The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027418	Providencia rettgeri strain FDAARGOS_330 chromosome, complete genome	4518601	1973893	1982338	4518601		Escherichia_phage(50.0%)	8	NA	NA
WP_071547662.1|1973893_1976314_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	37.9	4.8e-139
WP_042848441.1|1976310_1976949_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.8	1.9e-63
WP_042848439.1|1976945_1977845_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_042848437.1|1977882_1978449_+	molecular chaperone TorD family protein	NA	A0A077SLS7	Escherichia_phage	31.3	2.7e-16
WP_071547663.1|1978641_1979097_+	DoxX family protein	NA	NA	NA	NA	NA
WP_071547664.1|1979184_1979979_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	41.7	3.0e-42
WP_071547665.1|1979990_1981217_-	RtcB family protein	NA	A0A1V0EEW8	Caulobacter_phage	62.9	9.5e-136
WP_042848432.1|1981219_1982338_-	slipin family protein	NA	A0A2P1EMF1	Moumouvirus	28.1	1.3e-14
>prophage 2
NZ_CP027418	Providencia rettgeri strain FDAARGOS_330 chromosome, complete genome	4518601	2546069	2556668	4518601		Mycobacterium_phage(25.0%)	11	NA	NA
WP_042848391.1|2546069_2547269_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.5	4.5e-29
WP_042848390.1|2547996_2548968_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.2	1.3e-132
WP_071547823.1|2548982_2551115_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.6	1.4e-206
WP_042848388.1|2551127_2551541_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	33.6	2.9e-12
WP_042848387.1|2551549_2551777_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.2	1.4e-16
WP_042848385.1|2552064_2552523_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L300	Tupanvirus	46.6	6.0e-19
WP_014657708.1|2552740_2552950_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	7.7e-22
WP_042848383.1|2553106_2554072_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_071547824.1|2554196_2554826_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_042848378.1|2555057_2555321_-	YbeD family protein	NA	NA	NA	NA	NA
WP_071547825.1|2555456_2556668_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.9	5.9e-106
>prophage 3
NZ_CP027418	Providencia rettgeri strain FDAARGOS_330 chromosome, complete genome	4518601	2713970	2781733	4518601	lysis,tRNA,protease	Planktothrix_phage(12.5%)	59	NA	NA
WP_071547852.1|2713970_2714858_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_071547866.1|2715012_2716710_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_042846570.1|2717138_2717762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547867.1|2717821_2718514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547868.1|2718517_2719609_+|protease	serine protease	protease	NA	NA	NA	NA
WP_071547869.1|2719719_2720607_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_042846566.1|2720811_2721507_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_042846565.1|2721506_2721974_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_105880943.1|2722118_2724146_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.8	1.8e-54
WP_042846563.1|2724484_2725597_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_042846562.1|2725880_2726441_+	LemA family protein	NA	NA	NA	NA	NA
WP_042846560.1|2726542_2727499_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_042846559.1|2727678_2728323_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	42.2	6.3e-38
WP_042846558.1|2728365_2728947_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.0	4.8e-29
WP_048606515.1|2729074_2730913_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_071547870.1|2730962_2731643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042846555.1|2731825_2733409_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	3.7e-39
WP_042846554.1|2733651_2735058_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.5	2.7e-33
WP_071547871.1|2735246_2736434_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	28.0	3.7e-28
WP_105880944.1|2736517_2739679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042846551.1|2739965_2740607_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	39.5	3.6e-17
WP_042846643.1|2740656_2741133_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_071547873.1|2741482_2743660_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_081363939.1|2743720_2744707_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071547874.1|2744741_2745353_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_071547875.1|2745346_2746123_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_071547876.1|2746104_2746842_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_042846544.1|2746847_2747441_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_042846543.1|2747440_2748508_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_048606525.1|2748521_2749592_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_048606526.1|2749595_2750912_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_042846642.1|2750918_2751818_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	81.6	5.5e-08
WP_042846540.1|2752254_2753082_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_042846539.1|2753082_2753706_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_071547877.1|2753938_2755144_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	46.6	5.5e-96
WP_048606527.1|2755219_2756587_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_042846536.1|2756661_2757978_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_042846534.1|2758828_2759437_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_042846533.1|2759639_2760068_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_042846532.1|2760314_2760578_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	72.6	3.1e-28
WP_042846531.1|2760737_2761064_+	YbjC family protein	NA	NA	NA	NA	NA
WP_042846530.1|2761200_2761719_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_048606529.1|2761728_2762856_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	2.1e-28
WP_048606531.1|2762985_2763654_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_042846526.1|2763650_2764391_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_042846525.1|2764403_2765147_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042846524.1|2765165_2765894_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	38.6	3.4e-32
WP_042846523.1|2765992_2767474_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_048606535.1|2767525_2768425_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_071547878.1|2768816_2770481_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_048606537.1|2770692_2771799_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_042846519.1|2771800_2773744_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.8e-40
WP_042846518.1|2774213_2775566_+	cytosine permease	NA	NA	NA	NA	NA
WP_048606539.1|2775569_2776403_+	hydrolase	NA	NA	NA	NA	NA
WP_042846516.1|2776399_2777149_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071547879.1|2777399_2778362_+	DUF1177 domain-containing protein	NA	NA	NA	NA	NA
WP_071547880.1|2778456_2778699_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	2.1e-15
WP_042846513.1|2779099_2779420_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	50.0	3.7e-15
WP_048606557.1|2779450_2781733_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.4	9.9e-171
>prophage 4
NZ_CP027418	Providencia rettgeri strain FDAARGOS_330 chromosome, complete genome	4518601	2907898	2919363	4518601	integrase	Morganella_phage(66.67%)	20	2902140:2902154	2923363:2923377
2902140:2902154	attL	TGTTGATATTGTTTA	NA	NA	NA	NA
WP_008915269.1|2907898_2909110_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.8	3.7e-132
WP_105880948.1|2909323_2910256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191901882.1|2910407_2910629_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.4	7.4e-07
WP_105880949.1|2910628_2911024_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	59.6	3.8e-30
WP_105880950.1|2911036_2911633_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	71.2	2.3e-74
WP_105881216.1|2912619_2912844_+	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	49.2	5.2e-08
WP_004265088.1|2912836_2913010_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_105880951.1|2913012_2913204_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	55.6	3.6e-10
WP_004255433.1|2913200_2913362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004255431.1|2913358_2913538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105880952.1|2913534_2913744_+	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	49.3	1.4e-10
WP_105880953.1|2913740_2914325_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	58.0	3.1e-28
WP_192575026.1|2914321_2914495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105880954.1|2914494_2914689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105880955.1|2914688_2914910_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	39.2	8.8e-08
WP_105880956.1|2914906_2915503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105880957.1|2915517_2915862_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	75.4	4.4e-46
WP_105880958.1|2915858_2918606_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.8	3.8e-233
WP_192575027.1|2918626_2918767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105880959.1|2918925_2919363_+	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	66.7	2.4e-17
2923363:2923377	attR	TAAACAATATCAACA	NA	NA	NA	NA
>prophage 5
NZ_CP027418	Providencia rettgeri strain FDAARGOS_330 chromosome, complete genome	4518601	2985141	3023084	4518601	lysis,head,tail,terminase,integrase,plate	Salmonella_phage(35.29%)	58	2977573:2977588	3010206:3010221
2977573:2977588	attL	CACCTGAGTATAAAGC	NA	NA	NA	NA
WP_105880972.1|2985141_2986344_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	52.4	2.2e-124
WP_105881218.1|2986355_2986547_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	58.5	1.0e-12
WP_105880973.1|2986564_2986882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880974.1|2986868_2987264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880975.1|2987250_2987499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880976.1|2987495_2987723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880977.1|2987736_2988309_-	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	44.6	2.9e-26
WP_105880978.1|2988308_2989139_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	61.0	1.1e-95
WP_105880979.1|2989141_2989357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881219.1|2989353_2989542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880980.1|2989555_2989861_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_105880981.1|2989857_2990199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880982.1|2990273_2990696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880983.1|2990697_2991186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880984.1|2991188_2991374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192575029.1|2991373_2991550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192575030.1|2991542_2991680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880985.1|2991737_2991953_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_105881220.1|2992539_2993205_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	60.6	7.1e-77
WP_048606683.1|2993295_2993532_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080972708.1|2993524_2993779_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	51.9	5.3e-17
WP_105880986.1|2994037_2995606_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	69.2	1.6e-215
WP_105880987.1|2995602_2996583_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	55.9	8.2e-106
WP_105880988.1|2996582_2996966_+	antitermination protein	NA	A0A088CD47	Shigella_phage	68.3	1.3e-46
WP_151457916.1|2997071_2997434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880991.1|2997724_2998627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004912034.1|2998791_2999061_+	phage protein	NA	A0A2H4FNF0	Salmonella_phage	67.8	1.1e-25
WP_105880992.1|2999060_2999531_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	56.6	2.4e-47
WP_192575031.1|2999512_2999686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105880993.1|2999706_3000162_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	44.4	4.9e-21
WP_105880994.1|3000158_3000575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105880995.1|3000660_3001401_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_105881221.1|3001400_3002711_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4JCM3	uncultured_Caudovirales_phage	60.6	2.0e-144
WP_105880996.1|3002927_3004385_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	52.4	2.3e-144
WP_192575046.1|3004452_3005001_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	53.9	4.1e-46
WP_105880997.1|3005051_3006326_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	45.2	5.7e-75
WP_105880998.1|3006336_3006840_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	47.6	2.2e-30
WP_105880999.1|3006850_3007798_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	56.7	4.1e-102
WP_048606717.1|3007837_3008212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881000.1|3008180_3008591_+	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	54.1	4.7e-31
WP_105881001.1|3008587_3009097_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	36.3	7.9e-20
WP_070926288.1|3009096_3009483_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	71.8	9.2e-45
WP_105881002.1|3009475_3010021_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	59.7	5.5e-59
WP_105881003.1|3010024_3011488_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	51.0	9.3e-130
3010206:3010221	attR	CACCTGAGTATAAAGC	NA	NA	NA	NA
WP_105881004.1|3011495_3011939_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	65.0	6.0e-48
WP_105881005.1|3011938_3012340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881006.1|3012523_3014803_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	51.3	4.9e-101
WP_105881007.1|3014802_3015399_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	53.6	1.2e-46
WP_105881008.1|3015408_3015723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151457917.1|3015833_3016394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881010.1|3016503_3017454_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	37.5	4.4e-64
WP_192575032.1|3017450_3018203_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	65.1	2.8e-77
WP_105881011.1|3018202_3018547_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	52.6	2.7e-24
WP_105881012.1|3018546_3019734_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J5T1	uncultured_Caudovirales_phage	50.4	2.0e-106
WP_105881013.1|3019730_3020387_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	45.4	3.9e-51
WP_105881224.1|3021205_3021904_+|tail	tail fiber protein	tail	A0A219YBC2	Aeromonas_phage	53.7	3.0e-33
WP_105881014.1|3021903_3022521_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	39.9	5.3e-34
WP_048606755.1|3022679_3023084_-	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	38.6	2.0e-10
>prophage 6
NZ_CP027418	Providencia rettgeri strain FDAARGOS_330 chromosome, complete genome	4518601	3281803	3289256	4518601		Tupanvirus(33.33%)	7	NA	NA
WP_004263721.1|3281803_3282100_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_042844064.1|3282176_3283115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048606996.1|3283230_3284232_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.4	6.2e-16
WP_042844062.1|3284237_3285005_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	28.4	3.4e-06
WP_042844061.1|3285133_3286279_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	27.4	8.0e-36
WP_042844059.1|3286278_3287271_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.4	4.3e-38
WP_042844058.1|3287270_3289256_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.3	1.9e-21
>prophage 7
NZ_CP027418	Providencia rettgeri strain FDAARGOS_330 chromosome, complete genome	4518601	3911845	3955389	4518601	lysis,tail,head,terminase,integrase,plate	Pectobacterium_phage(18.6%)	66	3931546:3931560	3955550:3955564
WP_105881038.1|3911845_3911998_-	hypothetical protein	NA	Q77Z09	Phage_21	88.0	8.4e-18
WP_105881039.1|3912229_3912475_+	DinI-like family protein	NA	NA	NA	NA	NA
WP_105881040.1|3912471_3912750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881041.1|3913039_3913813_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_105881042.1|3913962_3915486_-|tail	phage tail protein	tail	A0A0F6R6B6	Escherichia_coli_O157_typing_phage	43.6	5.5e-40
WP_105881043.1|3915491_3916151_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	41.7	5.6e-42
WP_105881044.1|3916147_3917335_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	38.7	1.1e-75
WP_105881045.1|3917327_3917672_-	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	36.6	4.9e-13
WP_105881046.1|3917668_3918361_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	41.3	1.0e-30
WP_105881047.1|3918364_3919180_-	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	29.2	9.8e-20
WP_105881048.1|3919172_3919466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881049.1|3919469_3919997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881225.1|3919993_3922120_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.4	3.6e-21
WP_096863413.1|3922586_3923045_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	49.2	2.8e-24
WP_096863412.1|3923096_3923549_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	39.6	1.4e-23
WP_105881050.1|3923558_3925046_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.2	2.4e-80
WP_105881051.1|3925056_3925572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881052.1|3925561_3925930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881053.1|3925929_3926388_-	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	39.8	4.5e-14
WP_080972721.1|3926387_3926819_-	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	34.5	5.2e-12
WP_105881054.1|3926821_3927163_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	34.5	1.0e-07
WP_105881055.1|3927219_3928287_-	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	36.3	7.4e-52
WP_105881056.1|3928286_3928784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881057.1|3928783_3930040_-	DUF2213 domain-containing protein	NA	A0A2H5BG39	Pseudoalteromonas_phage	44.6	3.0e-36
WP_105881058.1|3930036_3930750_-|head	phage head morphogenesis protein	head	Q6IWU3	Burkholderia_phage	39.0	3.7e-39
WP_105881059.1|3930787_3932290_-	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	43.4	3.1e-104
3931546:3931560	attL	CAAAGTAGTTATAAA	NA	NA	NA	NA
WP_105881060.1|3932294_3933692_-|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	1.5e-84
WP_105881061.1|3933890_3934910_-|terminase	terminase small subunit	terminase	Q6V7Q7	Burkholderia_virus	45.2	6.9e-47
WP_105881062.1|3935024_3935264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881063.1|3935391_3936081_-	Rha family transcriptional regulator	NA	Q5G8R0	Enterobacteria_phage	71.6	3.0e-94
WP_105881064.1|3936502_3936964_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	40.4	5.0e-13
WP_192575035.1|3936972_3937146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881065.1|3937127_3937598_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	55.9	2.0e-46
WP_105881066.1|3937597_3937867_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	64.4	8.1e-24
WP_105881067.1|3938109_3938454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881068.1|3938580_3939114_-	antiterminator	NA	Q5TJL7	Enterobacteria_phage	54.5	9.8e-37
WP_105881069.1|3939101_3939416_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	72.9	4.9e-36
WP_105881070.1|3939427_3940021_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	58.7	8.0e-64
WP_105881071.1|3940097_3940436_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	61.7	2.7e-32
WP_105881072.1|3940525_3940765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881073.1|3940768_3940981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881074.1|3940984_3941335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881075.1|3941339_3941636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881076.1|3941650_3942184_-	hypothetical protein	NA	Q7Y3W6	Yersinia_phage	49.3	5.2e-14
WP_105881077.1|3942176_3942473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881078.1|3942469_3942700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881079.1|3942702_3942873_-	palmdelphin	NA	NA	NA	NA	NA
WP_192575036.1|3942894_3944262_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	45.9	5.0e-101
WP_105881080.1|3944258_3944849_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	48.7	5.2e-47
WP_105881081.1|3944841_3945654_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	77.4	1.7e-40
WP_105881082.1|3945655_3945880_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	62.2	7.3e-18
WP_004912077.1|3945897_3946353_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.0e-26
WP_105881083.1|3946391_3946577_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP24	Morganella_phage	58.0	7.3e-08
WP_105881227.1|3946684_3947326_+	LexA family transcriptional regulator	NA	A0A1W6JP50	Morganella_phage	37.8	6.7e-32
WP_105881084.1|3947810_3948143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881085.1|3948151_3948403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881086.1|3948415_3950455_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	38.7	1.2e-122
WP_105881087.1|3950454_3950955_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	54.0	4.1e-37
WP_105881088.1|3951001_3951181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881089.1|3951211_3951442_+	hypothetical protein	NA	A0A2H4JB60	uncultured_Caudovirales_phage	54.7	5.5e-13
WP_105881090.1|3951438_3952041_+	HNH endonuclease	NA	M1PKJ5	Streptococcus_phage	34.7	2.7e-19
WP_192575037.1|3952034_3952205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881091.1|3952447_3952654_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	44.1	3.8e-05
WP_192575038.1|3952653_3952905_+	excisionase	NA	NA	NA	NA	NA
WP_105881092.1|3952879_3954013_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	71.4	2.8e-150
WP_105881093.1|3954135_3955389_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.4e-20
3955550:3955564	attR	TTTATAACTACTTTG	NA	NA	NA	NA
>prophage 8
NZ_CP027418	Providencia rettgeri strain FDAARGOS_330 chromosome, complete genome	4518601	4195374	4246728	4518601	tail,integrase,capsid,terminase	Morganella_phage(28.57%)	83	4195185:4195210	4246921:4246946
4195185:4195210	attL	AAAGTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
WP_105881100.1|4195374_4197756_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	44.6	1.3e-32
WP_105881101.1|4197817_4200295_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	48.1	2.7e-230
WP_105881102.1|4200281_4200674_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	56.5	2.0e-42
WP_105881103.1|4200673_4201141_-	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	52.3	8.3e-40
WP_105881104.1|4201137_4201620_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	65.0	4.5e-57
WP_147675377.1|4202071_4202437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881106.1|4202455_4205725_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	28.9	1.5e-79
WP_105881107.1|4205836_4206358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881108.1|4206357_4206696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881109.1|4206748_4207633_-	hypothetical protein	NA	W6AT81	Vibrio_phage	52.5	7.6e-10
WP_105881110.1|4207756_4208107_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	48.0	2.2e-13
WP_105881111.1|4208228_4208396_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	43.1	5.2e-05
WP_105881229.1|4208694_4209198_+	phage antirepressor KilAC domain-containing protein	NA	A0A0U4J8Z7	Pseudomonas_phage	43.3	4.4e-23
WP_105881112.1|4209194_4210265_+	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	65.8	1.7e-35
WP_105881113.1|4210327_4210705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881114.1|4210704_4210953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881115.1|4210953_4211271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006661960.1|4211592_4211838_+	Arc family DNA-binding protein	NA	A0A0M5M1J2	Salmonella_phage	52.5	1.5e-16
WP_105881116.1|4211861_4212143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881117.1|4212230_4212479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881118.1|4212481_4213168_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	55.2	1.5e-61
WP_105881119.1|4213216_4213957_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	47.2	2.3e-52
WP_105881120.1|4214018_4214387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881121.1|4214383_4214752_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	71.3	9.1e-42
WP_105881122.1|4214753_4215125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881123.1|4215126_4215504_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	60.0	1.2e-36
WP_105881124.1|4215547_4216495_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	85.8	8.1e-151
WP_105881125.1|4216500_4217187_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	73.6	4.4e-66
WP_105881126.1|4217261_4218326_-|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	51.4	1.6e-102
WP_105881127.1|4218334_4219711_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.4	1.1e-212
WP_105881128.1|4219712_4221197_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	87.4	1.3e-267
WP_070929136.1|4221199_4221715_-	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	55.0	1.2e-47
WP_105881129.1|4221724_4222228_-	HNH endonuclease	NA	A0A173GC65	Salmonella_phage	48.5	8.9e-40
WP_105881130.1|4222403_4222661_-	DUF2560 family protein	NA	NA	NA	NA	NA
WP_105881132.1|4223089_4223323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881133.1|4223333_4223873_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	65.2	7.3e-64
WP_192575039.1|4224480_4224813_-	hypothetical protein	NA	A0A1P8DTG0	Proteus_phage	47.0	6.8e-12
WP_105881135.1|4224809_4225202_-	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	82.8	1.5e-55
WP_105881136.1|4225164_4225467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881137.1|4225463_4225877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168697653.1|4226134_4226293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881138.1|4226644_4227148_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	80.2	8.0e-73
WP_105881139.1|4227144_4227348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881140.1|4227337_4227703_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	69.2	2.0e-41
WP_105881141.1|4227699_4227990_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	78.1	2.6e-36
WP_105881142.1|4228089_4228413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881144.1|4228605_4229052_-	DUF1367 family protein	NA	A0A096XEN2	Escherichia_phage	65.8	1.6e-53
WP_105881146.1|4229290_4229548_-	hypothetical protein	NA	A0A1P8DTF4	Proteus_phage	90.5	2.4e-41
WP_105881148.1|4229874_4230096_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_105881150.1|4230289_4230493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881151.1|4230518_4231247_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	74.8	2.7e-98
WP_105881152.1|4231246_4232032_-	hypothetical protein	NA	G8C7U5	Escherichia_phage	57.6	4.3e-81
WP_172597506.1|4232031_4232721_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_004255330.1|4232790_4233135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881154.1|4233266_4233473_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW6	Morganella_phage	71.7	8.7e-10
WP_105881155.1|4233571_4234243_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	73.8	9.0e-88
WP_105881156.1|4234329_4235391_+	hypothetical protein	NA	U5P4L0	Shigella_phage	60.9	1.4e-114
WP_105881157.1|4235407_4235914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881158.1|4236351_4236660_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	59.2	1.8e-19
WP_192575040.1|4236699_4236909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151457919.1|4236911_4237262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881161.1|4237316_4237826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881162.1|4237855_4238071_+	hypothetical protein	NA	A0A1P8DTG4	Proteus_phage	49.1	8.0e-06
WP_105881163.1|4238072_4238327_+	hypothetical protein	NA	A0A249XWT3	Proteus_phage	57.9	4.1e-17
WP_105881164.1|4238391_4239390_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	46.3	3.3e-09
WP_165568291.1|4239456_4239606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881166.1|4239806_4240013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881167.1|4240009_4240828_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	90.1	2.7e-147
WP_105881168.1|4240820_4241639_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	89.2	5.6e-132
WP_105881169.1|4241631_4242093_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	80.9	3.5e-51
WP_105881170.1|4242155_4242413_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	43.5	1.4e-12
WP_105881171.1|4242431_4242590_+	hook protein	NA	NA	NA	NA	NA
WP_105881172.1|4242624_4242945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881173.1|4242944_4243211_+	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	37.9	6.4e-05
WP_105881174.1|4243203_4243500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881175.1|4243660_4243888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_192575041.1|4243877_4244054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881176.1|4244046_4244256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881177.1|4244252_4244612_+	DUF2591 family protein	NA	A0A1P8DTH6	Proteus_phage	41.2	3.4e-09
WP_105881178.1|4244601_4245147_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	60.3	6.0e-58
WP_105881179.1|4245154_4245391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070929098.1|4245383_4245575_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	47.3	1.2e-08
WP_070929097.1|4245552_4246728_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	76.5	9.0e-184
4246921:4246946	attR	AAAGTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
>prophage 9
NZ_CP027418	Providencia rettgeri strain FDAARGOS_330 chromosome, complete genome	4518601	4378407	4446466	4518601	transposase,lysis,tRNA,tail,integrase,plate	Burkholderia_phage(20.0%)	67	4374772:4374788	4400529:4400545
4374772:4374788	attL	TATTTTTGCCATTTAAG	NA	NA	NA	NA
WP_042844728.1|4378407_4379142_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_042844731.1|4379299_4380031_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071548222.1|4380033_4380951_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_042844735.1|4381223_4382429_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_042844736.1|4382612_4383944_+	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	30.9	3.3e-49
WP_071548223.1|4383973_4385419_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_042844740.1|4385577_4385961_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	69.9	5.2e-32
WP_048607890.1|4386340_4387021_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	47.6	2.3e-54
WP_042844743.1|4387140_4387734_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_042845373.1|4387835_4388735_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_105881185.1|4388820_4390482_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_042844747.1|4390594_4390987_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_042844748.1|4391168_4391465_-	RnfH family protein	NA	NA	NA	NA	NA
WP_164975517.1|4391457_4391931_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_042844751.1|4392045_4392528_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.8e-29
WP_105881186.1|4393123_4394365_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.3	2.6e-101
WP_105881187.1|4394412_4395198_-	TIGR02646 family protein	NA	NA	NA	NA	NA
WP_105881188.1|4395184_4397728_-	N-6 DNA methylase	NA	C7BGE8	Burkholderia_phage	28.0	2.7e-07
WP_105881189.1|4397967_4401171_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
4400529:4400545	attR	TATTTTTGCCATTTAAG	NA	NA	NA	NA
WP_105881190.1|4401183_4402326_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_105881191.1|4402328_4403573_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_105881192.1|4403572_4405612_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.5	1.6e-31
WP_105881193.1|4405819_4407064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881194.1|4407223_4407481_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_105881195.1|4407563_4408145_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_105881196.1|4408556_4409993_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_105881197.1|4411715_4412180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881198.1|4412281_4412620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_181488204.1|4412812_4413253_+	antirestriction protein	NA	NA	NA	NA	NA
WP_105881199.1|4413314_4414151_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.8	1.2e-44
WP_105881200.1|4414195_4415376_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.8	4.0e-115
WP_105881201.1|4415444_4415678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881202.1|4415671_4415938_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105881203.1|4416326_4417565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881204.1|4417554_4418241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881205.1|4418203_4420525_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_105881206.1|4420742_4421069_+	hypothetical protein	NA	Q716C2	Shigella_phage	57.5	4.1e-30
WP_105881207.1|4421595_4422510_+	hypothetical protein	NA	S5VKI3	Leptospira_phage	31.4	4.3e-32
WP_105881208.1|4422502_4423324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105881209.1|4423342_4423813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081363956.1|4424627_4424777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042844947.1|4425134_4426133_+	FUSC family protein	NA	NA	NA	NA	NA
WP_158516029.1|4426478_4426637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042845400.1|4426860_4427952_-	Zn-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.0	1.0e-35
WP_042844948.1|4428047_4428548_-	DUF4334 domain-containing protein	NA	NA	NA	NA	NA
WP_071548250.1|4428848_4429724_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042844950.1|4430151_4430346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548251.1|4430961_4432209_-|tail	phage tail protein	tail	E5AGC6	Erwinia_phage	40.4	8.5e-15
WP_071548252.1|4432214_4432874_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.5	2.9e-38
WP_071548253.1|4432870_4434058_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	38.7	1.7e-73
WP_071548254.1|4434050_4434395_-	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	35.7	1.8e-12
WP_071548255.1|4434391_4435084_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	39.7	5.2e-30
WP_071548256.1|4435087_4435903_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	37.5	2.3e-45
WP_071548257.1|4435895_4436192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548258.1|4436191_4436722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548259.1|4436718_4438782_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	27.3	2.5e-19
WP_071548260.1|4438846_4439533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548261.1|4439680_4440139_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.2	2.0e-22
WP_071548262.1|4440190_4440643_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	39.6	2.3e-23
WP_081363958.1|4442150_4442594_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_167363357.1|4442602_4442776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048607794.1|4442757_4443228_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.9	1.9e-47
WP_042844233.1|4443227_4443497_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	66.7	2.5e-25
WP_042844957.1|4443604_4444111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042844959.1|4444432_4444939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048607795.1|4445189_4445993_-	antitermination protein	NA	F1C595	Cronobacter_phage	43.6	1.4e-55
WP_042844962.1|4446004_4446466_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	38.3	6.5e-29
