514200_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000683105.1|514196_514592_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001609944.1|514599_515340_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000479169.1|515355_515778_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459488.1|515759_516194_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_094322806.1|516186_518748_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.8	0.0e+00
WP_000847379.1|518744_519074_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_032330060.1|519073_519772_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	3.0e-134
WP_053887856.1|519777_520521_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
WP_000090917.1|520457_521090_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_094322805.1|521150_524564_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
WP_001230353.1|524633_525233_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
WP_072005420.1|525297_528369_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	1.6e-67
WP_001593356.1|528368_528950_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 2
NZ_CP027126	Escherichia coli strain AR_0374 chromosome, complete genome	4877957	750123	801946	4877957	coat,terminase,tail,integrase,tRNA,lysis	Escherichia_phage(51.06%)	56	769626:769642	807547:807563
WP_097344277.1|750123_750732_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	3.8e-101
WP_106087011.1|750731_754085_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_061342618.1|754149_754749_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	4.4e-110
WP_106087012.1|754815_758214_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.2	0.0e+00
WP_050574668.1|758274_758883_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	92.6	1.9e-100
WP_106087013.1|758819_759563_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.1	3.2e-142
WP_106087014.1|759568_760267_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	2.4e-131
WP_000024051.1|760266_760605_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_106087015.1|760597_763831_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.7	2.4e-114
WP_012565075.1|764304_764664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106087016.1|764814_765777_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	1.0e-55
WP_000144678.1|765803_766196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029819.1|766192_766573_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_000524259.1|766573_766957_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	40.2	3.4e-15
WP_000634211.1|766956_767352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|767355_767532_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_079403889.1|767574_768714_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.7	7.4e-159
WP_106087017.1|768812_769577_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	6.6e-87
769626:769642	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_097291823.1|769681_770794_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	2.3e-112
WP_106087018.1|770777_772184_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.5	8.8e-186
WP_106087019.1|772186_773488_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	5.2e-148
WP_106087020.1|773468_774563_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	79.8	7.7e-113
WP_000126788.1|774566_774776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204033.1|774753_775686_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_106087021.1|775678_776473_-	ParB N-terminal domain-containing protein	NA	U3PCR3	Lactobacillus_phage	40.8	9.7e-49
WP_001697073.1|776610_778068_-	TrkG potassium ion Trk transporter	NA	NA	NA	NA	NA
WP_077613672.1|778264_778450_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	77.2	1.1e-14
WP_001135296.1|778666_779164_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839596.1|779163_779379_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000640107.1|780663_781206_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_000228032.1|781202_781493_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_001595669.1|781492_782092_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.9e-105
WP_001326322.1|782964_783303_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001595668.1|783915_784584_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000686865.1|784854_785127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001595666.1|785263_785686_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	6.5e-60
WP_106087022.1|785701_786463_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.3	3.8e-119
WP_001595663.1|786485_787232_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	3.4e-112
WP_001595662.1|787238_788096_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	74.1	1.5e-74
WP_000693801.1|788108_788531_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	97.1	8.2e-71
WP_001072343.1|788527_788782_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|788861_789281_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169150.1|789716_789869_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
WP_000560211.1|790279_790501_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.0e-37
WP_000245522.1|790494_790671_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	1.1e-24
WP_001314664.1|790745_791021_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
WP_001595659.1|791122_793723_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	62.8	1.5e-247
WP_000166313.1|793715_794525_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001317028.1|794581_794776_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001595656.1|794768_794957_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	7.2e-27
WP_000079604.1|795056_795272_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|795273_796509_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157377.1|796560_797496_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123738.1|797624_798998_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|799475_800459_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|800713_801946_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
807547:807563	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 3
NZ_CP027126	Escherichia coli strain AR_0374 chromosome, complete genome	4877957	1854281	1917433	4877957	holin,transposase,integrase	Enterobacteria_phage(50.0%)	53	1884518:1884532	1920405:1920419
WP_000131044.1|1854281_1856315_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001351501.1|1856443_1857031_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089063.1|1857044_1858517_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|1858530_1860201_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001616491.1|1860895_1861030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295805.1|1861275_1861839_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001315275.1|1862168_1862963_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406335.1|1862959_1863100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001406334.1|1863116_1863878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|1865023_1866217_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209098.1|1866400_1867066_+	membrane protein	NA	NA	NA	NA	NA
WP_000370308.1|1867311_1868007_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023910.1|1867999_1869427_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|1869437_1870157_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339587.1|1870686_1871541_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001352368.1|1873020_1874229_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000474074.1|1874538_1874775_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|1874786_1875380_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|1875539_1876409_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_000621018.1|1876657_1877515_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092556.1|1877635_1881889_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|1883004_1883106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|1883468_1883732_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|1883731_1883872_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|1883906_1884134_-	hypothetical protein	NA	NA	NA	NA	NA
1884518:1884532	attL	TATCCCTTACCCTTA	NA	NA	NA	NA
WP_001296902.1|1884956_1885499_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|1885573_1886161_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716392.1|1886218_1886887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131077.1|1886912_1889438_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001330883.1|1889427_1891071_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|1891039_1891750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|1892062_1892392_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|1892639_1893254_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070693.1|1893671_1894361_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643328.1|1894357_1895314_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|1895310_1897509_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121326.1|1897518_1898475_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|1898453_1898864_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000783650.1|1899482_1901816_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|1901830_1902151_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_106087034.1|1902286_1902742_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_001244665.1|1902734_1903022_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980231.1|1903014_1903614_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.9e-49
WP_001149160.1|1903610_1903877_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283027.1|1904428_1905163_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	1.4e-129
WP_000638629.1|1905159_1905660_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446152.1|1905733_1906306_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_001273463.1|1908339_1909005_-	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	41.1	1.5e-31
WP_001609341.1|1909287_1909632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067395.1|1909982_1910909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000857772.1|1912047_1913889_+	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_000068781.1|1913969_1915907_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032195659.1|1916098_1917433_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1920405:1920419	attR	TATCCCTTACCCTTA	NA	NA	NA	NA
>prophage 4
NZ_CP027126	Escherichia coli strain AR_0374 chromosome, complete genome	4877957	1965270	2027544	4877957	protease,plate,transposase,tRNA	Enterobacteria_phage(12.5%)	51	NA	NA
WP_000611738.1|1965270_1965684_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|1965687_1967538_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|1967501_1968584_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|1968608_1969889_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|1969885_1970410_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|1970412_1971744_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|1971748_1972510_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001766987.1|1972518_1975362_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.6	1.0e-79
WP_000088859.1|1975358_1976102_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|1976106_1977519_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|1977627_1981062_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|1981072_1982425_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|1982448_1982931_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|1982974_1983889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|1983898_1984378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|1984514_1985300_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|1985839_1986571_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|1986635_1987103_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|1987099_1987822_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052710.1|1987855_1988611_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1988682_1990041_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211689.1|1990088_1990859_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1990936_1991737_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|1991977_1992892_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|1992888_1993692_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|1999451_2000024_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|2000211_2001243_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|2001235_2001889_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|2001928_2002744_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|2002861_2003266_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|2003262_2003970_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|2004081_2005800_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399647.1|2006880_2007861_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|2008110_2008821_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635316.1|2008834_2009257_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|2009253_2009799_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|2009964_2010165_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|2010151_2010412_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|2010460_2011759_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|2011823_2012213_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|2012269_2014411_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|2014509_2015469_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|2015481_2018964_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|2019000_2019597_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|2019593_2020742_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|2020741_2021530_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2021533_2021989_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|2022093_2023119_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|2023122_2023608_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|2023729_2026162_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|2026191_2027544_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 5
NZ_CP027126	Escherichia coli strain AR_0374 chromosome, complete genome	4877957	2349499	2386529	4877957	transposase,integrase	Escherichia_phage(27.27%)	43	2348249:2348266	2372391:2372408
2348249:2348266	attL	AATATCTCATGGAGATAT	NA	NA	NA	NA
WP_001218329.1|2349499_2350765_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
WP_001290178.1|2351226_2351373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001327226.1|2351457_2351655_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761685.1|2351674_2352163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094443.1|2352159_2352537_-	toxin	NA	NA	NA	NA	NA
WP_001285607.1|2352626_2352995_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692350.1|2353074_2353296_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186165.1|2353382_2353859_-	RadC family protein	NA	NA	NA	NA	NA
WP_000206664.1|2353873_2354359_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.2e-12
WP_001175163.1|2354450_2355269_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	1.9e-47
WP_001278287.1|2355358_2355592_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001097301.1|2355597_2356275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282919.1|2356422_2357103_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000010383.1|2357305_2358190_-	GTPase	NA	NA	NA	NA	NA
WP_000126799.1|2358295_2359258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001499035.1|2359254_2360124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000778605.1|2361728_2362259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075491.1|2362928_2363660_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001611347.1|2363875_2364655_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_001295213.1|2364654_2365677_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_123906543.1|2365690_2366185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538703.1|2366129_2366612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072164.1|2366815_2367319_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_000218942.1|2367321_2368098_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001617303.1|2368376_2368724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609855.1|2369374_2370178_+	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	51.3	4.1e-79
WP_000387046.1|2370363_2370915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001609859.1|2371163_2371613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000900255.1|2371650_2372472_+	hypothetical protein	NA	NA	NA	NA	NA
2372391:2372408	attR	ATATCTCCATGAGATATT	NA	NA	NA	NA
WP_000902464.1|2372542_2373334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000878218.1|2373470_2374337_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|2374333_2374633_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001325745.1|2375157_2375898_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001611300.1|2377389_2377527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|2377596_2378805_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|2379170_2380376_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|2380819_2381140_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|2381132_2381519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|2381526_2382213_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|2382190_2382814_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|2382895_2384101_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|2384213_2384807_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001352368.1|2385320_2386529_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 6
NZ_CP027126	Escherichia coli strain AR_0374 chromosome, complete genome	4877957	2408238	2459004	4877957	transposase,tRNA,integrase	Enterobacteria_phage(26.67%)	47	2419643:2419702	2448242:2448860
WP_001218930.1|2408238_2409504_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
WP_001514390.1|2410009_2410219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294545.1|2410301_2411804_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001295681.1|2411922_2413005_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|2413004_2414105_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2414371_2415883_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2416016_2416460_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|2416459_2419315_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_106087038.1|2419370_2419649_-	hypothetical protein	NA	NA	NA	NA	NA
2419643:2419702	attL	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGT	NA	NA	NA	NA
WP_001059414.1|2420421_2420925_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|2420970_2421387_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000086237.1|2421548_2422553_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001309158.1|2422653_2422884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331059.1|2422870_2424214_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000412211.1|2425606_2426266_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|2426466_2426844_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|2426910_2429877_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|2429879_2430440_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|2430565_2430916_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845054.1|2431118_2432132_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_003159191.1|2432292_2432847_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|2432941_2433574_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000777555.1|2433642_2434116_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	33.8	3.7e-19
WP_000679427.1|2434877_2435225_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2435218_2436058_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2436185_2436686_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000344784.1|2440867_2441728_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|2441730_2443446_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|2443484_2444153_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|2444188_2444425_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|2444421_2444784_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|2444801_2446496_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|2446547_2446970_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|2447005_2447281_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|2447294_2447645_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|2447716_2448151_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001143760.1|2448892_2451898_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
2448242:2448860	attR	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAG	NA	NA	NA	NA
WP_001235713.1|2452061_2452619_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|2452801_2453662_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000256656.1|2454292_2454886_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500727.1|2454956_2455670_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|2455800_2456196_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|2456476_2456611_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|2456614_2457550_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2457562_2458024_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2458096_2458483_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_001118337.1|2458548_2459004_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP027126	Escherichia coli strain AR_0374 chromosome, complete genome	4877957	3935254	4000623	4877957	transposase,tRNA,integrase	Escherichia_phage(18.75%)	55	3973333:3973392	3996968:3997585
WP_000003071.1|3935254_3936772_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192790.1|3936814_3937363_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|3937417_3937489_+	protein YqfH	NA	NA	NA	NA	NA
WP_001050745.1|3937485_3937611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|3937612_3939061_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001626722.1|3939496_3941416_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|3941415_3941904_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|3941939_3943307_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|3943342_3944659_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|3944676_3946077_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_000583615.1|3946241_3949112_-	molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit	NA	NA	NA	NA	NA
WP_000572462.1|3949108_3949888_-	molybdopterin-dependent oxidoreductase FAD-binding subunit	NA	NA	NA	NA	NA
WP_000906280.1|3949938_3951267_-	putative aminohydrolase SsnA	NA	NA	NA	NA	NA
WP_000502404.1|3951269_3954368_-	putative selenate reductase subunit YgfK	NA	NA	NA	NA	NA
WP_001272856.1|3954689_3955268_-	molybdenum cofactor cytidylyltransferase	NA	NA	NA	NA	NA
WP_001298920.1|3955370_3956141_+	putative selenium-dependent hydroxylase accessory protein YqeC	NA	NA	NA	NA	NA
WP_001020377.1|3956188_3957814_+	EF2563 family selenium-dependent molybdenum hydroxylase system protein	NA	NA	NA	NA	NA
WP_000037992.1|3957854_3958787_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001264457.1|3958834_3960220_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_001107117.1|3960272_3961484_-	YgeY family selenium metabolism-linked hydrolase	NA	NA	NA	NA	NA
WP_000110493.1|3961541_3962738_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_001303128.1|3962795_3963983_-	knotted carbamoyltransferase YgeW	NA	NA	NA	NA	NA
WP_000417808.1|3964461_3966240_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_001016606.1|3966279_3966759_-	xanthine dehydrogenase iron sulfur-binding subunit XdhC	NA	NA	NA	NA	NA
WP_000459182.1|3966755_3967634_-	xanthine dehydrogenase FAD-binding subunit XdhB	NA	NA	NA	NA	NA
WP_000388150.1|3967644_3969942_-	xanthine dehydrogenase molybdenum-binding subunit XdhA	NA	NA	NA	NA	NA
WP_001272558.1|3970356_3971112_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_000676929.1|3971497_3973108_+	hypothetical protein	NA	NA	NA	NA	NA
3973333:3973392	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_000412211.1|3974323_3974983_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|3975183_3975561_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|3975627_3978594_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|3978596_3979157_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|3979282_3979633_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845054.1|3979835_3980849_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_003159191.1|3981009_3981564_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|3981658_3982291_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000777555.1|3982359_3982833_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	33.8	3.7e-19
WP_123906544.1|3983077_3983428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000679427.1|3983595_3983943_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3983936_3984776_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|3984903_3985404_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|3985579_3986362_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|3986351_3987875_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000287615.1|3987997_3989542_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_000344784.1|3989592_3990453_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|3990455_3992171_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|3992209_3992878_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|3992913_3993150_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|3993146_3993509_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|3993526_3995221_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|3995272_3995695_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|3995730_3996006_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|3996019_3996370_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|3996441_3996876_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001143760.1|3997617_4000623_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
3996968:3997585	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAG	NA	NA	NA	NA
>prophage 8
NZ_CP027126	Escherichia coli strain AR_0374 chromosome, complete genome	4877957	4142392	4149532	4877957		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4142392_4143031_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590388.1|4143027_4144290_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_000847985.1|4144286_4145195_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4145390_4146158_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|4146208_4146865_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272894.1|4146970_4149532_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 9
NZ_CP027126	Escherichia coli strain AR_0374 chromosome, complete genome	4877957	4219563	4310886	4877957	portal,protease,terminase,tail,transposase,integrase,tRNA,lysis	Enterobacteria_phage(47.17%)	87	4212829:4212843	4235544:4235558
4212829:4212843	attL	GACATTTCCCGCGCC	NA	NA	NA	NA
WP_000169527.1|4219563_4219863_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001746364.1|4219859_4220726_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.8e-51
WP_000577254.1|4220877_4222596_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000448925.1|4224419_4224836_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|4224874_4226104_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_001352368.1|4227074_4228283_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000531801.1|4228490_4229666_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.9e-147
WP_001331174.1|4229626_4229833_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|4229892_4230108_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001242730.1|4230104_4230467_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_106087053.1|4230457_4230994_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.8	2.0e-98
WP_000196297.1|4231632_4232112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|4232519_4233194_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4233284_4233485_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515836.1|4233528_4234086_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	2.6e-96
WP_001250269.1|4234261_4234441_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001610668.1|4234430_4235372_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	7.5e-141
WP_001331408.1|4235368_4235863_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	8.1e-86
4235544:4235558	attR	GACATTTCCCGCGCC	NA	NA	NA	NA
WP_001610667.1|4235862_4236516_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_000210170.1|4236512_4236839_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|4236835_4237225_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061397.1|4237244_4238042_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_001625103.1|4238049_4239039_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	5.2e-193
WP_001204819.1|4239056_4239422_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_001038607.1|4239506_4239953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|4240223_4240427_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|4240577_4241630_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|4241696_4241912_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135251.1|4241911_4242409_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	99.4	1.7e-91
WP_001442864.1|4242405_4242873_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	99.4	2.9e-77
WP_001139680.1|4242860_4243013_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000373425.1|4243688_4244183_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934130.1|4244182_4246285_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_001072975.1|4246281_4246494_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_011478361.1|4246421_4248002_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_077248791.1|4247946_4249974_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|4250060_4250384_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4250376_4250652_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|4250663_4251242_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079408.1|4251238_4251640_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	7.0e-72
WP_000211105.1|4251650_4252394_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	98.0	5.6e-131
WP_001429942.1|4252454_4252841_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	99.2	2.8e-65
WP_001352368.1|4253008_4254217_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001615060.1|4254488_4257545_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	97.8	0.0e+00
WP_001610655.1|4257544_4257874_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_001152385.1|4257883_4258582_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_001619743.1|4258587_4259331_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	8.0e-146
WP_003887348.1|4259228_4259876_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	8.6e-112
WP_001230388.1|4263400_4264000_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_024262335.1|4264064_4267091_+|tail	tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_001631692.1|4267090_4267675_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	1.9e-105
WP_001610640.1|4268229_4270218_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000011690.1|4270214_4270853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072748.1|4271302_4272223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|4272967_4273450_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|4273581_4274058_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4274047_4274338_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4274399_4274741_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|4274889_4276551_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|4276636_4277515_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|4277637_4278231_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|4278285_4279572_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001189257.1|4279592_4280459_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|4280550_4281912_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4282160_4282409_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4282427_4282976_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|4283006_4283774_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|4283815_4284163_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|4284239_4284722_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969042.1|4284737_4285964_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|4285953_4286472_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168054.1|4287224_4288295_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225217.1|4288305_4289427_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200098.1|4289469_4290630_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|4290728_4290776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|4290879_4291221_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|4291491_4292229_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|4292363_4293344_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|4293340_4294072_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|4294201_4296775_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000230378.1|4302630_4303929_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.4	4.3e-46
WP_000464877.1|4303925_4304270_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|4304294_4305650_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082949.1|4305763_4308424_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001307345.1|4308455_4309154_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|4309222_4309642_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_089454903.1|4309848_4310886_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP027126	Escherichia coli strain AR_0374 chromosome, complete genome	4877957	4777975	4787417	4877957		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|4777975_4778902_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|4778906_4779638_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4779618_4779726_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|4779785_4780517_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|4780738_4782424_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4782420_4783140_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4783186_4783657_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4783697_4784159_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001331478.1|4784283_4786284_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292767.1|4786280_4787417_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
