The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	92657	163628	4960650	tail,protease	Pseudomonas_phage(21.43%)	60	NA	NA
WP_050074756.1|92657_93164_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_042568309.1|93458_93716_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	57.8	2.5e-22
WP_005192400.1|93719_94850_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	9.0e-173
WP_005192398.1|94942_97228_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	64.1	6.5e-287
WP_042568307.1|97721_98450_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_005192395.1|98651_101324_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.3	3.0e-102
WP_080608165.1|101437_104305_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.5	2.0e-43
WP_005192390.1|104530_105184_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_042568306.1|105186_107880_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_005192386.1|107902_109057_-	MFS transporter	NA	NA	NA	NA	NA
WP_005192384.1|110083_111190_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.8	5.6e-103
WP_050296715.1|111678_111921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050074759.1|112405_113998_+	MFS transporter	NA	NA	NA	NA	NA
WP_005192377.1|114023_115163_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_050296714.1|115204_116497_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_071843581.1|116676_116760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608480.1|116898_116991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050074761.1|117209_117779_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_050074762.1|118077_119142_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005192367.1|119681_120887_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_032907905.1|121285_121648_+	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_032907899.1|122172_122469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050074765.1|123123_124134_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005192359.1|124237_124483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042568297.1|125343_125895_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_080608166.1|126210_128754_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_074010376.1|129003_129915_+	adhesin	NA	NA	NA	NA	NA
WP_125461919.1|130332_130548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608167.1|130865_132191_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_032907378.1|132377_132695_-	DUF4387 domain-containing protein	NA	NA	NA	NA	NA
WP_032907376.1|132691_134065_-	acyclic terpene utilization AtuA family protein	NA	NA	NA	NA	NA
WP_032907374.1|134066_135311_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_032907373.1|135310_136756_-	methylaspartate mutase subunit E	NA	NA	NA	NA	NA
WP_032907371.1|136770_138162_-	glutamate mutase L	NA	NA	NA	NA	NA
WP_005190158.1|138158_138605_-	methylaspartate mutase subunit S	NA	NA	NA	NA	NA
WP_005190156.1|139177_140038_-	GHMP kinase	NA	NA	NA	NA	NA
WP_005190153.1|140152_140935_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_032907370.1|141451_142372_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050074739.1|142771_144418_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_005190137.1|144439_145030_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_050297006.1|145359_146502_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_032907368.1|146753_148280_-	MFS transporter	NA	NA	NA	NA	NA
WP_080608168.1|148654_149683_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_050289055.1|149755_151543_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_050074740.1|151875_152817_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_005190119.1|152987_153230_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	70.9	1.7e-25
WP_042568291.1|153479_154202_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.1	6.3e-63
WP_042568290.1|154466_154946_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	61.6	1.6e-38
WP_042568289.1|155208_155487_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	47.2	1.6e-14
WP_050074742.1|155488_156004_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	58.4	1.9e-53
WP_042568287.1|156000_156330_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_144405110.1|156343_156541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042568286.1|156638_157169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071843434.1|157173_157338_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_042568285.1|157364_158873_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	45.8	3.9e-107
WP_042568284.1|158914_159283_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_042568283.1|159284_159584_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_050074744.1|159704_161051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050297010.1|161154_162561_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	32.8	5.4e-18
WP_050297011.1|162557_163628_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	29.8	2.5e-39
>prophage 2
NZ_CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	597117	653061	4960650	tRNA,tail,terminase,transposase,head,integrase	Cronobacter_phage(33.33%)	67	601136:601152	660251:660267
WP_080608185.1|597117_598200_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.0	9.4e-103
WP_025378521.1|598174_598441_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.9	1.1e-09
WP_080608186.1|598513_599026_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	45.9	7.4e-34
WP_080608187.1|599022_601116_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.4	3.4e-93
601136:601152	attL	ATAGCTGATTTTTTGGG	NA	NA	NA	NA
WP_125461923.1|601192_601507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608189.1|601605_601836_-	hypothetical protein	NA	A0A2H4JG91	uncultured_Caudovirales_phage	43.7	1.6e-12
WP_080608190.1|602053_602389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105877047.1|602402_602576_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_080608191.1|602615_602852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608192.1|602973_603198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608193.1|603372_603765_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	55.4	1.0e-30
WP_080608194.1|603846_604044_+	helix-turn-helix domain-containing protein	NA	H9C161	Pectobacterium_phage	49.2	7.1e-09
WP_080608195.1|604084_604525_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	53.1	1.9e-33
WP_080608196.1|604538_604790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608197.1|604782_604971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608198.1|604983_606018_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	55.3	1.5e-41
WP_080608486.1|606046_606454_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	47.2	1.2e-31
WP_080608199.1|606468_606969_+	hypothetical protein	NA	H9C166	Pectobacterium_phage	44.5	3.9e-19
WP_080608200.1|606965_609131_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	50.4	1.9e-216
WP_080608201.1|609277_609460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608202.1|609534_610128_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	56.6	2.0e-59
WP_080608203.1|610136_610421_+	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	78.7	6.1e-38
WP_080608487.1|610429_610855_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	62.5	2.4e-38
WP_050297974.1|611627_612506_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_080608204.1|612702_612822_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_050297973.1|613058_613385_+	acid-activated periplasmic chaperone HdeA	NA	NA	NA	NA	NA
WP_050297972.1|613888_614176_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_050287950.1|614550_614868_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	62.1	9.3e-27
WP_080608205.1|614851_615358_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.1	3.4e-47
WP_050297037.1|615342_615678_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_050089496.1|615953_616274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608206.1|616566_616893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608207.1|617061_617664_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	73.0	4.0e-71
WP_080608208.1|617663_619145_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.0	1.1e-250
WP_080608488.1|619189_620632_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	55.3	2.6e-132
WP_080608209.1|620633_621533_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	59.7	2.2e-97
WP_105165836.1|621569_622313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608211.1|622364_623714_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.9	9.8e-126
WP_050287253.1|623714_624143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608212.1|624153_625236_+	hypothetical protein	NA	A0A125RNM3	Pseudomonas_phage	43.8	4.4e-76
WP_080608213.1|625246_625531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608214.1|625533_625914_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	49.6	7.2e-26
WP_080608215.1|625913_626225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608216.1|626221_626572_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	53.4	1.8e-26
WP_080608217.1|626573_626942_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	68.0	7.7e-41
WP_080608218.1|626938_627322_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	68.5	5.7e-47
WP_080608219.1|627346_628096_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	48.8	4.0e-52
WP_080608220.1|628235_628925_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	50.9	3.0e-54
WP_080608221.1|628917_632670_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	39.9	2.2e-159
WP_080608222.1|632666_633140_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	53.9	1.6e-46
WP_080608223.1|633139_633610_+	DUF1833 family protein	NA	B1GS46	Salmonella_phage	46.8	3.0e-37
WP_080608224.1|633645_634038_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	43.5	1.2e-28
WP_080608225.1|634024_636520_+|tail	phage tail protein	tail	A0A1B1W274	Salmonella_phage	49.1	4.4e-220
WP_080608226.1|636578_638990_+|tail	tail fiber domain-containing protein	tail	A0A291AXF7	Shigella_phage	43.6	2.2e-43
WP_080608227.1|639100_640318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608228.1|640670_641297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608229.1|641695_642667_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_080608230.1|642663_643992_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_080608231.1|644059_644287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608232.1|644436_644976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608233.1|645070_645421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608234.1|646534_647281_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_050297751.1|648551_649010_+|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	34.4	2.0e-14
WP_050297750.1|649209_649734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050297749.1|650108_650630_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050088376.1|650935_652348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161597802.1|652944_653061_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
660251:660267	attR	ATAGCTGATTTTTTGGG	NA	NA	NA	NA
>prophage 3
NZ_CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	721004	732334	4960650	tRNA	Anomala_cuprea_entomopoxvirus(16.67%)	10	NA	NA
WP_050074088.1|721004_722531_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	6.3e-12
WP_005182850.1|722871_723678_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005182848.1|723821_724535_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_032905797.1|724646_724859_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	43.5	3.4e-09
WP_005182845.1|725311_727240_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	9.7e-127
WP_011816226.1|727243_727795_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|727890_728088_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004706556.1|728125_728482_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005182843.1|728949_729933_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	3.8e-34
WP_005182841.1|729946_732334_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	4.3e-07
>prophage 4
NZ_CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	1280714	1314105	4960650	tail,terminase,holin,head,integrase,plate,lysis,capsid,portal	Escherichia_phage(39.39%)	43	1277326:1277376	1314273:1314323
1277326:1277376	attL	TTTGTTGGTGGGTCGTGCAGGGTTCGAACCTGCGACCAATTGATTAAGAGT	NA	NA	NA	NA
WP_080608265.1|1280714_1281725_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	61.3	1.1e-116
WP_080608266.1|1281734_1282322_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	35.3	9.5e-25
WP_050134119.1|1282521_1282701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105165845.1|1282728_1283250_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	38.3	2.3e-22
WP_080608267.1|1283250_1283709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176393549.1|1283910_1284087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608493.1|1284125_1284593_+	replication protein B	NA	M1SV55	Escherichia_phage	53.9	2.1e-43
WP_192945372.1|1284666_1284912_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_080608268.1|1284923_1285142_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	53.5	1.1e-13
WP_080608269.1|1285138_1287409_+	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	60.2	1.1e-265
WP_080608270.1|1287521_1287716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608271.1|1288171_1289041_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_050162496.1|1289358_1289613_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_080608272.1|1289609_1289951_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_192945337.1|1290752_1293716_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_105165846.1|1293794_1294814_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	75.1	9.3e-153
WP_080608274.1|1294813_1296577_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	80.4	3.2e-286
WP_080608275.1|1296719_1297541_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	61.1	2.5e-92
WP_080608276.1|1297562_1298630_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	72.8	9.8e-145
WP_080608277.1|1298633_1299290_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	67.6	6.8e-72
WP_080608278.1|1299379_1299886_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	78.7	2.6e-71
WP_080608279.1|1299885_1300089_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	80.6	8.0e-24
WP_080608280.1|1300079_1300301_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	71.2	6.0e-25
WP_080608281.1|1300284_1300794_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	80.2	9.6e-74
WP_080608282.1|1300790_1301216_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.2	2.4e-38
WP_080608283.1|1301103_1301349_+|holin	holin	holin	S4TNY4	Salmonella_phage	78.2	3.2e-27
WP_080608284.1|1301311_1301779_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	78.7	7.2e-68
WP_080608285.1|1301771_1302218_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.2	2.5e-49
WP_080608286.1|1302251_1302917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608287.1|1303034_1303670_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	81.5	1.2e-94
WP_080608288.1|1303666_1304014_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	73.0	1.7e-42
WP_080608289.1|1304018_1304927_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.8	1.0e-134
WP_050162476.1|1304919_1305525_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	76.9	2.0e-86
WP_080608290.1|1305529_1306804_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	44.7	4.6e-101
WP_080608291.1|1306806_1307385_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	44.5	4.4e-43
WP_080608292.1|1307514_1308705_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	89.4	1.2e-207
WP_080608293.1|1308717_1309236_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	92.4	2.2e-89
WP_080608294.1|1309296_1309578_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	84.1	2.6e-33
WP_071777697.1|1309610_1309730_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
WP_080608295.1|1309722_1312167_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	69.0	4.2e-268
WP_050877693.1|1312181_1312661_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	82.9	1.9e-71
WP_080608296.1|1312660_1313821_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	78.8	2.9e-166
WP_080608297.1|1313904_1314105_+	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	63.9	1.6e-16
1314273:1314323	attR	TTTGTTGGTGGGTCGTGCAGGGTTCGAACCTGCGACCAATTGATTAAGAGT	NA	NA	NA	NA
>prophage 5
NZ_CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	1922416	1944413	4960650	integrase,holin,transposase,protease	Proteus_phage(33.33%)	19	1933516:1933530	1954397:1954411
WP_032905703.1|1922416_1922746_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_105165850.1|1923124_1924576_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_050297884.1|1924965_1926405_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_125461927.1|1926927_1927167_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_032905700.1|1927596_1927980_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032905698.1|1928396_1928702_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_032905696.1|1928703_1929093_+	M15 family metallopeptidase	NA	A0A2I6PFM8	Proteus_phage	54.9	2.3e-35
WP_125461928.1|1929218_1929428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042569345.1|1929990_1930401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608328.1|1930614_1931865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005182577.1|1931939_1933220_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
1933516:1933530	attL	CCAGCGAGGCATTAG	NA	NA	NA	NA
WP_050297886.1|1933526_1934453_-	transcriptional regulator MelR	NA	NA	NA	NA	NA
WP_050297887.1|1934723_1936073_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_005182571.1|1936162_1937584_+	melibiose:sodium transporter MelB	NA	NA	NA	NA	NA
WP_005182570.1|1937586_1937841_+	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_032905755.1|1938237_1939791_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_032905690.1|1939762_1940632_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_042569341.1|1941258_1943547_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	31.3	4.2e-60
WP_080608329.1|1943888_1944413_+|integrase	integrase	integrase	A0A0M4R586	Salmonella_phage	65.7	1.0e-62
1954397:1954411	attR	CTAATGCCTCGCTGG	NA	NA	NA	NA
>prophage 6
NZ_CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	1950532	2039393	4960650	tail,terminase,holin,plate,head,integrase,lysis,capsid,portal	Salmonella_phage(18.42%)	118	1991638:1991683	2039425:2039470
WP_080608330.1|1950532_1950988_+	hypothetical protein	NA	G9L674	Escherichia_phage	66.0	1.1e-47
WP_080608331.1|1950989_1952021_+	serine/threonine protein kinase	NA	D2X3B9	Enterobacteria_phage	48.9	2.4e-84
WP_192945339.1|1952024_1952192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608500.1|1952222_1952432_-	fumarate hydratase FumD	NA	NA	NA	NA	NA
WP_080608332.1|1952532_1953168_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	42.5	6.0e-33
WP_080608501.1|1953167_1954307_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	46.2	3.1e-32
WP_080608333.1|1954752_1955349_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	40.1	3.0e-34
WP_080608334.1|1955345_1956482_-|plate	baseplate J/gp47 family protein	plate	A0A1E1GE19	Vibrio_phage	28.0	1.7e-09
WP_080608335.1|1956485_1956923_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	45.4	2.0e-19
WP_080608336.1|1956919_1957513_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	35.2	2.0e-06
WP_080608337.1|1957509_1958583_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	30.3	5.0e-40
WP_080608338.1|1958579_1959986_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	28.3	3.0e-24
WP_080608339.1|1960043_1961846_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	49.2	1.1e-23
WP_080608340.1|1961963_1962266_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080608341.1|1962267_1962642_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_080608342.1|1962654_1964145_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	43.3	6.0e-100
WP_080608343.1|1964144_1964336_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_080608344.1|1964340_1964886_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_050134623.1|1964882_1965227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608345.1|1965226_1965634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608346.1|1965635_1966682_-|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	31.8	1.4e-39
WP_080608347.1|1966791_1967193_-|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	37.2	8.2e-12
WP_080608348.1|1967192_1967777_-	DNA primase	NA	NA	NA	NA	NA
WP_032898862.1|1967776_1968634_-	S49 family peptidase	NA	K7P7A7	Enterobacteria_phage	39.5	3.0e-51
WP_080608349.1|1968630_1970199_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.5	7.0e-99
WP_005278866.1|1970267_1970531_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_080608502.1|1970539_1972516_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.0	3.1e-136
WP_005278871.1|1972487_1973099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608350.1|1973210_1973735_-	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	48.8	1.7e-33
WP_080608351.1|1973811_1974456_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	30.9	2.6e-07
WP_080608352.1|1974803_1975085_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	76.3	3.7e-35
WP_080608503.1|1975117_1975618_-	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	86.1	5.2e-72
WP_080608353.1|1975635_1976031_-	M15 family metallopeptidase	NA	K0NZV5	Escherichia_virus	65.1	5.9e-39
WP_050143246.1|1976020_1976359_-|holin	phage holin, lambda family	holin	A0A0N7CER3	Salmonella_phage	47.1	7.9e-16
WP_125461930.1|1976608_1977130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608354.1|1977885_1978302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050133492.1|1980144_1980570_-	antitermination protein	NA	S5M7R9	Escherichia_phage	57.1	9.5e-35
WP_105165854.1|1980831_1981881_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	50.5	8.6e-69
WP_080608355.1|1981932_1984608_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.9	1.4e-232
WP_032898470.1|1984604_1985000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032905637.1|1985113_1985317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049602772.1|1985319_1985490_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_049602771.1|1985467_1985665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608356.1|1985657_1986452_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	44.3	1.2e-41
WP_080608504.1|1986444_1986741_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_192945340.1|1986895_1987090_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_192945341.1|1987298_1987631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032898475.1|1987968_1988481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049602767.1|1988589_1988796_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_125461932.1|1988905_1989874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005182448.1|1990285_1991473_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.0	2.3e-131
1991638:1991683	attL	ATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_192945342.1|1991979_1993806_+	acyltransferase family protein	NA	A0A193GZ69	Enterobacter_phage	31.9	8.5e-64
WP_080608359.1|1993862_1995905_-	hypothetical protein	NA	A0A291AXF7	Shigella_phage	58.0	8.4e-44
WP_080608505.1|1995962_1998326_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	49.6	8.6e-218
WP_080608360.1|1998444_1998837_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	46.8	2.6e-31
WP_080608361.1|1998872_1999343_-	DUF1833 family protein	NA	B1GS46	Salmonella_phage	46.8	3.0e-37
WP_080608362.1|1999342_1999816_-	hypothetical protein	NA	B1GS45	Salmonella_phage	54.2	3.2e-47
WP_192945343.1|1999812_2002995_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	40.0	2.4e-154
WP_080608364.1|2003106_2003466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608365.1|2003544_2004225_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	54.4	1.5e-66
WP_080608366.1|2004277_2005021_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	53.0	8.5e-55
WP_077174374.1|2005077_2005452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608367.1|2005448_2005820_-	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	63.3	8.3e-35
WP_080608368.1|2005821_2006163_-	hypothetical protein	NA	A0A1B1W262	Salmonella_phage	48.5	1.3e-18
WP_192945375.1|2006172_2006460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608370.1|2006396_2006567_-	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	55.6	3.0e-16
WP_080608371.1|2006566_2006965_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	81.8	1.4e-59
WP_049556430.1|2007028_2007214_-	hypothetical protein	NA	Q5G8X9	Enterobacteria_phage	58.7	9.2e-11
WP_080608372.1|2007224_2008322_-	hypothetical protein	NA	J7I0Q9	Pseudomonas_phage	71.9	1.2e-150
WP_080608373.1|2008332_2008773_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	62.8	1.6e-40
WP_080608374.1|2008772_2010050_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	78.3	9.1e-190
WP_080608375.1|2010053_2010977_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	63.9	3.6e-103
WP_080608376.1|2010936_2012307_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	73.1	8.0e-184
WP_080608377.1|2012504_2013824_-|terminase	terminase	terminase	Q5G8Y7	Enterobacteria_phage	89.7	3.0e-236
WP_080608378.1|2013807_2014275_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.5	1.8e-55
WP_105165857.1|2014308_2014944_-	hypothetical protein	NA	I6S676	Salmonella_phage	70.9	1.8e-85
WP_192945344.1|2015127_2015298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608379.1|2015294_2015870_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	58.8	3.7e-58
WP_080608380.1|2016214_2016400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608381.1|2016415_2016874_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.3	9.0e-23
WP_080608382.1|2016858_2017371_-	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	1.8e-48
WP_049528949.1|2017370_2017652_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_080608383.1|2018106_2018931_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	50.7	1.0e-72
WP_080608384.1|2018927_2019287_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	69.5	5.2e-42
WP_042562425.1|2019283_2019574_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	76.8	5.7e-39
WP_080608385.1|2019685_2020354_-	metallophosphoesterase	NA	K7PJY0	Enterobacterial_phage	62.4	3.5e-76
WP_192945345.1|2020346_2020688_-	DUF2591 family protein	NA	A0A2I7QJ87	Vibrio_phage	37.0	2.3e-07
WP_080608387.1|2020827_2021211_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	76.9	1.2e-52
WP_080608388.1|2021207_2021645_-	recombination protein NinB	NA	E5AGF7	Erwinia_phage	83.4	3.3e-67
WP_042546561.1|2021637_2021949_-	hypothetical protein	NA	A0A0A0YR00	Erwinia_phage	36.6	6.1e-07
WP_192945373.1|2021945_2022236_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	36.8	7.5e-07
WP_080608389.1|2022652_2023003_-	hypothetical protein	NA	Q7Y3W5	Yersinia_phage	75.2	1.7e-45
WP_080608390.1|2023263_2023458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608391.1|2023457_2024861_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	61.7	1.9e-164
WP_080608392.1|2024850_2025753_-	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	47.2	1.6e-63
WP_192945346.1|2025745_2025907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080608393.1|2025919_2026210_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	61.9	4.8e-22
WP_048901721.1|2026345_2026576_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	47.1	1.0e-06
WP_080608507.1|2026734_2027433_+	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	63.5	5.3e-83
WP_080608394.1|2027764_2028112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608395.1|2028739_2029102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050122729.1|2029151_2029394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_192945347.1|2029435_2029597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125461933.1|2029938_2030253_+	hypothetical protein	NA	A0A2I7RGU7	Vibrio_phage	42.6	2.4e-14
WP_050311065.1|2031520_2031910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608398.1|2032260_2032509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608399.1|2032480_2033161_+	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	69.5	1.8e-91
WP_080608400.1|2033157_2033754_+	DUF669 domain-containing protein	NA	K7PHD7	Enterobacteria_phage	51.6	2.7e-43
WP_080608401.1|2033780_2034047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608402.1|2034086_2034290_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_105165858.1|2034493_2035000_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	45.9	9.7e-10
WP_080608403.1|2034999_2035893_+	hypothetical protein	NA	A0A2K9VK66	Klebsiella_phage	60.4	4.1e-96
WP_192945348.1|2035905_2036139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608404.1|2036135_2036435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042569889.1|2036499_2036706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608405.1|2036713_2036932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080608406.1|2036928_2037564_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	74.0	1.1e-87
WP_080608407.1|2038238_2039393_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	71.1	6.2e-161
2039425:2039470	attR	ATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 7
NZ_CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	2066260	2074972	4960650		Tupanvirus(14.29%)	8	NA	NA
WP_050297437.1|2066260_2067271_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	47.2	4.5e-83
WP_050297436.1|2067330_2068701_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.7	1.8e-34
WP_050297435.1|2068713_2070111_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	5.2e-53
WP_050297434.1|2070117_2071083_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	48.9	8.7e-84
WP_050297433.1|2071088_2072207_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	63.6	3.4e-132
WP_050297432.1|2072203_2073280_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_050297431.1|2073266_2074115_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	26.4	5.0e-11
WP_080608510.1|2074111_2074972_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.8	2.2e-09
>prophage 8
NZ_CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	4383095	4391229	4960650	integrase	uncultured_Mediterranean_phage(33.33%)	6	4377547:4377561	4396569:4396583
4377547:4377561	attL	CTGTTTTCATTTCTT	NA	NA	NA	NA
WP_072088679.1|4383095_4383848_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	1.6e-64
WP_042568533.1|4383870_4384497_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	4.8e-35
WP_005181658.1|4384914_4385880_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	32.8	1.3e-07
WP_005181660.1|4385934_4386933_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	3.6e-32
WP_080608115.1|4387039_4389601_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.4	1.3e-25
WP_080608116.1|4389759_4391229_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	27.4	1.3e-22
4396569:4396583	attR	AAGAAATGAAAACAG	NA	NA	NA	NA
>prophage 9
NZ_CP027397	Yersinia intermedia strain FDAARGOS_358 chromosome, complete genome	4960650	4874098	4882958	4960650		Escherichia_phage(71.43%)	10	NA	NA
WP_050088829.1|4874098_4874608_+	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	29.1	2.2e-09
WP_005183665.1|4874744_4875980_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005183662.1|4876155_4876680_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	51.0	7.6e-26
WP_098057507.1|4876738_4876813_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_005183650.1|4877321_4877753_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	49.3	6.7e-28
WP_050073786.1|4877849_4878413_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_050073785.1|4878409_4879024_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	48.7	1.9e-44
WP_050073784.1|4879127_4879904_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	42.2	7.8e-43
WP_005183646.1|4879905_4880523_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	70.2	3.4e-89
WP_050296751.1|4880534_4882958_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	55.8	4.8e-264
