The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027533	Serratia marcescens strain AR_0091 chromosome, complete genome	5309542	516047	524703	5309542	integrase	Enterobacteria_phage(66.67%)	9	517647:517661	523507:523521
WP_033637217.1|516047_517151_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
WP_086556832.1|517154_518414_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	3.6e-98
517647:517661	attL	CTGGAACAGTGCGGC	NA	NA	NA	NA
WP_033649938.1|518832_520023_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	2.8e-140
WP_048321296.1|520758_521022_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.5e-17
WP_048321297.1|521018_521234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048321298.1|521220_521766_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.7	5.5e-27
WP_048321299.1|521762_522026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086556834.1|522022_522358_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_048321301.1|522369_524703_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.2	3.3e-262
523507:523521	attR	GCCGCACTGTTCCAG	NA	NA	NA	NA
>prophage 2
NZ_CP027533	Serratia marcescens strain AR_0091 chromosome, complete genome	5309542	1276419	1319305	5309542	plate,tail,lysis,capsid,integrase,terminase,protease,portal,head	Erwinia_phage(41.67%)	56	1285522:1285540	1319420:1319438
WP_033637803.1|1276419_1276932_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_049197156.1|1276987_1277878_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_133306279.1|1277951_1279121_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_033646678.1|1279117_1280119_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_033646677.1|1280151_1280844_+	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_130042894.1|1281028_1281379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033646675.1|1281760_1283242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025302229.1|1283238_1284012_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_060428358.1|1284061_1284958_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_049213125.1|1284959_1285400_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
1285522:1285540	attL	AGGCAACAAAAAACCCGAT	NA	NA	NA	NA
WP_086556855.1|1285631_1286666_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	59.2	6.6e-114
WP_120027045.1|1286760_1288278_-	NTPase	NA	R9TRQ8	Vibrio_phage	33.5	7.3e-45
WP_158702815.1|1288357_1288957_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	35.2	1.5e-25
WP_086556858.1|1289071_1289302_+	regulator	NA	NA	NA	NA	NA
WP_072269686.1|1289331_1289841_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	51.2	2.1e-41
WP_060418374.1|1289858_1290059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037432527.1|1290086_1290275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072269687.1|1290421_1290601_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	52.1	6.6e-06
WP_060418375.1|1290612_1290915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060418376.1|1290979_1291273_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	54.4	6.4e-06
WP_033639330.1|1291272_1291497_+	hypothetical protein	NA	Q6K1F5	Salmonella_virus	58.3	9.8e-15
WP_060418377.1|1291622_1291937_+	DUF3850 domain-containing protein	NA	D2XJW3	Escherichia_phage	51.9	3.1e-14
WP_106046294.1|1291933_1294150_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	57.9	3.8e-236
WP_033644912.1|1294188_1294413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126186641.1|1294460_1294658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071605322.1|1295028_1295283_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
WP_063988754.1|1295282_1295624_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_086556860.1|1295667_1296885_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_086556861.1|1296919_1297954_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.7	4.5e-163
WP_086556862.1|1297953_1299726_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	82.0	5.7e-291
WP_086556863.1|1299868_1300684_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.3	3.5e-70
WP_086556864.1|1300726_1301938_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	77.7	2.5e-157
WP_086556865.1|1301940_1302600_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.9	1.8e-80
WP_086556866.1|1302693_1303182_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	8.7e-40
WP_086556867.1|1303181_1303385_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	67.2	5.4e-20
WP_017894084.1|1303389_1303599_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	1.2e-09
WP_086556868.1|1303582_1304095_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	67.7	1.9e-58
WP_086556869.1|1304091_1304520_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.6	4.2e-14
WP_086556870.1|1304615_1305092_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	63.4	3.8e-48
WP_086556871.1|1305078_1305525_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	57.0	5.1e-39
WP_086556872.1|1305597_1306227_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	71.0	5.7e-76
WP_154619209.1|1306237_1306378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033639346.1|1306374_1306725_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	66.4	6.4e-37
WP_086556873.1|1306729_1307638_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	68.2	9.6e-109
WP_015379109.1|1307630_1308164_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.6	4.3e-77
WP_106046295.1|1308170_1310690_+	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	53.6	1.2e-60
WP_086556875.1|1310691_1311216_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	44.8	1.8e-35
WP_048321696.1|1311384_1311603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086556876.1|1312330_1313500_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.7	4.0e-184
WP_086556877.1|1313515_1314025_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	75.6	3.8e-70
WP_060445948.1|1314078_1314360_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.8	5.3e-26
WP_026142543.1|1314392_1314515_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	75.0	3.0e-10
WP_086556878.1|1314507_1317357_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	52.1	4.2e-110
WP_060387526.1|1317356_1317842_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_086556879.1|1317838_1318987_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.6	4.1e-125
WP_072265518.1|1319086_1319305_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.2	3.2e-26
1319420:1319438	attR	AGGCAACAAAAAACCCGAT	NA	NA	NA	NA
>prophage 3
NZ_CP027533	Serratia marcescens strain AR_0091 chromosome, complete genome	5309542	1575418	1594883	5309542	tail,capsid,holin,terminase,head,portal	Cronobacter_phage(71.43%)	22	NA	NA
WP_086579621.1|1575418_1577086_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	42.8	3.0e-124
WP_086579622.1|1577082_1577637_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	46.7	2.4e-30
WP_086579623.1|1577633_1578335_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	32.3	2.2e-28
WP_106046298.1|1578552_1580100_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	48.7	6.3e-68
WP_060433223.1|1580190_1580793_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	54.7	2.1e-51
WP_060387972.1|1580785_1581970_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	62.6	1.5e-141
WP_086579625.1|1581959_1582298_-	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	62.7	4.3e-30
WP_086579626.1|1582290_1584204_-|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	38.5	2.3e-104
WP_060422330.1|1584391_1584658_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	48.8	1.8e-15
WP_086579627.1|1584774_1585164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060422324.1|1585163_1585505_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	81.2	1.2e-43
WP_060387966.1|1585491_1585791_-|holin	holin	holin	S4TP56	Salmonella_phage	60.5	1.4e-19
WP_060387965.1|1585800_1586256_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	58.9	5.2e-47
WP_086579628.1|1586262_1587384_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	59.8	7.1e-122
WP_060422317.1|1587380_1588094_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	53.2	6.0e-58
WP_086579629.1|1588077_1588575_-	hypothetical protein	NA	Q94MZ1	Haemophilus_virus	31.1	1.6e-12
WP_086579630.1|1588571_1589063_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	47.7	1.3e-27
WP_106046299.1|1589059_1589863_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	56.2	8.6e-69
WP_140368138.1|1589865_1590918_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	58.4	1.4e-106
WP_086579631.1|1590976_1591864_-	hypothetical protein	NA	F1BUM4	Cronobacter_phage	38.7	2.9e-41
WP_086579632.1|1592037_1593837_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	54.3	1.2e-192
WP_086579633.1|1593833_1594883_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	61.8	2.5e-124
>prophage 4
NZ_CP027533	Serratia marcescens strain AR_0091 chromosome, complete genome	5309542	1781350	1830781	5309542	coat,integrase,protease	Moraxella_phage(16.67%)	44	1820108:1820124	1830823:1830839
WP_033638278.1|1781350_1782286_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_060428615.1|1782306_1784649_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_033638279.1|1784794_1785559_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033646335.1|1785583_1786138_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_154632409.1|1786137_1786641_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033638282.1|1786643_1787183_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_060428567.1|1787457_1788894_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033638759.1|1788996_1791627_-	PqiB family protein	NA	NA	NA	NA	NA
WP_039567108.1|1791595_1792843_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033638286.1|1793098_1793596_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_060441846.1|1793692_1794403_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033638289.1|1794422_1796471_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.7e-85
WP_033638291.1|1796780_1797659_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_060387635.1|1797896_1798604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033646331.1|1798704_1800099_-	MFS transporter	NA	NA	NA	NA	NA
WP_048321503.1|1800330_1801122_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_048321504.1|1801168_1801972_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_033646329.1|1801974_1802838_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_086556887.1|1802839_1803976_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	1.3e-25
WP_049196135.1|1803972_1804983_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033653907.1|1805158_1805878_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_041034837.1|1806033_1807137_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_033653909.1|1807146_1807956_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_086556888.1|1808019_1809417_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_049212644.1|1809592_1810141_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	6.4e-07
WP_033638306.1|1810564_1811230_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_060428573.1|1811294_1812575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638308.1|1812760_1813321_+	membrane protein	NA	NA	NA	NA	NA
WP_033646323.1|1813356_1814226_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_033646322.1|1814465_1815320_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_015377686.1|1815319_1816180_-	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_033638312.1|1816179_1817070_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.7	2.5e-08
WP_033638313.1|1817066_1818011_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033646321.1|1818142_1818442_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_004931439.1|1818551_1819217_+	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	46.3	1.0e-06
WP_033646320.1|1819524_1820250_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
1820108:1820124	attL	ATCCCATCCATGGCGGC	NA	NA	NA	NA
WP_004931432.1|1820252_1822034_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_086556889.1|1822046_1823384_+	cytochrome c	NA	NA	NA	NA	NA
WP_033638320.1|1823641_1824925_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_033646319.1|1825075_1826209_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033646318.1|1826245_1826935_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_060418478.1|1827319_1828369_+	YrzE family protein	NA	NA	NA	NA	NA
WP_033646316.1|1828608_1829232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060428577.1|1829578_1830781_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	59.8	7.9e-135
1830823:1830839	attR	GCCGCCATGGATGGGAT	NA	NA	NA	NA
>prophage 5
NZ_CP027533	Serratia marcescens strain AR_0091 chromosome, complete genome	5309542	1835217	1890240	5309542	tail,holin,terminase,head,tRNA	Salmonella_phage(31.25%)	69	NA	NA
WP_086556894.1|1835217_1836003_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	50.2	2.7e-59
WP_154582428.1|1836005_1836149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140367549.1|1836142_1836355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140367550.1|1836715_1836913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086556895.1|1836936_1837095_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_086557005.1|1837729_1838323_-	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	59.2	1.2e-14
WP_041033757.1|1838433_1838646_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	75.4	1.4e-23
WP_086556896.1|1838671_1838962_+	hypothetical protein	NA	I6PCV6	Cronobacter_phage	44.0	5.5e-10
WP_060452900.1|1839095_1839278_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_086556897.1|1839274_1840189_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	43.6	9.2e-51
WP_086556898.1|1840185_1840905_+	DNA replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	48.8	6.5e-44
WP_086556899.1|1840901_1841876_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	37.3	6.1e-61
WP_086556900.1|1841872_1842229_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	65.5	5.3e-39
WP_086556901.1|1842225_1842624_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	61.2	2.2e-33
WP_140367551.1|1842872_1843211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049193441.1|1843388_1843706_+|holin	holin	holin	F1C5D1	Cronobacter_phage	82.8	5.1e-41
WP_060429443.1|1843692_1844133_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	66.4	6.6e-47
WP_106046301.1|1844129_1844666_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	51.0	8.6e-33
WP_060429444.1|1844662_1844860_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	68.8	2.4e-17
WP_060429445.1|1844979_1845525_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060429463.1|1845502_1845802_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_060429447.1|1846889_1847309_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	69.9	5.0e-44
WP_060429448.1|1847301_1848549_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	95.6	7.5e-213
WP_086556902.1|1848570_1849899_+	DUF1073 domain-containing protein	NA	I6R9A1	Salmonella_phage	77.1	1.6e-200
WP_060429450.1|1849882_1850809_+|head	phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	62.2	1.8e-107
WP_060429451.1|1850812_1852078_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	77.4	9.0e-190
WP_060429452.1|1852090_1852537_+	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	85.8	3.0e-63
WP_060429453.1|1852554_1853631_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	92.7	2.0e-193
WP_060429454.1|1853640_1853934_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	78.4	8.3e-38
WP_060429455.1|1854000_1854399_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	84.0	4.7e-60
WP_060429456.1|1854570_1854918_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	60.0	6.6e-34
WP_060429457.1|1854920_1855331_+	hypothetical protein	NA	A0A291AXD9	Shigella_phage	58.1	2.7e-34
WP_060429458.1|1855327_1855711_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	49.6	2.0e-31
WP_041033806.1|1855771_1856521_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	55.2	2.3e-63
WP_060429459.1|1856728_1857238_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	69.0	1.5e-63
WP_060429460.1|1857276_1857957_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.0	3.3e-61
WP_140367552.1|1858208_1858508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140367553.1|1858510_1858897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071845153.1|1858919_1859348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158702816.1|1859416_1859611_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_086556903.1|1859723_1859924_+	lipoprotein	NA	NA	NA	NA	NA
WP_086556904.1|1859987_1860872_-	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	69.2	1.3e-81
WP_086556905.1|1861025_1861304_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_086556906.1|1861398_1861803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086556907.1|1861864_1865071_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.3	3.3e-180
WP_060428211.1|1865128_1865596_+	hypothetical protein	NA	A0A173GC35	Salmonella_phage	64.7	1.1e-52
WP_086556908.1|1865596_1866067_+	DUF1833 family protein	NA	R9TPR6	Aeromonas_phage	56.9	1.3e-45
WP_060428233.1|1866086_1866491_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	64.7	8.7e-46
WP_086556909.1|1866438_1868931_+|tail	phage tail protein	tail	A0A1B1W274	Salmonella_phage	55.3	2.7e-254
WP_086556910.1|1868931_1871238_+	hypothetical protein	NA	A0A1B1W279	Salmonella_phage	60.9	8.1e-11
WP_060437140.1|1871238_1872144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033637997.1|1872289_1872712_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.0	3.0e-33
WP_060425706.1|1872711_1873980_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.5	8.8e-177
WP_086556911.1|1873976_1874684_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	55.7	2.3e-70
WP_025159696.1|1874951_1876880_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.5e-132
WP_048233542.1|1876883_1877435_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_004931418.1|1877533_1877731_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004931417.1|1877774_1878131_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_151498502.1|1878200_1878296_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004931416.1|1878542_1879526_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
WP_060418479.1|1879540_1881928_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	1.4e-05
WP_004931414.1|1881932_1882229_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_039566415.1|1882778_1883195_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_033653920.1|1883373_1884381_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_060387687.1|1884426_1884978_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	34.4	9.8e-16
WP_033638333.1|1884983_1885739_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	2.8e-05
WP_033638335.1|1886136_1887291_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	25.2	1.2e-28
WP_049196145.1|1887277_1888258_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	B9UDL7	Salmonella_phage	32.4	3.1e-36
WP_033638761.1|1888257_1890240_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	1.1e-21
>prophage 6
NZ_CP027533	Serratia marcescens strain AR_0091 chromosome, complete genome	5309542	3058156	3098898	5309542	tail,lysis,protease,head,capsid,terminase,portal,integrase	Enterobacteria_phage(32.5%)	56	3053880:3053899	3108774:3108793
3053880:3053899	attL	GCGGTATTGGCCGCCGAGGT	NA	NA	NA	NA
WP_072271590.1|3058156_3059317_-	hypothetical protein	NA	A0A1I9SF20	Klebsiella_phage	49.7	3.5e-31
WP_154640823.1|3059320_3059497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106046308.1|3059497_3060451_-	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	45.3	6.8e-65
WP_060437588.1|3060500_3061490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106046309.1|3061491_3064698_-	host specificity protein J	NA	F1C571	Cronobacter_phage	64.8	0.0e+00
WP_106046310.1|3064870_3065110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158702818.1|3065116_3065275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106046311.1|3065296_3065923_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	53.2	5.3e-50
WP_158702819.1|3065978_3066338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106046312.1|3066377_3067082_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	76.3	3.9e-110
WP_047574429.1|3067090_3067840_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	66.9	4.3e-99
WP_106046313.1|3067852_3068191_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	56.4	1.6e-32
WP_106046314.1|3068190_3071139_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	27.3	5.4e-44
WP_106046315.1|3071371_3071731_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_075202145.1|3071740_3072004_-	immunoglobulin domain-containing protein	NA	Q7Y402	Yersinia_phage	59.3	3.8e-18
WP_033655098.1|3072000_3072456_-	hypothetical protein	NA	Q7Y403	Yersinia_phage	73.5	8.0e-56
WP_033655097.1|3072490_3072895_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	68.1	2.2e-41
WP_106046316.1|3072891_3073281_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	52.7	2.4e-32
WP_048796895.1|3073267_3073606_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	50.9	5.8e-19
WP_049272269.1|3073602_3073929_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	56.5	2.0e-32
WP_106046317.1|3073937_3074123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106046318.1|3074171_3075392_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	80.2	8.2e-180
WP_033655091.1|3075407_3076259_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	79.8	8.4e-123
WP_106046319.1|3076271_3077576_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	80.9	3.8e-207
WP_106046320.1|3077575_3079321_-|terminase	terminase large subunit	terminase	M4QNU0	Tetraselmis_viridis_virus	43.0	3.2e-137
WP_047574388.1|3079271_3079739_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.8	3.1e-47
WP_060437661.1|3079863_3080193_-	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	64.9	3.5e-37
WP_072271586.1|3080257_3080554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060437575.1|3080625_3080847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060437574.1|3081009_3081294_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	64.9	3.2e-26
WP_060437573.1|3081290_3081818_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	54.8	6.5e-33
WP_106046336.1|3081817_3082294_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	62.8	1.4e-50
WP_033646506.1|3082302_3082548_-|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	36.2	1.2e-05
WP_106046321.1|3082704_3083727_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	61.5	8.8e-119
WP_106046322.1|3083945_3084686_-	restriction endonuclease	NA	A0A1P8VV61	Rathayibacter_phage	30.6	1.2e-08
WP_106046323.1|3084672_3085599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106046324.1|3085831_3086503_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	44.5	1.9e-45
WP_106046325.1|3086499_3087078_-	protein NinG	NA	A0A1P8DTE0	Proteus_phage	63.3	1.3e-39
WP_106046326.1|3087061_3088048_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.3	9.4e-110
WP_106046327.1|3088044_3089574_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	65.6	2.9e-198
WP_106046328.1|3090098_3090632_-	DNA-binding protein	NA	S5FXP0	Shigella_phage	53.5	1.4e-43
WP_079450243.1|3090706_3090901_-	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	80.6	4.6e-21
WP_106046337.1|3091009_3091720_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	66.8	1.4e-86
WP_106046329.1|3092099_3092258_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	52.3	4.9e-05
WP_060706781.1|3092272_3092716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157783371.1|3092763_3092976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158702820.1|3093073_3093343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046687498.1|3093528_3093891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060437565.1|3093933_3094755_+	DUF2303 family protein	NA	R9TSA8	Rhizobium_phage	29.4	1.6e-17
WP_060437564.1|3094827_3095661_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	59.4	3.3e-87
WP_060437563.1|3095657_3095876_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.3	3.0e-08
WP_158702821.1|3095990_3096491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154640822.1|3096704_3096893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060435612.1|3096953_3097517_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	63.8	7.3e-67
WP_072271584.1|3097541_3097733_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	68.3	7.3e-19
WP_060437561.1|3097713_3098898_-|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	67.7	6.5e-166
3108774:3108793	attR	ACCTCGGCGGCCAATACCGC	NA	NA	NA	NA
