The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	75533	100299	4607960	tRNA,integrase,lysis,tail	Escherichia_phage(38.46%)	32	83289:83304	105900:105915
WP_000837924.1|75533_76667_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001300461.1|76807_77242_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_001157925.1|77507_77681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|78020_78134_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|78202_78436_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|78751_79342_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355360.1|79569_79863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000654171.1|79875_80154_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	2.9e-24
WP_024182056.1|80150_82175_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	3.2e-181
WP_000770037.1|82474_83239_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
83289:83304	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001291101.1|83343_83775_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	58.7	3.3e-19
WP_001097897.1|83912_85370_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|85566_85752_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000992105.1|85968_86502_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_000370546.1|86607_86880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193293.1|86845_87190_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_012775985.1|87194_87407_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	96.9	3.0e-29
WP_001169151.1|87550_87706_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_105286125.1|87702_88191_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_105929175.1|88632_88854_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	1.7e-35
WP_001352098.1|88853_89024_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|89098_89374_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105139.1|89475_92076_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
WP_105929176.1|92068_92878_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	9.8e-105
WP_001317028.1|92934_93129_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|93121_93331_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|93409_93625_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040858.1|93626_94862_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_001157407.1|94913_95849_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|95977_97351_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|97828_98812_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001301114.1|99066_100299_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	35.0	3.1e-17
105900:105915	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
>prophage 2
NZ_CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	546941	623269	4607960	integrase,lysis,tRNA,plate,terminase,protease,portal,capsid,tail	Salmonella_phage(45.45%)	78	539904:539919	626356:626371
539904:539919	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|546941_548234_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|548324_549668_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|549678_550290_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077053.1|550444_554473_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|554607_555102_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|555646_556612_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_105929179.1|556734_558501_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202189.1|558501_560223_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001241678.1|560264_560969_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|561253_561472_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934045.1|562154_564431_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.5e-166
WP_000520781.1|564461_564782_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|565104_565329_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|565401_567348_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746443.1|567344_568460_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|568610_569567_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599802.1|569563_571222_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|571646_572342_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|572836_573736_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|573879_575532_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|575543_576512_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815335.1|576644_578363_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000566356.1|578399_579401_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136577.1|579411_580842_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|580940_581954_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255168.1|581950_582781_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|582777_583101_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|583226_583742_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|583959_584688_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|584705_585437_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|585443_586160_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|586159_586828_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|587118_587850_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149743.1|588048_589176_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|589216_589705_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061667.1|589764_590610_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105444.1|590606_591560_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|591569_592703_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126069.1|592797_593910_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|594260_594737_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|594824_595727_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|595787_596510_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|596493_596781_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|596940_597198_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|597227_597605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|597874_599560_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|599795_600014_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001318481.1|600775_601315_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.5	1.5e-56
WP_000368077.1|601314_601917_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.3e-98
WP_000280166.1|601888_602326_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	75.0	1.7e-55
WP_000104800.1|602327_603950_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	78.5	6.2e-151
WP_001086815.1|603946_604552_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	2.3e-111
WP_000268294.1|604544_605453_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_000177591.1|605439_605799_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	8.0e-51
WP_000993743.1|605795_606374_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
WP_000115390.1|606477_607284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829156.1|607225_607672_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.7	7.6e-59
WP_001039932.1|607664_608096_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	3.8e-71
WP_000196203.1|608191_608620_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	8.1e-58
WP_000216259.1|608756_609509_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	94.7	3.1e-113
WP_001098413.1|609651_611418_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_000520360.1|611417_612443_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_001320043.1|612460_613423_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001034589.1|613585_614509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059831.1|614981_615317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|615509_615743_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|615753_615942_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_000017603.1|616094_618509_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
WP_000104175.1|618505_619363_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
WP_000752619.1|619359_619587_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244230.1|619586_619820_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000963472.1|619887_620229_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_000956182.1|620192_620393_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460893.1|620400_620910_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247707.1|620942_621164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047321.1|621289_621859_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	3.8e-39
WP_001321204.1|621874_622066_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_000290930.1|622252_623269_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.2e-105
626356:626371	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 3
NZ_CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	705125	716449	4607960	terminase,integrase,tail	Escherichia_phage(45.45%)	13	704433:704447	716523:716537
704433:704447	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000603805.1|705125_706271_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.9	1.6e-20
WP_000394418.1|706308_707646_-	hypothetical protein	NA	A0A2D2W3A0	Escherichia_phage	56.4	5.5e-145
WP_000204789.1|708038_709064_+	acyltransferase	NA	G9L6E5	Escherichia_phage	28.9	2.4e-15
WP_001104982.1|709105_709501_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	36.6	1.6e-12
WP_001130801.1|710769_712392_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_001218995.1|712394_712946_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
WP_001472362.1|712899_713514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113283.1|713646_713832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376718.1|714341_714626_+	DUF4752 family protein	NA	G9L657	Escherichia_phage	94.7	3.2e-47
WP_000002107.1|714618_714903_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000545729.1|714975_715143_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	2.9e-27
WP_001303849.1|715182_715401_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|715378_716449_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
716523:716537	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 4
NZ_CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	910392	965348	4607960	integrase,lysis,transposase,protease,tail	Enterobacteria_phage(44.44%)	53	940823:940869	965362:965408
WP_001300563.1|910392_911505_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|911581_911734_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_105929221.1|911831_911960_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	3.3e-15
WP_001130654.1|914003_915122_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682514.1|915187_915436_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|915500_915869_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351477.1|915962_916616_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153155.1|916723_917971_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786310.1|918038_919415_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573928.1|919516_922660_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	1.7e-59
WP_000717157.1|922671_923895_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709865.1|923910_924243_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074253.1|924400_925774_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770941.1|925930_926614_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000253837.1|926603_928052_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_105929182.1|928788_930387_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	2.5e-27
WP_089581168.1|930349_930796_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.2	7.2e-17
WP_000889443.1|930828_931089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300892.1|931214_931376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105929183.1|932340_933477_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001300620.1|935971_938944_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224575.1|938944_939835_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177481.1|940017_940779_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
940823:940869	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|941292_942246_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|942494_943244_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_105929184.1|943919_944213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105929185.1|944223_944928_-	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	61.1	4.1e-59
WP_000654156.1|944937_945219_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_105929186.1|945215_947561_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
WP_103857208.1|947619_950451_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	87.5	0.0e+00
WP_001415975.1|951359_951554_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|951914_952208_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|952298_952481_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|952697_953195_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|953194_953410_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001204780.1|956047_956431_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971071.1|956516_956657_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001099655.1|956653_957016_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
WP_000774479.1|957012_957303_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224907.1|957295_957466_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001054340.1|957465_957921_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|957917_958019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|958135_958933_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|958942_959494_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|959958_961485_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001299444.1|961542_961692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070454.1|961739_962072_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|962139_962442_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001386642.1|963061_963343_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763373.1|963441_963660_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488419.1|963707_963986_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000446905.1|963957_964329_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_001318654.1|964184_965348_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	1.3e-198
965362:965408	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 5
NZ_CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3347281	3360464	4607960		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|3347281_3348043_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3348036_3348663_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|3348802_3349942_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3350004_3350997_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104459.1|3351090_3352455_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136925.1|3352543_3353320_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3353324_3353963_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590371.1|3353959_3355222_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	4.9e-135
WP_000847971.1|3355218_3356127_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001295181.1|3356322_3357090_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141307.1|3357140_3357797_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_001272928.1|3357902_3360464_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 6
NZ_CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3942194	3951636	4607960		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569344.1|3942194_3943121_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_000783120.1|3943125_3943857_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216966.1|3943837_3943945_-	protein YohO	NA	NA	NA	NA	NA
WP_001240403.1|3944004_3944736_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3944957_3946643_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3946639_3947359_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3947405_3947876_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|3947916_3948378_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_105929207.1|3948502_3950503_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_001300968.1|3950499_3951636_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 7
NZ_CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3963268	4014048	4607960	tail,plate,integrase,tRNA	Escherichia_phage(29.17%)	52	3987569:3987591	4009725:4009747
WP_001300978.1|3963268_3965302_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
WP_001005448.1|3965433_3966543_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_012777768.1|3966805_3966994_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_112843499.1|3967985_3968180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012777764.1|3969096_3969360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000858919.1|3969553_3970219_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001276099.1|3970322_3970754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001318412.1|3970800_3971040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195564.1|3971368_3972157_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822257.1|3972153_3972954_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001300994.1|3973018_3973837_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.9e-24
WP_000434038.1|3973888_3974635_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011997.1|3974608_3975574_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846243.1|3975570_3976575_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	5.8e-14
WP_000858501.1|3976571_3977849_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|3978105_3979158_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001300977.1|3979457_3980312_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853869.1|3980340_3981603_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182921.1|3981612_3982065_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823266.1|3982095_3982380_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|3982383_3983739_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|3983786_3984827_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|3984926_3985706_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807361.1|3985787_3986687_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001318299.1|3987091_3987409_+	hypothetical protein	NA	NA	NA	NA	NA
3987569:3987591	attL	AAAAAATAAGCCCGTGTAAGGGA	NA	NA	NA	NA
WP_000985261.1|3987674_3988688_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|3988803_3989103_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|3989224_3989500_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217677.1|3989677_3990178_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557697.1|3990241_3990466_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	95.9	1.5e-31
WP_001277898.1|3990465_3990765_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113266.1|3990767_3990992_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	1.5e-34
WP_000027664.1|3990988_3991264_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_065273924.1|3991253_3993536_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063128.1|3993624_3994848_+	protein SERAC1	NA	NA	NA	NA	NA
WP_065273982.1|3994894_3995347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844440.1|3995346_3997314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490543.1|3998615_3999401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093750.1|3999484_4000120_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127144.1|4000116_4000464_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	1.1e-57
WP_001121455.1|4000468_4001377_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	8.3e-161
WP_001285323.1|4001369_4001900_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_000104717.1|4001910_4004769_+|tail	phage tail protein	tail	A0A0A0YPY9	Escherichia_phage	76.7	0.0e+00
WP_000348282.1|4004980_4006093_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_105929208.1|4006070_4006298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001286736.1|4007340_4008531_+|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	98.2	2.6e-223
WP_001251411.1|4008543_4009323_+|tail	major tail tube protein	tail	A0A0F7LDR0	Escherichia_phage	98.8	1.9e-73
WP_000468308.1|4009404_4009623_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|4009895_4011257_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
4009725:4009747	attR	AAAAAATAAGCCCGTGTAAGGGA	NA	NA	NA	NA
WP_000929408.1|4011402_4011735_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|4011925_4012648_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|4012644_4014048_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 8
NZ_CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4060260	4069117	4607960		Enterobacteria_phage(42.86%)	8	NA	NA
WP_001115981.1|4060260_4061655_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_000183060.1|4061829_4062723_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699450.1|4063095_4064181_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
WP_001023616.1|4064180_4065080_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000857508.1|4065138_4066017_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
WP_001100801.1|4066021_4066567_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.9	1.6e-47
WP_001060533.1|4066570_4067995_+	O7 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000998544.1|4068004_4069117_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.7	1.3e-14
>prophage 9
NZ_CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4461805	4514562	4607960	lysis,protease,transposase,tail	Escherichia_phage(26.47%)	64	NA	NA
WP_001260835.1|4461805_4462627_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4462726_4462810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743942.1|4462902_4463238_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|4463634_4464888_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|4464994_4465888_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|4466022_4467243_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|4467367_4468063_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|4468015_4469308_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|4469466_4470081_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|4470123_4470978_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4470979_4471597_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|4471607_4474031_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041695.1|4474091_4476518_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	5.0e-213
WP_001300836.1|4476716_4477022_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|4477129_4477840_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|4477842_4478403_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|4478437_4478779_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|4478913_4479240_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|4479445_4480660_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836067.1|4480671_4481691_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001531709.1|4481748_4481853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296941.1|4483192_4483429_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048322.1|4483516_4485988_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.2	5.0e-59
WP_001083270.1|4486081_4486273_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854560.1|4486269_4486458_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000159335.1|4486960_4487161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001320327.1|4487129_4487495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|4487506_4487659_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000381212.1|4487827_4488235_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|4488315_4488543_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705360.1|4488526_4489048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054497.1|4489028_4489994_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_001151183.1|4490034_4490457_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
WP_001366387.1|4490453_4490687_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
WP_021568046.1|4490740_4491406_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000887491.1|4491961_4492174_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000981003.1|4492390_4492642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012775982.1|4492708_4492987_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265279.1|4492988_4493639_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	70.3	2.6e-68
WP_001204787.1|4493656_4494034_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|4494189_4494714_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_085947771.1|4495083_4496246_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001146314.1|4497533_4498247_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839587.1|4498437_4498653_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_000189920.1|4498657_4499209_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	49.4	3.3e-35
WP_001557934.1|4499156_4499417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|4499530_4500064_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071781.1|4500060_4500558_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|4500921_4501134_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|4501144_4501333_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|4501480_4501636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|4501808_4501982_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|4502277_4502484_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_085947771.1|4502637_4503800_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001230558.1|4505235_4505835_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	4.5e-107
WP_000741760.1|4505899_4508278_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.8	3.4e-137
WP_001205170.1|4508277_4508559_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	4.5e-17
WP_105929217.1|4508568_4509273_+	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.9e-59
WP_097749469.1|4509283_4509577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078178.1|4509804_4510395_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|4510710_4510944_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4511012_4511126_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|4511729_4513013_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527826.1|4513101_4514562_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.3	2.8e-41
