The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	8519	53217	4141030	plate,protease,coat,holin,transposase	Bacillus_phage(53.33%)	46	NA	NA
WP_031600552.1|8519_9641_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.5	9.8e-196
WP_031600553.1|9656_9956_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	2.0e-39
WP_031600554.1|9952_10123_+	XkdX family protein	NA	NA	NA	NA	NA
WP_031600555.1|10174_10387_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
WP_031600556.1|10401_10665_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
WP_031600557.1|10720_11698_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	71.4	2.0e-64
WP_105778738.1|11727_12207_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_033881288.1|12225_13989_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	52.3	3.3e-121
WP_080283100.1|14158_14230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479884.1|14245_15331_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_049832641.1|15367_15568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881290.1|16164_16455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479885.1|16693_17185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479887.1|18515_18767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072592598.1|18950_19385_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014479891.1|20427_21186_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_014480339.1|21182_22730_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479132.1|22892_24047_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.4e-24
WP_033881852.1|24043_24943_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_029726895.1|25020_25401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479898.1|25942_26173_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
WP_014479901.1|27684_27849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479902.1|27988_28459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479903.1|29255_30647_+	MFS transporter	NA	NA	NA	NA	NA
WP_014479904.1|30719_31037_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033880480.1|31033_31948_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
WP_014479906.1|32086_33688_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_014479907.1|33825_34980_-	ROK family protein	NA	NA	NA	NA	NA
WP_014479908.1|35217_36555_+	xylose isomerase	NA	NA	NA	NA	NA
WP_014479909.1|36705_38205_+	xylulokinase	NA	NA	NA	NA	NA
WP_031600262.1|38689_39937_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014479910.1|40066_40702_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
WP_033881939.1|41114_42530_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_031600564.1|42631_43816_-	alanine racemase	NA	NA	NA	NA	NA
WP_014479913.1|44226_44652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479915.1|45570_46005_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
WP_033881937.1|46605_46869_-|coat	spore coat protein CotU	coat	NA	NA	NA	NA
WP_003231643.1|47275_47440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479918.1|47714_48554_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
WP_121509411.1|48676_48964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479919.1|49006_49726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479920.1|49885_50242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479921.1|50487_50688_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
WP_003231634.1|50862_51051_-	twin-arginine translocase TatAC	NA	NA	NA	NA	NA
WP_009967329.1|51304_51703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014478984.1|51864_53217_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 2
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	122062	158059	4141030	transposase,integrase	Bacillus_phage(41.67%)	35	121969:122028	148534:149819
121969:122028	attL	GGGACTGACCCCATAAGATGAGACAAATAAAAACACCTTCAAGTTTGAATACGGATGATT	NA	NA	NA	NA
WP_087614160.1|122062_123212_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003231473.1|123458_124004_-|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	51.4	3.6e-42
WP_003231472.1|124320_124551_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_014479969.1|124735_126499_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_014479970.1|126660_127518_-	LysR family transcriptional regulator YofA	NA	Q6JIH3	Burkholderia_virus	35.0	4.5e-07
WP_014479971.1|127645_128635_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_014479972.1|128690_130172_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
WP_014479973.1|130188_134751_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_004399246.1|134896_135799_+	glutamate biosynthesis transcriptional regulator GltC	NA	NA	NA	NA	NA
WP_003220337.1|137891_138260_-	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.8	9.2e-18
WP_014479980.1|138558_139275_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	78.0	9.7e-48
WP_017697324.1|139425_139734_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_014479982.1|139800_140571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479983.1|140614_141148_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014479985.1|141287_142280_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014479986.1|142273_143020_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014479987.1|143029_143968_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	6.1e-26
WP_014479988.1|143983_144535_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033880940.1|144930_146175_-	MFS transporter	NA	NA	NA	NA	NA
WP_031600262.1|146273_147521_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_142767572.1|147522_147792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881179.1|147971_148268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087614160.1|148627_149777_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_052006227.1|149818_150058_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
148534:149819	attR	GGGACTGACCCCATAAGATGAGACAAATAAAAACACCTTCAAGTTTGAATACGGATGATTGTTATCCGAAATTAGACTTGGAGGTGTTTTTTCTATGGGGACAAGAGTGAGTTATCCGGTTGAAGTGAAACAGAAGGCTGTAGAAATGAGATTGGCAGGCGTACCTATGAAAGAGATCATGCAGGAGTTGAATATCAAAAATAATACGCAGATTAAGACATGGGTCAGATGGTATAAGGCTGGTGATACACATCGATTTGAACAGCCTGTTGGTAAGCAATACACTTATGGAAAAGGTCCGGAGTATTCTTCCGAATTAGAGAAACTGCAGGCAGAGAATCGATATCTGAGACAACAGAATGAAGTGTTAAAAAAGTACAACGAATTGGAAAGGAAGTTGATAGCCAAACGTCAGTCGAACTTGTAGAAGAATTGCACAGCACAATGACCGTGCAGGATATCTGTATTCATTTAGGTATCTCTCGCTCGTCTTATTATCGTTGGAAGAAGAATCTGAAGAAAGATCATCCCAAGCGCCATTTAGAAAAACAAATCGGCACGTTGTGCCGAGAGCACCAGTATCGATATGGATATCGAAAAATCACAGCTATATTAAAAAAGAGAATGTGTATTAACCATAAAACGGTTCAGCGTATTATGCAGAAAAATCAGTGGCAGTGCCGGGTTAAGGTGAAAAAGCGCAAGAAGAATGGGCAGCCATATGCCGTGGTCGACAATATATTAGATAGGAACTTTCAGTCTGATCATCCTCTTGAAAAACTAGTAACAGACATCACGTATTTGCCTTATGGACAGAAACAATTGTACCTTTCCAGTATATTGGATGTATATAATGGAGAAGTGATTGCTTTTACGATTGGAGATAAGCAGGACACAGACTTTGTCTTACACACACTTGATCAACTGCCAACACTGCCTGAGAACTGCGTGTTACATAGTGACCAAGGATCTGTGTATACATCTTACGAGTATCAGAAAGCTGTTAAAACAAAAGGCATTACCATGAGCATGTCCCGCAAAGGGACACCCGCTGATAATGCCTCCATCGAATCGTTTCATTCCTCACTAAAGTCTGAAACGTTCTATCTTAACAGCATTGATCGAACCACGACCGCCATCGTAGAACGCACTGTCATAGAATACATTCATTATTATAACAATATTCGTATTCAAACGAAACTAAACAACCAATCACCGATAAATTATCGGCAATTGGCTGTTTAAAAGGTGTTTTGATCCCTGTCTCAAAAACGGGGGTCAGTCCC	NA	NA	NA	NA
WP_033881696.1|150094_150328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600262.1|150787_152035_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_033881211.1|152107_152251_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	92.5	9.6e-16
WP_033881213.1|152487_152739_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	96.4	1.0e-36
WP_033881218.1|153107_154535_-	serine hydrolase	NA	NA	NA	NA	NA
WP_033881214.1|154668_154899_+	membrane protein	NA	NA	NA	NA	NA
WP_033881215.1|154908_155301_-	UPF0715 family protein	NA	O64087	Bacillus_phage	81.4	3.7e-49
WP_087614174.1|155345_155570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837923.1|155604_155958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592540.1|156076_156721_-	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_031601042.1|156934_158059_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	161726	172416	4141030	transposase,holin	Bacillus_phage(75.0%)	10	NA	NA
WP_031600262.1|161726_162974_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_033881859.1|165180_165540_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
WP_072592542.1|165799_165883_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_014479996.1|166171_166705_-	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	97.2	2.9e-97
WP_014479997.1|166764_167319_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.3	4.3e-96
WP_014479998.1|167374_167833_-	hypothetical protein	NA	A0A1P8CWJ1	Bacillus_phage	85.5	2.8e-72
WP_003231326.1|167925_168384_-	type II toxin-antitoxin system antitoxin YobK	NA	NA	NA	NA	NA
WP_014479999.1|168393_170196_-	type II toxin-antitoxin system toxin ribonuclease YobL	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
WP_029318053.1|170294_170852_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.7	7.0e-102
WP_121509415.1|170979_172416_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	2.6e-07
>prophage 4
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	384857	390952	4141030		Staphylococcus_phage(66.67%)	8	NA	NA
WP_014480158.1|384857_385451_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
WP_014477220.1|385440_386196_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_014480159.1|386475_387000_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|387013_387388_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|387500_387965_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_014480160.1|387997_389194_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_014480161.1|389208_389856_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_014480162.1|389866_390952_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
>prophage 5
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	629200	688830	4141030	transposase,coat,protease,holin	uncultured_Caudovirales_phage(22.22%)	59	NA	NA
WP_031600262.1|629200_630448_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014480325.1|630813_632202_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_014480326.1|632368_633259_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_105778740.1|634107_634596_+	VOC family protein	NA	NA	NA	NA	NA
WP_014480328.1|635335_636463_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	48.8	5.0e-91
WP_014480331.1|638584_638872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480332.1|639274_639715_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014480333.1|639813_640266_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014480334.1|640362_640722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014477426.1|640793_641306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158695060.1|641572_641815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480337.1|643091_643382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480339.1|644222_645770_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479891.1|645766_646525_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_072592549.1|647117_647204_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_123772463.1|648616_648922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480344.1|649314_649794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881358.1|650410_650677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049832653.1|650815_650968_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	76.0	8.4e-18
WP_014480349.1|652455_653277_-	multidrug efflux transcriptional regulator BltR	NA	NA	NA	NA	NA
WP_014480350.1|653393_654596_+	multidrug efflux MFS transporter Blt	NA	NA	NA	NA	NA
WP_014480351.1|654777_655236_+	spermine/spermidine acetyltransferase	NA	NA	NA	NA	NA
WP_014480352.1|655394_656699_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_014477437.1|656988_657132_-	YrzO family protein	NA	NA	NA	NA	NA
WP_014480354.1|657149_658115_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014480355.1|658240_659107_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014480356.1|659226_660264_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.5	6.4e-16
WP_014480357.1|660351_661287_-	CDF family zinc transporter CzcD	NA	NA	NA	NA	NA
WP_014480358.1|661964_663287_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_014480359.1|663451_663784_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
WP_014480361.1|664519_664993_-	azlBCD operon transcriptional regulator AzlB	NA	NA	NA	NA	NA
WP_014480362.1|665326_665602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480363.1|665874_667107_-	cytochrome P450	NA	NA	NA	NA	NA
WP_014480365.1|667769_668336_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_072592606.1|668564_668936_-	YrdB family protein	NA	NA	NA	NA	NA
WP_014480368.1|669767_670271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480369.1|670490_671345_-	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.6	9.7e-95
WP_014480370.1|671740_672784_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_014480371.1|673131_673929_+	glutamate racemase	NA	NA	NA	NA	NA
WP_032726255.1|674309_675017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033881351.1|675928_676090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480373.1|676153_676909_-	ZinT family metal-binding protein	NA	NA	NA	NA	NA
WP_014480374.1|677038_677569_-	RNA polymerase sigma factor SigZ	NA	NA	NA	NA	NA
WP_014480375.1|677704_678685_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014480377.1|678826_679642_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	33.2	3.7e-19
WP_014480379.1|680084_680348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398671.1|681697_682054_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_004399021.1|682106_682466_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_121517030.1|682737_682839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480381.1|682981_683368_-	VOC family protein	NA	NA	NA	NA	NA
WP_014480382.1|683630_683876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967868.1|683891_684260_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014480383.1|684278_685415_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	7.7e-15
WP_014480384.1|685433_685631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480385.1|685646_685946_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014480386.1|686208_686631_-	aldehyde stress transcriptional regulator AdhR	NA	NA	NA	NA	NA
WP_014480387.1|686813_687008_+	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_014480388.1|687138_688188_+	formaldehyde dehydrogenase AdhA	NA	A0A2K9L339	Tupanvirus	41.8	8.6e-69
WP_003229836.1|688320_688830_+|protease	cysteine protease YraA	protease	NA	NA	NA	NA
>prophage 6
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	765141	818610	4141030	tRNA,coat,protease	uncultured_Mediterranean_phage(12.5%)	56	NA	NA
WP_003229725.1|765141_766287_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|766313_767342_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|767371_767572_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|767564_768569_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|768579_769185_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014480438.1|769323_769836_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_014480439.1|769883_771191_-	MFS transporter	NA	NA	NA	NA	NA
WP_014480440.1|771261_772287_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_014480441.1|772524_773172_+	hypothetical protein	NA	A0A2R3ZQF2	Marseillevirus	26.3	9.2e-05
WP_003229707.1|773217_773340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600754.1|773445_773871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398683.1|773877_774018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480443.1|774181_775636_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_033881612.1|775676_776399_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014480445.1|776501_777098_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_014480446.1|777245_778409_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_014480447.1|778525_779632_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_014480448.1|779618_780488_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014480449.1|780441_782037_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_033881608.1|782139_783327_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|783286_783829_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_004398512.1|783853_784711_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|784727_785171_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003246161.1|785231_786518_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_014480451.1|786551_787130_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|787207_787330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|787450_787735_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|787747_788086_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|788088_788397_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014480452.1|788543_789410_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_014480453.1|789402_790197_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014480454.1|790346_791153_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|791154_791835_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|791887_792406_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|792402_793275_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|793305_794319_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_014480455.1|794410_795106_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_014480456.1|795142_795712_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_014480457.1|795864_796863_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072592551.1|796996_797743_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014480460.1|797882_799175_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014480461.1|799234_801877_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003222590.1|802324_802516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480462.1|802534_803560_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_014480463.1|803592_805314_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_014480464.1|805444_806737_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_014480465.1|806766_807741_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014480466.1|807737_808526_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014480467.1|808515_809460_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|809492_810323_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_004399038.1|810330_811698_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014477563.1|811927_812425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|812446_813034_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014480468.1|813030_815355_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_004398923.1|815535_817194_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|817347_818610_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 7
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	1416607	1472429	4141030	capsid,plate,head,protease,holin,portal,terminase,tail	Bacillus_phage(69.05%)	69	NA	NA
WP_014480874.1|1416607_1418191_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
WP_014480875.1|1418205_1418595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105778748.1|1418937_1419540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480877.1|1419579_1420521_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
WP_014480878.1|1420562_1420985_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
WP_014480879.1|1421038_1421209_-	XkdX family protein	NA	NA	NA	NA	NA
WP_031600923.1|1421205_1421505_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
WP_031600924.1|1421520_1422744_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	79.9	6.5e-177
WP_072592555.1|1422780_1424355_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	88.7	1.1e-264
WP_031600926.1|1424391_1426098_-	hypothetical protein	NA	D6R400	Bacillus_phage	81.8	9.4e-267
WP_031600927.1|1426109_1426949_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	83.2	8.5e-136
WP_033882059.1|1426948_1430827_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	81.0	0.0e+00
WP_017696308.1|1430839_1431019_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
WP_003220222.1|1431021_1431360_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	70.5	3.0e-39
WP_017696306.1|1431414_1432026_-|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
WP_031600930.1|1432026_1432407_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
WP_033882058.1|1432403_1432787_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	86.6	2.9e-59
WP_033882056.1|1432779_1433151_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	68.3	3.5e-41
WP_031600933.1|1433083_1433431_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	87.0	2.0e-51
WP_031600934.1|1433446_1433938_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	69.1	1.3e-27
WP_031600935.1|1433966_1434281_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	68.8	6.8e-30
WP_033882054.1|1434296_1435499_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.5	3.3e-157
WP_003220242.1|1435535_1436162_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.8	1.8e-106
WP_033882052.1|1436151_1437399_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
WP_033882051.1|1437404_1437620_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
WP_031600939.1|1437632_1439342_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.3	0.0e+00
WP_017697674.1|1439341_1439875_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
WP_046160532.1|1440254_1440629_-	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
WP_033881251.1|1440678_1441425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600943.1|1441815_1442589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123772464.1|1442739_1443105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031600945.1|1444313_1444766_-	hypothetical protein	NA	S6AVV9	Thermus_phage	56.6	3.4e-38
WP_014480881.1|1445019_1445220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480882.1|1445216_1445636_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	61.2	1.6e-42
WP_014480883.1|1445632_1445965_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.3	8.3e-18
WP_014480884.1|1445964_1446621_-	hypothetical protein	NA	R9TQ23	Paenibacillus_phage	46.0	9.9e-39
WP_014480885.1|1446738_1446996_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.7	6.6e-07
WP_014480886.1|1446992_1447400_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
WP_014480887.1|1447396_1447714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480888.1|1447710_1448073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220282.1|1448115_1448313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003237439.1|1448559_1448700_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_014480892.1|1448807_1449356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480894.1|1449670_1450498_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
WP_014480895.1|1450481_1451363_-	phage replisome organiser	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
WP_033881245.1|1451355_1451574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881244.1|1451598_1451790_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
WP_014480896.1|1451841_1452045_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014480897.1|1452279_1452678_+	helix-turn-helix transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
WP_014480900.1|1453110_1454211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220025.1|1456135_1456606_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
WP_003228386.1|1456750_1459090_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.9	2.4e-87
WP_003242610.1|1459108_1459849_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003220028.1|1459980_1460211_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014480904.1|1460359_1461133_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003220031.1|1461166_1461400_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003220034.1|1461551_1461959_+	transcriptional repressor RghR	NA	S6C481	Thermus_phage	64.8	1.9e-16
WP_014480905.1|1461988_1462408_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
WP_003242888.1|1462499_1462826_+	catDE operon transcriptional regulator CatR	NA	NA	NA	NA	NA
WP_014480906.1|1462953_1464654_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.0e-24
WP_014480907.1|1464694_1465375_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_014480908.1|1465391_1466312_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|1466323_1466977_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_014480909.1|1466993_1468139_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_014480910.1|1468422_1468956_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478003.1|1468987_1469662_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_031600963.1|1469679_1470591_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|1470610_1471264_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_014480912.1|1471286_1472429_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	29.6	2.8e-12
>prophage 8
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	1546761	1583205	4141030	integrase,plate,portal,terminase,tail	Bacillus_phage(34.62%)	48	1546570:1546623	1583399:1583452
1546570:1546623	attL	TATTGGACGCGCTCGGAGGGATTCGAACCCCCGACAGACGTGGTACCGGAAACC	NA	NA	NA	NA
WP_033881229.1|1546761_1546995_-	helix-turn-helix domain-containing protein	NA	B3RH35	Bacillus_virus	62.0	4.3e-21
WP_014480971.1|1547273_1547552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480972.1|1547564_1548749_+	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	53.4	1.3e-108
WP_014480973.1|1548735_1549368_+	hypothetical protein	NA	Q0H249	Geobacillus_phage	57.1	7.2e-63
WP_014480974.1|1549409_1549712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480975.1|1549833_1550091_-	hypothetical protein	NA	A0A0U4JE55	Bacillus_phage	57.6	5.6e-22
WP_033881228.1|1550110_1551058_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.7	2.5e-91
WP_033881227.1|1551130_1551334_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	46.5	1.9e-09
WP_014480977.1|1551358_1551529_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	68.1	1.1e-10
WP_014480978.1|1551529_1551823_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	80.2	1.6e-41
WP_031600995.1|1551838_1553062_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	74.9	4.1e-163
WP_031600996.1|1553098_1554676_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.8	3.3e-258
WP_031600997.1|1554688_1556083_-	hypothetical protein	NA	A6M966	Geobacillus_virus	30.3	3.0e-37
WP_033880944.1|1556097_1557516_-	glycoside hydrolase family 73	NA	A0A2H4JBY6	uncultured_Caudovirales_phage	42.4	1.3e-56
WP_080283095.1|1557519_1560342_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.4	6.7e-68
WP_033880947.1|1560346_1560568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880428.1|1560663_1561020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880949.1|1561106_1561676_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	1.0e-52
WP_033880952.1|1561716_1562091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880954.1|1562095_1562503_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	55.5	2.1e-31
WP_033880956.1|1562499_1562838_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	47.3	8.1e-21
WP_031601003.1|1562838_1563231_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.5	7.5e-18
WP_033880957.1|1563248_1563440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601004.1|1563496_1564405_-	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	52.5	1.4e-80
WP_031601005.1|1564436_1564997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695234.1|1565102_1565915_-	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	52.7	8.1e-75
WP_031601006.1|1565914_1567585_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.3	1.5e-155
WP_031601007.1|1567589_1568024_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.3	1.5e-27
WP_033880959.1|1568040_1569801_-|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	44.8	8.3e-133
WP_033880961.1|1569884_1570433_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	7.0e-38
WP_031601009.1|1570462_1570672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049832644.1|1571045_1571357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880962.1|1571609_1571789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601012.1|1572833_1573376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601013.1|1573372_1573651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880965.1|1574511_1574883_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_033880966.1|1574950_1575334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880968.1|1575330_1575579_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017695246.1|1576210_1576411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033880970.1|1576403_1576745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041516557.1|1577106_1577649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480746.1|1578182_1579358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881551.1|1579478_1579694_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	50.8	1.7e-08
WP_031601018.1|1579895_1580231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881293.1|1580819_1581053_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033881294.1|1581112_1581295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041516560.1|1581325_1582057_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	32.7	6.7e-20
WP_014480981.1|1582215_1583205_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IBS1	Pseudomonas_phage	28.1	2.7e-08
1583399:1583452	attR	TATTGGACGCGCTCGGAGGGATTCGAACCCCCGACAGACGTGGTACCGGAAACC	NA	NA	NA	NA
>prophage 9
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	1879058	1954397	4141030	tRNA,coat,protease,bacteriocin	Bacillus_phage(26.67%)	74	NA	NA
WP_003227570.1|1879058_1880729_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014481216.1|1880725_1881154_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|1881466_1881598_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|1881554_1881707_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_014481217.1|1881731_1883078_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|1883090_1883252_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_014481218.1|1883248_1883968_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.6e-18
WP_033881822.1|1883960_1885271_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_072592616.1|1885260_1886421_+	insulinase family protein	NA	NA	NA	NA	NA
WP_014481221.1|1886425_1887706_+	insulinase family protein	NA	NA	NA	NA	NA
WP_014481222.1|1887702_1888404_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_014481223.1|1888409_1889786_-	YncE family protein	NA	NA	NA	NA	NA
WP_014481224.1|1889824_1891180_-	YncE family protein	NA	NA	NA	NA	NA
WP_014481226.1|1891409_1892555_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
WP_009968329.1|1892538_1892658_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_105778741.1|1892755_1893313_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_003227545.1|1893247_1894120_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|1894180_1895011_-	spermidine synthase	NA	NA	NA	NA	NA
WP_014481227.1|1895212_1897288_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_014478299.1|1897315_1897750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244446.1|1897888_1898407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|1898420_1899080_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|1899188_1899377_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003227535.1|1899419_1899839_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014481228.1|1899958_1901875_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	1.9e-143
WP_003243441.1|1902719_1904120_-	MFS transporter	NA	NA	NA	NA	NA
WP_003243988.1|1904119_1904590_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|1904701_1905202_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003243873.1|1905237_1906539_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|1906700_1906925_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003227516.1|1907139_1907916_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_033881831.1|1908059_1908950_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014481232.1|1909118_1909964_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|1910012_1910912_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|1911057_1912029_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003227507.1|1912298_1913063_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_014481234.1|1913195_1913975_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_031601099.1|1913990_1915205_-	transaminase BacF	NA	NA	NA	NA	NA
WP_014481236.1|1915205_1916390_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_003242921.1|1916386_1917805_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_003243359.1|1917823_1918585_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003244300.1|1918587_1919295_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|1919284_1919899_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_014481237.1|1920050_1921289_-	MFS transporter	NA	NA	NA	NA	NA
WP_015250969.1|1921498_1922911_-	amino acid permease	NA	NA	NA	NA	NA
WP_014481239.1|1922910_1924611_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014478322.1|1924684_1926232_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227482.1|1926458_1927733_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_014481241.1|1927910_1928375_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_014481242.1|1928698_1929154_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_014481243.1|1929146_1929998_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	1.3e-38
WP_003244201.1|1930011_1930959_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_014478328.1|1930958_1931699_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_014481244.1|1931723_1932743_-|coat	spore coat polysaccharide biosynthesis protein SpsG	coat	NA	NA	NA	NA
WP_014481245.1|1932745_1933468_-|coat	spore coat polysaccharide biosynthesis protein SpsF	coat	NA	NA	NA	NA
WP_031601100.1|1933460_1934582_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_014481248.1|1934581_1935451_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014481249.1|1935451_1936621_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
WP_014481250.1|1936641_1938066_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_014481251.1|1938070_1938841_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	4.4e-06
WP_014481253.1|1939160_1939706_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|1939749_1940121_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_014481254.1|1940182_1941505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481255.1|1941524_1941842_-	YwdI family protein	NA	NA	NA	NA	NA
WP_014481256.1|1942009_1943380_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003242965.1|1943404_1944082_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
WP_014481257.1|1944095_1944902_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014481258.1|1945093_1945909_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|1945999_1946248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481259.1|1946341_1947781_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.8	3.7e-22
WP_014481260.1|1947777_1949163_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_014481261.1|1949464_1950235_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_015250947.1|1951144_1951447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481265.1|1951976_1954397_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
>prophage 10
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	2121341	2219084	4141030	transposase,coat,protease,holin	Bacillus_phage(23.81%)	89	NA	NA
WP_003227093.1|2121341_2121707_+|coat	inner spore coat protein CotNE	coat	NA	NA	NA	NA
WP_003242469.1|2121954_2122308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481403.1|2122351_2122750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481404.1|2122927_2123893_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003227084.1|2123933_2124281_-	YxeA family protein	NA	NA	NA	NA	NA
WP_014481410.1|2127030_2128008_-	two-component system sensor histidine kinase YxdJ	NA	NA	NA	NA	NA
WP_003243527.1|2128004_2128694_-	two-component system response regulator YxdJ	NA	NA	NA	NA	NA
WP_014481411.1|2128801_2129674_-	6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase	NA	NA	NA	NA	NA
WP_014481412.1|2129694_2130531_-	2-keto-myo-inositol isomerase	NA	NA	NA	NA	NA
WP_014481413.1|2130616_2131486_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014481414.1|2131505_2132540_-	bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase	NA	NA	NA	NA	NA
WP_014481415.1|2132562_2133879_-	myo-inositol transporter IolF	NA	NA	NA	NA	NA
WP_014481416.1|2133893_2134787_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_014481417.1|2134803_2136717_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_014478485.1|2136749_2137727_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_014481418.1|2137750_2138566_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_014481419.1|2138640_2140104_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_031601042.1|2140517_2141642_-|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_003227050.1|2141935_2142691_+	myo-inositol utilization transcriptional regulator IolR	NA	NA	NA	NA	NA
WP_014481420.1|2142744_2143677_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014481421.1|2143906_2144221_+	hypothetical protein	NA	L7TIP7	Escherichia_phage	47.0	1.6e-10
WP_014481422.1|2144324_2144795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481425.1|2145551_2146064_+	HPP family protein	NA	NA	NA	NA	NA
WP_014481428.1|2147609_2149490_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.4	1.1e-93
WP_014481429.1|2149657_2149909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881094.1|2151100_2151301_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014481433.1|2151923_2152142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481434.1|2152186_2152408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014478926.1|2152729_2153854_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_014481435.1|2154131_2154386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481436.1|2154549_2156733_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	30.8	1.7e-50
WP_014481437.1|2156733_2158203_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014481439.1|2158611_2159646_-	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_014481440.1|2159739_2160315_-	transcriptional regulator YxaF	NA	NA	NA	NA	NA
WP_014481441.1|2160445_2161516_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003243994.1|2161574_2162006_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009968420.1|2162232_2162637_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003227015.1|2162606_2163299_+	LrgB family protein	NA	NA	NA	NA	NA
WP_014481442.1|2163338_2164370_-	general stress protein 30	NA	NA	NA	NA	NA
WP_014481443.1|2164462_2165611_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.3	1.4e-48
WP_003243132.1|2165806_2166538_+	gluconate operon transcriptional repressor GntR	NA	NA	NA	NA	NA
WP_014481444.1|2166530_2168072_+	gluconokinase	NA	NA	NA	NA	NA
WP_003243139.1|2168100_2169447_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_014478511.1|2169469_2170876_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.6	1.7e-32
WP_003243686.1|2171341_2171905_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003243077.1|2171918_2173448_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
WP_014481445.1|2173558_2174998_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_014481447.1|2175564_2176275_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478516.1|2176365_2177088_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
WP_014481448.1|2177108_2177738_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_014481449.1|2178218_2180144_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_080283096.1|2180594_2180945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481451.1|2181425_2181866_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
WP_014479891.1|2182285_2183044_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_014480339.1|2183040_2184588_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_033881507.1|2184717_2185104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031601173.1|2185515_2186979_+	hypothetical protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
WP_121591334.1|2187213_2189100_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
WP_031601176.1|2189077_2191111_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014479904.1|2192168_2192486_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033881055.1|2192482_2193397_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
WP_080283097.1|2193477_2193924_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	97.5	3.2e-57
WP_017696296.1|2193908_2194187_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	100.0	7.3e-44
WP_033881129.1|2194885_2195149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881055.1|2195532_2196447_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
WP_014479904.1|2196443_2196761_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014481454.1|2197025_2200139_-	DEAD/DEAH box helicase	NA	A7WKM3	Acidianus_filamentous_virus	26.4	6.6e-08
WP_014481455.1|2200104_2201013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003226975.1|2201300_2201780_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_014481456.1|2201860_2202031_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_014481457.1|2202215_2202629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481458.1|2202662_2203889_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.3	1.1e-11
WP_014481459.1|2203951_2204122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481460.1|2204226_2204475_-	DUF2651 family protein	NA	NA	NA	NA	NA
WP_014481461.1|2204490_2205648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481462.1|2205658_2206396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481463.1|2206537_2207008_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014481464.1|2207118_2208216_+	response regulator aspartate phosphatase RapG	NA	D6R410	Bacillus_phage	39.3	6.0e-73
WP_003226961.1|2208216_2208333_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003226959.1|2208569_2209460_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
WP_014481465.1|2209532_2210936_-	amino acid permease	NA	NA	NA	NA	NA
WP_033882007.1|2211158_2212364_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
WP_015715048.1|2212695_2213298_-	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_014481469.1|2213359_2214313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715050.1|2214297_2214852_-	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_014481470.1|2215035_2215671_-	SdpI family protein	NA	NA	NA	NA	NA
WP_015715052.1|2215670_2215955_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
WP_003244510.1|2216181_2217567_+	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
WP_014481472.1|2217881_2219084_-|protease	serine protease HtrC	protease	W5SAB9	Pithovirus	40.4	5.9e-13
>prophage 11
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	2952814	3025311	4141030	tRNA,transposase,coat	Synechococcus_phage(15.79%)	60	NA	NA
WP_014479048.1|2952814_2954356_-|coat	outer spore coat copper-dependent laccase CotA	coat	NA	NA	NA	NA
WP_014479049.1|2954504_2955914_-	GABA permease	NA	NA	NA	NA	NA
WP_009966725.1|2955951_2956239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479050.1|2956311_2957184_+	manganese transporter MneS	NA	NA	NA	NA	NA
WP_014479051.1|2957334_2958297_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_014479052.1|2958296_2959493_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_014479053.1|2959514_2961728_+	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
WP_003244399.1|2961890_2963432_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.5	5.7e-21
WP_014479055.1|2963663_2964443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479056.1|2965070_2966393_+	hypoxanthine/guanine permease PbuG	NA	A0A0R6PHV4	Moraxella_phage	31.2	5.2e-39
WP_014479057.1|2966603_2967407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479058.1|2967565_2967733_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_009966729.1|2967946_2968501_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003219403.1|2968500_2968698_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_003244134.1|2969020_2969509_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	8.7e-24
WP_014479059.1|2969501_2970644_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003233955.1|2970640_2971936_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_014479060.1|2972009_2972735_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_003219409.1|2972727_2972982_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003243954.1|2972978_2973662_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003233949.1|2973645_2975874_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
WP_003233947.1|2975849_2977280_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_014479061.1|2977381_2978422_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
WP_014479062.1|2978418_2979006_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
WP_014479063.1|2979002_2980541_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.6	3.0e-78
WP_014479064.1|2980556_2981825_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_014479065.1|2981862_2982285_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479066.1|2982428_2983703_+	amino acid permease	NA	NA	NA	NA	NA
WP_014479068.1|2984073_2985816_+	adenine deaminase	NA	NA	NA	NA	NA
WP_014479069.1|2985842_2986838_+	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_014479070.1|2986840_2987155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600238.1|2987189_2988767_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_014479073.1|2989031_2989718_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_014479074.1|2989779_2991999_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.9	3.2e-134
WP_014479075.1|2992022_2994029_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.3	3.1e-128
WP_014479076.1|2994044_2995235_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_087614160.1|2995351_2996501_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_072592588.1|2996687_2997698_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_010886431.1|2997735_2998434_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.7e-18
WP_003242814.1|2998539_3000018_-	proline transporter OpuE	NA	NA	NA	NA	NA
WP_003219442.1|3000431_3000722_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_014479078.1|3000737_3002195_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003219444.1|3002208_3003639_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_014479079.1|3003675_3004524_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479080.1|3004655_3007814_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	5.0e-64
WP_003233894.1|3007964_3008876_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.7	1.2e-21
WP_031600241.1|3009185_3010562_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.6	3.6e-115
WP_014479083.1|3011883_3012093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029317421.1|3012326_3015344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479085.1|3015772_3015970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479086.1|3016568_3017042_-	TIGR01741 family protein	NA	NA	NA	NA	NA
WP_031600245.1|3017046_3019056_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	57.4	3.7e-145
WP_014479091.1|3020432_3021563_+	response regulator aspartate phosphatase RapH	NA	A0A1P8CWN8	Bacillus_phage	45.9	9.8e-87
WP_003242557.1|3021552_3021726_+	phosphatase RapH inhibitor PhrH	NA	NA	NA	NA	NA
WP_003233863.1|3021885_3022605_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_049832634.1|3022738_3023356_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014479093.1|3023470_3024055_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479094.1|3024231_3024480_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_014479095.1|3024463_3024727_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_014479096.1|3024741_3025311_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
>prophage 12
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	3474150	3522936	4141030	tRNA,transposase,coat	Planktothrix_phage(22.22%)	57	NA	NA
WP_087614160.1|3474150_3475301_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003245356.1|3475478_3475658_+	YjzC family protein	NA	NA	NA	NA	NA
WP_003245236.1|3475703_3475889_-	DUF2929 domain-containing protein	NA	NA	NA	NA	NA
WP_014479433.1|3476137_3476872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479435.1|3476953_3477511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479436.1|3477601_3478555_+	transcriptional regulator Med	NA	NA	NA	NA	NA
WP_003224559.1|3478569_3478761_+	ComG operon repressor	NA	NA	NA	NA	NA
WP_031600361.1|3478790_3479018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232971.1|3479182_3480121_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_014479438.1|3480143_3481385_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_014479439.1|3481460_3482246_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|3482437_3483424_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|3483420_3484410_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_014479440.1|3484497_3486129_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003245828.1|3486204_3487155_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_014479441.1|3487171_3488083_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_003239298.1|3488288_3489041_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|3489075_3490068_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014479443.1|3490811_3492449_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_014479444.1|3492556_3493492_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|3493495_3494413_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_072173823.1|3494417_3495494_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|3495495_3496413_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_072592593.1|3496520_3497738_+	MFS transporter	NA	NA	NA	NA	NA
WP_003224597.1|3497901_3498480_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014476435.1|3498660_3499056_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_014479447.1|3499098_3499755_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_119122854.1|3499924_3500065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479448.1|3500031_3500688_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003245684.1|3500682_3500805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479449.1|3500848_3502000_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_014479450.1|3502046_3504059_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|3504096_3504264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|3504578_3505478_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|3505474_3505873_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_072592594.1|3506127_3506673_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	73.7	5.1e-41
WP_014479452.1|3506876_3507449_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_014479453.1|3507573_3507942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|3507970_3508606_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|3508624_3509425_+	NAD kinase	NA	NA	NA	NA	NA
WP_072592595.1|3509487_3510339_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003232912.1|3510351_3511086_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A8E2N0	Enterococcus_phage	24.8	7.2e-06
WP_014479455.1|3511320_3513165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479456.1|3513413_3514124_+	thiaminase II	NA	NA	NA	NA	NA
WP_014479457.1|3514098_3514716_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_014479458.1|3514699_3515809_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_072592596.1|3515808_3516009_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_072592522.1|3516005_3516776_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014479461.1|3516772_3517783_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014479462.1|3517801_3518617_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|3518752_3519529_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_031600370.1|3519629_3520313_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_014479464.1|3520405_3520855_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479465.1|3520982_3521471_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_014479466.1|3521622_3522105_-|coat	spore coat protein X	coat	NA	NA	NA	NA
WP_014479467.1|3522189_3522510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479468.1|3522549_3522936_-|coat	spore coat protein V	coat	NA	NA	NA	NA
>prophage 13
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	3605875	3640755	4141030	plate,holin,portal,terminase,transposase,tail	uncultured_Caudovirales_phage(32.35%)	45	NA	NA
WP_087614160.1|3605875_3607026_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_015252291.1|3607438_3608575_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245487.1|3608564_3608699_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_014479545.1|3609096_3610050_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
WP_014479546.1|3610089_3610467_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
WP_014479547.1|3610571_3611174_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
WP_003245071.1|3611250_3612087_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|3612130_3612727_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|3612889_3613231_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|3613409_3613589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232710.1|3613575_3614412_+	hypothetical protein	NA	S6BFM4	Thermus_phage	27.8	6.7e-24
WP_072592528.1|3614311_3615112_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
WP_003245588.1|3615111_3615279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479549.1|3615363_3615714_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_014476537.1|3615710_3615917_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
WP_014479550.1|3616032_3616542_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
WP_003244697.1|3616657_3617455_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003232697.1|3617451_3618753_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
WP_003232695.1|3618756_3620244_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_014479551.1|3620263_3621091_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
WP_003232690.1|3621116_3622052_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479552.1|3622073_3622457_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_009967053.1|3622453_3622810_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003245226.1|3622806_3623292_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_014479553.1|3623304_3623745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232679.1|3623748_3623967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479554.1|3623963_3625364_+	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	39.3	3.0e-77
WP_014479555.1|3625365_3625809_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
WP_014479556.1|3625900_3626347_+	hypothetical protein	NA	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
WP_014479557.1|3626388_3626529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600410.1|3626529_3631533_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.4e-37
WP_014479559.1|3631525_3632185_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
WP_003245730.1|3632200_3633178_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_003244812.1|3633177_3633444_+	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_014479560.1|3633501_3633927_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
WP_003232669.1|3633919_3634966_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
WP_014476551.1|3634949_3635528_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
WP_003232665.1|3635524_3635797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479561.1|3635799_3637863_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
WP_014479562.1|3637874_3638204_+	hypothetical protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	1.3e-15
WP_014479563.1|3638200_3638365_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_014479564.1|3638411_3639251_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_014479565.1|3639303_3639573_+	phage-like element PBSX protein XhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
WP_014479566.1|3639585_3639849_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_014479567.1|3639861_3640755_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
>prophage 14
NZ_CP020023	Bacillus subtilis strain ATCC 21228 chromosome, complete genome	4141030	4078553	4138960	4141030	tRNA,integrase,capsid,head,protease,plate,holin,portal,terminase,transposase,tail	Bacillus_phage(57.78%)	73	4076933:4076948	4107695:4107710
4076933:4076948	attL	TTAAAGGAGGACCAAA	NA	NA	NA	NA
WP_017697674.1|4078553_4079087_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
WP_031600391.1|4079374_4080586_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
WP_072592534.1|4081632_4082088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479830.1|4082242_4082800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479831.1|4082920_4083535_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003231786.1|4083673_4084030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592535.1|4084108_4084933_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033881122.1|4085043_4086372_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.6	1.2e-27
WP_014476869.1|4086596_4086830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479835.1|4087109_4087817_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_014479836.1|4087886_4088339_+	OsmC family protein	NA	NA	NA	NA	NA
WP_014479837.1|4088352_4088706_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_009967307.1|4088719_4089037_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_014479838.1|4089171_4089450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592536.1|4089538_4089952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479840.1|4090051_4090996_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|4091035_4091257_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014479841.1|4091451_4091724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|4091805_4092036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|4092278_4092671_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|4092630_4094733_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|4094750_4095740_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|4095789_4096410_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014479843.1|4096473_4097241_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
WP_003231746.1|4097881_4098850_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_015483254.1|4098982_4100245_+	GTPase HflX	NA	NA	NA	NA	NA
WP_014479845.1|4100262_4101528_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|4101637_4102045_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_031600540.1|4102103_4103438_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_088272329.1|4103550_4104708_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	8.3e-65
WP_105778744.1|4104723_4105779_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	24.2	1.7e-08
WP_014479849.1|4105762_4106149_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	31.4	9.0e-08
WP_033881118.1|4106273_4106492_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	63.2	2.1e-17
WP_014479850.1|4106606_4107371_+	hypothetical protein	NA	A8ATN0	Listeria_phage	49.1	1.0e-47
WP_014479851.1|4107386_4107698_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105778750.1|4107758_4107950_+	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	53.1	7.1e-06
4107695:4107710	attR	TTAAAGGAGGACCAAA	NA	NA	NA	NA
WP_014479853.1|4107946_4108222_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.1	1.2e-19
WP_014479855.1|4108417_4108972_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	96.2	3.1e-94
WP_014479856.1|4108975_4109911_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	96.5	2.0e-170
WP_014479857.1|4109900_4110215_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	99.0	1.5e-53
WP_014479858.1|4110235_4110673_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	97.2	1.3e-79
WP_014479859.1|4110733_4113151_+	hypothetical protein	NA	D6R422	Bacillus_phage	88.7	0.0e+00
WP_014479860.1|4113350_4113788_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
WP_014479861.1|4113784_4114324_+	hypothetical protein	NA	Q9ZXC2	Bacillus_phage	96.1	1.8e-94
WP_014479862.1|4114358_4114874_+	hypothetical protein	NA	D6R425	Bacillus_phage	93.0	8.7e-91
WP_046159992.1|4115127_4115541_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.0	2.1e-63
WP_033881110.1|4115912_4116296_+	hypothetical protein	NA	A0A075M5R4	Enterococcus_phage	43.3	1.2e-17
WP_033881107.1|4116298_4116505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479865.1|4116743_4117229_+|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	36.0	4.2e-18
WP_014479866.1|4117218_4118952_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	48.9	2.1e-144
WP_014479867.1|4118968_4119175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479868.1|4119179_4120406_+|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	39.4	2.4e-70
WP_014479869.1|4120398_4120995_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.8	3.3e-49
WP_014479870.1|4121042_4122251_+|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.8	4.9e-76
WP_014479871.1|4122278_4122662_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.8	1.4e-05
WP_014479872.1|4122716_4123010_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
WP_014479873.1|4122999_4123326_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_031600548.1|4123325_4123718_+	hypothetical protein	NA	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
WP_014479875.1|4123714_4124122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479876.1|4124127_4124712_+	hypothetical protein	NA	U5U3Z7	Lactobacillus_phage	36.5	9.1e-28
WP_014479877.1|4124771_4125134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479878.1|4125145_4125328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479879.1|4125390_4129131_+	transglycosylase SLT domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	60.4	9.1e-105
WP_014479880.1|4129143_4129977_+|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	3.5e-33
WP_033881098.1|4129990_4131865_+	autolysin	NA	D6R400	Bacillus_phage	27.8	5.5e-50
WP_031600552.1|4133489_4134611_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.5	9.8e-196
WP_031600553.1|4134626_4134926_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	2.0e-39
WP_031600554.1|4134922_4135093_+	XkdX family protein	NA	NA	NA	NA	NA
WP_031600555.1|4135144_4135357_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
WP_031600556.1|4135371_4135635_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
WP_031600557.1|4135690_4136668_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	71.4	2.0e-64
WP_031600558.1|4136713_4137178_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_033881288.1|4137196_4138960_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	52.3	3.3e-121
