The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	757245	766090	4139887		Escherichia_phage(66.67%)	8	NA	NA
WP_036421545.1|757245_759699_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.7	1.7e-216
WP_004237907.1|759710_760328_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	8.0e-75
WP_004237908.1|760329_761190_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.7	1.1e-26
WP_004904608.1|761275_761887_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.2	1.9e-23
WP_004904609.1|761952_762243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004904610.1|762370_763057_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004904611.1|763145_763766_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	55.5	1.5e-60
WP_004904613.1|764134_766090_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	9.7e-82
>prophage 2
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	1297630	1312642	4139887		Escherichia_phage(11.11%)	12	NA	NA
WP_015422419.1|1297630_1299037_+	replicative DNA helicase	NA	O80281	Escherichia_phage	75.0	3.3e-193
WP_004241542.1|1299116_1300196_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.0	5.2e-29
WP_004241543.1|1300251_1301448_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004241544.1|1301496_1301763_-	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	55.7	1.2e-16
WP_004241545.1|1301894_1304729_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.6	0.0e+00
WP_004241546.1|1305007_1305526_+	single-stranded DNA-binding protein SSB1	NA	A0A291LCB6	Klebsiella_phage	84.6	2.3e-51
WP_004241551.1|1306719_1308411_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.2	6.0e-64
WP_004241553.1|1308428_1308713_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_004238248.1|1308755_1309313_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	31.7	1.2e-05
WP_004241554.1|1309483_1310233_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_036415716.1|1310239_1311034_-	M15 family metallopeptidase	NA	L7TND1	Rhizobium_phage	35.6	5.1e-05
WP_004238244.1|1311295_1312642_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	69.6	5.5e-153
>prophage 3
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2001546	2009601	4139887	tRNA	Mycobacterium_phage(33.33%)	8	NA	NA
WP_004235572.1|2001546_2002752_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.5	5.5e-27
WP_004240866.1|2003357_2004320_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	1.7e-135
WP_004240864.1|2004344_2006465_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.7	9.5e-208
WP_004240863.1|2006495_2006912_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.4	8.5e-12
WP_004240861.1|2006933_2007152_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
WP_004240857.1|2007460_2008543_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004240856.1|2008724_2009192_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004235583.1|2009391_2009601_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	4.5e-22
>prophage 4
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2023434	2090994	4139887	tail,portal,terminase,tRNA,lysis,integrase,plate,capsid,head	Morganella_phage(19.44%)	85	2032909:2032925	2075779:2075795
WP_032099112.1|2023434_2026017_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.4	8.0e-193
WP_004240836.1|2026233_2026959_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	6.4e-31
WP_004235602.1|2026955_2027633_-	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_004235603.1|2027632_2028370_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_036421286.1|2028568_2029471_-	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004240833.1|2029895_2030264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240832.1|2030321_2032358_+	DUF255 domain-containing protein	NA	NA	NA	NA	NA
WP_004235609.1|2032354_2033083_+	DsbA family protein	NA	NA	NA	NA	NA
2032909:2032925	attL	TGTGAAAGTCACTGATA	NA	NA	NA	NA
WP_004235610.1|2033082_2033580_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_004240831.1|2033651_2035205_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_004235612.1|2035201_2036092_-	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_036421295.1|2036396_2037620_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	48.3	1.9e-107
WP_071592733.1|2037576_2037783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240829.1|2037779_2038097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240827.1|2038083_2038860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036421283.1|2038849_2039101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240826.1|2039097_2039319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085987532.1|2039331_2039904_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.9	1.2e-32
WP_004240824.1|2039903_2040131_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_036425735.1|2040336_2041134_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	47.3	1.0e-45
WP_004242453.1|2041133_2041340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036425733.1|2041326_2041674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123805123.1|2042160_2042409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242451.1|2042356_2042656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242450.1|2042658_2043054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242433.1|2043046_2043220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036422003.1|2043221_2043410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242434.1|2043411_2043600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036422007.1|2043621_2044074_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PJ00	Moraxella_phage	47.8	1.3e-05
WP_004242438.1|2044217_2044994_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	53.9	3.4e-70
WP_024473767.1|2045104_2045326_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	71.6	2.4e-21
WP_105369946.1|2047602_2048226_+	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	62.0	5.8e-65
WP_105369881.1|2048222_2049209_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.9	3.1e-113
WP_105369882.1|2049208_2049988_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	39.3	3.1e-47
WP_062773656.1|2050200_2050395_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	100.0	1.0e-28
WP_004242333.1|2050533_2051571_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	95.9	9.7e-174
WP_036421924.1|2051627_2051810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024474664.1|2052153_2052345_+	hypothetical protein	NA	A0A1W6JP85	Morganella_phage	100.0	4.9e-31
WP_105369883.1|2052337_2052814_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	93.0	1.1e-82
WP_164091680.1|2052795_2052954_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	95.5	9.6e-17
WP_004904859.1|2052950_2053403_+|lysis	lysis protein	lysis	A0A1W6JP00	Morganella_phage	59.5	1.3e-13
WP_004242385.1|2053432_2053618_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	60.3	1.4e-11
WP_004904855.1|2053872_2054517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421907.1|2054858_2055431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105369947.1|2055501_2057379_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.3	9.4e-143
WP_004904843.1|2057388_2057640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105212821.1|2057639_2059292_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.6	1.3e-92
WP_004904838.1|2059288_2060143_+	S49 family peptidase	NA	A0A0B4SK12	Proteus_phage	44.3	1.5e-50
WP_004904836.1|2060145_2060766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004904834.1|2060765_2061158_+|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	39.8	1.3e-14
WP_004904831.1|2061231_2062278_+|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	34.1	1.3e-48
WP_004904830.1|2062290_2062662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004904829.1|2062651_2062990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004904826.1|2062989_2063547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004904824.1|2063549_2063717_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	54.8	4.7e-06
WP_004904820.1|2063713_2065195_+|tail	bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	44.9	8.0e-105
WP_004904816.1|2065204_2065573_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_105212820.1|2065572_2065839_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_004904808.1|2065981_2067862_+	hypothetical protein	NA	A0A0E3GMJ2	Enterobacteria_phage	33.3	1.2e-09
WP_123805124.1|2067922_2068336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421901.1|2068381_2068849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004904803.1|2068968_2070369_+|tail	phage tail/DNA circulation protein	tail	NA	NA	NA	NA
WP_004904800.1|2070365_2071436_+|tail	phage tail protein	tail	A0A2I7S9G1	Vibrio_phage	30.7	3.8e-40
WP_036421899.1|2071438_2072023_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_004904794.1|2072022_2072460_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	56.2	8.3e-18
WP_004904792.1|2072460_2073600_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	33.1	6.5e-38
WP_004904788.1|2073596_2074190_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_105369884.1|2074240_2074864_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	38.4	5.4e-10
WP_105369886.1|2075234_2075531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105369887.1|2075828_2075957_-	hypothetical protein	NA	E7EKV7	Edwardsiella_phage	53.7	3.1e-05
2075779:2075795	attR	TGTGAAAGTCACTGATA	NA	NA	NA	NA
WP_164091681.1|2075956_2076100_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_105369889.1|2076368_2076641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105369890.1|2076669_2076894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004241588.1|2076883_2077438_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	72.8	3.5e-69
WP_004241589.1|2077480_2077765_-	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	89.9	8.6e-40
WP_004241590.1|2077944_2078409_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_004241591.1|2078401_2079484_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	47.4	1.2e-49
WP_004241592.1|2079536_2080976_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_004241594.1|2081180_2082362_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_004235617.1|2083173_2083371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004241595.1|2083386_2084622_-	ROK family protein	NA	NA	NA	NA	NA
WP_004241596.1|2084635_2085799_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_004241597.1|2085882_2086692_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_004241599.1|2087121_2089152_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	46.8	2.1e-10
WP_004235622.1|2089326_2090994_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	2.3e-286
>prophage 5
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2235049	2244892	4139887	protease,tRNA	Planktothrix_phage(16.67%)	8	NA	NA
WP_004241749.1|2235049_2236996_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.3	1.5e-37
WP_004235798.1|2237082_2237313_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	2.6e-15
WP_015422570.1|2237571_2237892_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.7	2.6e-16
WP_004235801.1|2237925_2240211_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	2.8e-173
WP_002211347.1|2240287_2240506_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004241750.1|2240656_2241376_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004241751.1|2241353_2243120_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	5.8e-17
WP_036421740.1|2243122_2244892_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.2	3.7e-24
>prophage 6
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2645016	2689737	4139887	transposase,tail,integrase,terminase	Morganella_phage(94.0%)	55	2644929:2644985	2695753:2695809
2644929:2644985	attL	ACTGACTTGTAATCAGTAGGTCACCAGTTCGACTCCGGTAGCCGGCACCATATTAAA	NA	NA	NA	NA
WP_004240095.1|2645016_2646168_-|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	69.8	8.6e-155
WP_036420946.1|2646705_2647101_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	99.2	5.3e-72
WP_036420949.1|2647101_2647716_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	99.0	3.8e-109
WP_015422640.1|2647718_2648081_-	hypothetical protein	NA	A0A1W6JNZ2	Morganella_phage	85.8	6.4e-56
WP_004236757.1|2648077_2648242_-	hypothetical protein	NA	A0A1W6JNX8	Morganella_phage	100.0	3.2e-23
WP_004240098.1|2648238_2648415_-	hypothetical protein	NA	A0A1W6JNY7	Morganella_phage	100.0	6.3e-25
WP_155735002.1|2648888_2649047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164091683.1|2649187_2649346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240099.1|2649804_2650014_+	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	100.0	5.9e-30
WP_036420969.1|2650042_2650351_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	99.0	6.4e-49
WP_004240100.1|2651082_2652156_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	41.5	2.8e-67
WP_036420956.1|2652193_2652535_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	95.5	4.2e-57
WP_036414490.1|2652573_2653221_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	100.0	4.0e-117
WP_036420959.1|2653320_2653530_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW6	Morganella_phage	91.3	2.7e-14
WP_004240105.1|2653660_2653987_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	99.1	7.0e-54
WP_004240106.1|2654128_2654920_+	replication protein	NA	A0A1W6JNY0	Morganella_phage	98.5	8.3e-133
WP_004240107.1|2654919_2655648_+	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	97.9	4.2e-131
WP_036420961.1|2655896_2656340_+	hypothetical protein	NA	A0A1W6JNZ4	Morganella_phage	99.3	2.7e-80
WP_036420964.1|2656545_2656950_+	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	89.4	1.2e-66
WP_024473812.1|2656977_2657421_-	universal stress protein	NA	NA	NA	NA	NA
WP_036420965.1|2657530_2658160_+	Lambda NinG family protein	NA	A0A1W6JNX3	Morganella_phage	97.1	2.7e-102
WP_004240110.1|2658449_2658821_+	phage antitermination protein Q	NA	A0A1W6JNX1	Morganella_phage	96.7	3.8e-64
WP_001339197.1|2658830_2660039_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_004242341.1|2660599_2660812_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	100.0	2.0e-33
WP_079549287.1|2662037_2662799_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_015422642.1|2663127_2663568_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	54.0	5.2e-28
WP_004242347.1|2663874_2664333_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_015422643.1|2665102_2665312_+	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	67.2	8.5e-21
WP_004240322.1|2665981_2666173_+	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
WP_036424740.1|2666165_2666642_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	92.4	8.9e-82
WP_164091684.1|2666623_2666782_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	84.8	4.5e-14
WP_004242351.1|2666778_2667156_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	82.4	4.2e-50
WP_036421931.1|2667779_2668295_+	membrane protein	NA	A0A1W6JNX6	Morganella_phage	99.4	2.1e-97
WP_004242354.1|2668564_2668762_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	95.4	3.6e-29
WP_004242355.1|2668764_2669292_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	99.4	1.9e-93
WP_004242356.1|2669293_2670778_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	99.4	2.1e-299
WP_004242359.1|2670779_2672159_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	98.9	3.3e-262
WP_004242360.1|2672162_2673224_+	hypothetical protein	NA	A0A1W6JNT7	Morganella_phage	98.9	4.3e-193
WP_004242361.1|2673289_2673976_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	97.4	9.2e-96
WP_004242362.1|2673981_2674962_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	98.5	4.9e-175
WP_004242363.1|2674986_2675364_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	98.4	4.0e-61
WP_049241820.1|2675365_2675707_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	96.5	4.0e-60
WP_004242365.1|2675708_2676077_+	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	97.5	4.3e-60
WP_036421933.1|2676073_2676445_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	98.4	2.8e-67
WP_004242369.1|2676509_2677265_+|tail	tail protein	tail	A0A1W6JNT1	Morganella_phage	96.8	4.3e-131
WP_004242371.1|2677315_2678008_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	99.1	1.3e-126
WP_004242373.1|2678051_2681375_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	99.5	0.0e+00
WP_004242374.1|2681414_2681744_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	99.1	1.5e-59
WP_004242375.1|2681740_2682439_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	99.1	6.6e-134
WP_036421935.1|2682442_2683156_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	99.2	7.7e-146
WP_036421940.1|2683098_2683665_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	99.2	8.4e-63
WP_004242379.1|2683665_2686800_+	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	98.4	0.0e+00
WP_004238646.1|2686801_2687122_+	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	99.1	6.9e-62
WP_004238648.1|2687118_2687805_+	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	98.2	1.3e-134
WP_036423168.1|2688186_2689737_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	73.8	1.9e-210
2695753:2695809	attR	ACTGACTTGTAATCAGTAGGTCACCAGTTCGACTCCGGTAGCCGGCACCATATTAAA	NA	NA	NA	NA
>prophage 7
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2700647	2710918	4139887		Burkholderia_phage(33.33%)	12	NA	NA
WP_004239643.1|2700647_2702135_+	DUF3383 domain-containing protein	NA	E5E3F3	Pseudomonas_phage	34.8	4.2e-69
WP_004237449.1|2702150_2702603_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	37.8	8.3e-21
WP_004239642.1|2702645_2703104_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	49.3	3.5e-27
WP_004239641.1|2703186_2705157_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.9	1.1e-16
WP_004237446.1|2705153_2705693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239640.1|2705689_2705983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237444.1|2705975_2706791_+	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	27.5	2.9e-16
WP_004239639.1|2706807_2707500_+	phage-related protein	NA	Q6IWQ1	Burkholderia_phage	40.1	1.8e-35
WP_004237440.1|2707496_2707841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239638.1|2707833_2709021_+	phage-related protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	39.4	1.1e-75
WP_004239637.1|2709017_2709680_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	38.3	4.2e-37
WP_004239636.1|2709685_2710918_+	hypothetical protein	NA	A0A2K9V2I0	Shigella_phage	33.8	2.0e-24
>prophage 8
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	2735107	2772187	4139887	tail,holin,integrase,terminase	Escherichia_phage(34.38%)	47	2724803:2724819	2768845:2768861
2724803:2724819	attL	CGCTCGATTCCGTCAGG	NA	NA	NA	NA
WP_004239607.1|2735107_2736310_+|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	64.7	1.9e-144
WP_004239606.1|2736310_2736487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239605.1|2736496_2736694_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	61.9	4.1e-17
WP_036420629.1|2736698_2737301_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	60.9	2.6e-62
WP_052005511.1|2737287_2737671_-	DUF2591 family protein	NA	E9NID9	Enterobacter_phage	38.3	8.6e-11
WP_036420627.1|2737654_2738068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239600.1|2738268_2738805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239598.1|2738890_2739085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052005510.1|2739087_2739399_-	hypothetical protein	NA	A0A2I7R6M5	Vibrio_phage	42.5	3.8e-09
WP_105369898.1|2739401_2740409_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	61.0	9.3e-113
WP_004239595.1|2740434_2740578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024472865.1|2740593_2740833_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004239594.1|2740873_2741965_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	58.2	1.4e-114
WP_004239593.1|2742013_2743711_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	46.4	4.4e-107
WP_004239592.1|2743694_2743853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036407682.1|2744180_2744771_-	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	35.0	1.6e-27
WP_036420625.1|2744902_2745121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239589.1|2745451_2746477_+	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	56.6	2.4e-47
WP_036420623.1|2746445_2746919_+	replication protein	NA	NA	NA	NA	NA
WP_004239587.1|2747125_2747548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239586.1|2747537_2747900_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.5	1.2e-33
WP_105369899.1|2747980_2748238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036420621.1|2748316_2748757_+	DUF2591 family protein	NA	NA	NA	NA	NA
WP_004239583.1|2748753_2749104_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	59.1	3.3e-33
WP_036420619.1|2749409_2749970_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	54.3	3.5e-45
WP_004239581.1|2749969_2751454_+	hypothetical protein	NA	G9L6B8	Escherichia_phage	78.5	9.8e-236
WP_036420617.1|2751501_2751867_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	71.5	2.2e-40
WP_004239577.1|2752064_2752271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239576.1|2752286_2753948_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	61.2	3.9e-193
WP_004239575.1|2753944_2754268_+	hypothetical protein	NA	Q2A090	Sodalis_phage	47.0	8.3e-15
WP_004239574.1|2754264_2754927_+	hypothetical protein	NA	G9L6C4	Escherichia_phage	58.7	2.3e-43
WP_004239573.1|2754940_2755921_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	62.2	8.2e-114
WP_004239571.1|2755975_2756407_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.5	4.2e-30
WP_004239570.1|2756415_2756745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036420615.1|2756794_2757106_+	hypothetical protein	NA	T1SBJ0	Salmonella_phage	41.0	5.2e-14
WP_004239566.1|2757105_2757711_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	63.2	2.0e-70
WP_004239565.1|2757710_2760179_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	69.0	0.0e+00
WP_004239563.1|2760182_2760647_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	61.0	4.4e-49
WP_036420612.1|2760646_2761219_+	hypothetical protein	NA	Q858G1	Salmonella_phage	46.3	6.8e-28
WP_004239560.1|2761230_2764038_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.1	3.5e-109
WP_004239559.1|2764037_2767433_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	35.6	1.9e-178
WP_004239558.1|2767464_2768277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239556.1|2768318_2768570_-	hypothetical protein	NA	Q858F6	Salmonella_phage	37.3	9.0e-09
WP_004239555.1|2768727_2770977_+	hypothetical protein	NA	G9L6E4	Escherichia_phage	51.0	2.4e-60
2768845:2768861	attR	CCTGACGGAATCGAGCG	NA	NA	NA	NA
WP_004239554.1|2771070_2771442_+	phage protein	NA	G9L6E6	Escherichia_phage	38.6	2.5e-15
WP_024472897.1|2771431_2771707_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	52.2	3.2e-15
WP_004239550.1|2771710_2772187_+	Structural protein P5	NA	A0A0A0RQM4	Escherichia_phage	48.2	5.1e-29
>prophage 9
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	3207094	3288677	4139887	tail,portal,terminase,tRNA,protease,integrase	Enterobacteria_phage(33.33%)	94	3237208:3237223	3290094:3290109
WP_004235488.1|3207094_3208369_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	3.3e-83
WP_004235487.1|3208504_3209155_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_004239113.1|3209209_3210328_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_004235484.1|3210646_3211114_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_015422751.1|3211173_3211608_-	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_032098095.1|3212123_3212360_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_004235481.1|3212512_3212920_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004239109.1|3213029_3213677_+	ribonuclease T	NA	NA	NA	NA	NA
WP_004239108.1|3213744_3214425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004235478.1|3214562_3214904_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_004239107.1|3215187_3215808_+	homoserine/homoserine lactone efflux protein	NA	NA	NA	NA	NA
WP_004239106.1|3215870_3216329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239105.1|3216407_3217169_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.6	3.0e-07
WP_004235472.1|3217192_3217732_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_004239103.1|3217801_3218110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239101.1|3218507_3219086_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_123805126.1|3219169_3219265_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_004235455.1|3219529_3220555_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.5	2.4e-31
WP_004239099.1|3220558_3221461_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004239098.1|3221582_3222794_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.3	2.6e-16
WP_004239097.1|3223059_3224223_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.5	8.0e-84
WP_004239096.1|3224305_3224971_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.8	1.4e-24
WP_004239095.1|3225183_3226557_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004235443.1|3227274_3228687_+	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_004239093.1|3229012_3229249_+	major outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_004239092.1|3229389_3230472_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_004239091.1|3230570_3230990_-	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_004239090.1|3230998_3232237_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.5	4.5e-85
WP_004239089.1|3232236_3233541_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_004235432.1|3233515_3234262_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.8	4.9e-10
WP_004239088.1|3234313_3235798_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004239087.1|3235813_3236194_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	35.9	1.1e-13
WP_004239086.1|3236532_3236958_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_036420557.1|3236992_3240061_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
3237208:3237223	attL	TGCTGACAGACTGCAG	NA	NA	NA	NA
WP_015422756.1|3240270_3241386_+	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
WP_004239083.1|3241860_3244239_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.3	3.4e-174
WP_004235416.1|3244457_3245321_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_004239082.1|3245467_3246517_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.3	3.5e-78
WP_004239078.1|3247035_3247320_+	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	87.6	3.3e-39
WP_036420531.1|3247580_3248246_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_065425766.1|3248594_3248852_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105369904.1|3248891_3250472_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	73.4	9.8e-210
WP_036421961.1|3250537_3251152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036421959.1|3251153_3251522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242411.1|3251515_3254677_-	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	49.7	4.9e-285
WP_046024959.1|3254689_3255334_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	46.7	3.9e-48
WP_004242409.1|3255237_3255966_-	C40 family peptidase	NA	A0A0P0ZE89	Stx2-converting_phage	60.8	2.6e-88
WP_004242408.1|3255983_3256682_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	50.9	8.5e-65
WP_004242407.1|3256693_3257476_-	hypothetical protein	NA	Q9MCN2	Enterobacteria_phage	45.0	6.9e-55
WP_004242405.1|3257978_3258308_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	54.1	7.1e-30
WP_004242404.1|3258310_3261232_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	35.1	9.5e-142
WP_036413646.1|3261212_3261521_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	51.5	9.7e-21
WP_004242401.1|3261544_3261943_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	36.4	3.6e-12
WP_004242400.1|3261946_3262474_-|tail	Putative tail component protein	tail	M9NYX0	Enterobacteria_phage	75.5	1.9e-64
WP_004242399.1|3262483_3262882_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	61.7	5.2e-43
WP_004242398.1|3262881_3263445_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	55.6	1.6e-45
WP_004242396.1|3263446_3263725_-	ATP-binding sugar transporter-like protein	NA	K7PH43	Enterobacteria_phage	43.2	5.5e-15
WP_004242395.1|3263729_3264071_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	56.5	5.7e-22
WP_004242393.1|3264156_3266193_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	65.4	2.2e-254
WP_004242392.1|3266164_3267640_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	67.8	2.9e-187
WP_004242389.1|3267636_3267855_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	58.6	1.1e-15
WP_004242387.1|3267851_3269966_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.4	2.3e-294
WP_004242386.1|3269962_3270466_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	57.2	2.3e-40
WP_004242385.1|3270856_3271042_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	60.3	1.4e-11
WP_004242383.1|3271438_3271816_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	86.4	4.0e-53
WP_004242382.1|3271812_3271971_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	93.3	3.7e-16
WP_105369906.1|3271952_3272429_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.7	2.2e-80
WP_004240322.1|3272421_3272613_-	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
WP_024474662.1|3272936_3273254_-	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	65.7	2.4e-30
WP_004242331.1|3273475_3274534_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	95.0	1.3e-170
WP_105369907.1|3274672_3274867_-	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	96.9	5.1e-28
WP_036422061.1|3275134_3275716_+	membrane protein	NA	NA	NA	NA	NA
WP_105369908.1|3275777_3276557_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	39.5	5.6e-49
WP_105369909.1|3276556_3277543_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.2	4.8e-114
WP_105369910.1|3277539_3279117_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.4	2.0e-210
WP_036421918.1|3279627_3279855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036421915.1|3279949_3280660_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	64.8	3.0e-81
WP_004242325.1|3280800_3281565_+	KilA-N domain-containing protein	NA	K7YGK4	Megavirus	45.6	2.1e-08
WP_036421911.1|3282092_3282278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421909.1|3282279_3282468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242323.1|3282469_3282643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105369911.1|3282635_3283031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105369912.1|3283033_3283531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105369913.1|3284017_3284365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242337.1|3284351_3284558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105369914.1|3284557_3285352_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	46.3	1.0e-42
WP_004240004.1|3285557_3285776_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_004240003.1|3285772_3286381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240002.1|3286377_3286599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036420896.1|3286595_3286853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240001.1|3286836_3286977_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	47.7	1.5e-05
WP_036420916.1|3286976_3287294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239999.1|3287290_3287497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239998.1|3287453_3288677_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	49.8	6.6e-113
3290094:3290109	attR	TGCTGACAGACTGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	3490589	3493516	4139887		Morganella_phage(85.71%)	7	NA	NA
WP_036417780.1|3490589_3490787_-	hypothetical protein	NA	A0A1W6JP52	Morganella_phage	67.9	1.1e-12
WP_004235070.1|3490758_3491136_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	38.4	7.7e-12
WP_004239826.1|3491132_3491291_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	67.4	1.8e-10
WP_004239825.1|3491272_3491749_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	77.7	3.6e-67
WP_004239823.1|3491738_3491933_-	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	73.0	3.4e-24
WP_004239822.1|3492005_3492443_-	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	47.8	1.2e-27
WP_004239817.1|3492808_3493516_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	55.7	2.9e-68
>prophage 11
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	3507853	3557953	4139887	tail,portal,terminase,tRNA,protease,integrase,capsid,head	Morganella_phage(79.17%)	62	3520164:3520178	3558916:3558930
WP_105369916.1|3507853_3508288_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	67.7	2.8e-42
WP_004239791.1|3508462_3509425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239790.1|3509440_3510442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071592716.1|3510831_3511497_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_014226449.1|3511748_3511946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004235018.1|3512303_3512468_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-22
WP_004239784.1|3513849_3516591_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080634081.1|3516825_3517314_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	96.2	2.7e-86
WP_004239781.1|3518734_3519421_-	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	94.7	5.7e-130
WP_036420868.1|3519417_3519738_-	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	97.2	4.5e-61
WP_004239780.1|3519739_3522916_-	host specificity protein J	NA	A0A1W6JNZ7	Morganella_phage	89.3	0.0e+00
3520164:3520178	attL	GCCGAAGCCGTGCCT	NA	NA	NA	NA
WP_105369961.1|3522948_3523545_-|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	87.9	7.2e-89
WP_036420900.1|3523618_3524047_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	68.8	2.4e-49
WP_004239777.1|3524090_3524813_-|tail	phage tail assembly protein	tail	A0A1W6JP31	Morganella_phage	95.2	2.4e-134
WP_004239776.1|3524815_3525574_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	96.4	4.8e-146
WP_004239775.1|3525570_3525906_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	99.1	6.5e-63
WP_004239774.1|3525902_3529160_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	97.4	0.0e+00
WP_025154454.1|3529185_3529470_-	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	88.2	3.6e-38
WP_105369962.1|3529481_3529850_-|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	94.3	2.2e-59
WP_004239771.1|3529868_3530336_-	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	92.9	7.7e-78
WP_004239768.1|3530395_3530731_-	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	93.7	1.6e-56
WP_004239767.1|3530727_3531177_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	96.0	4.2e-73
WP_036420863.1|3531169_3531493_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	96.3	1.4e-54
WP_004239763.1|3531503_3531806_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	81.0	7.0e-40
WP_004239761.1|3531892_3533110_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	91.9	3.8e-209
WP_004239758.1|3533119_3533728_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	91.0	5.8e-102
WP_004239756.1|3533717_3534941_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	96.1	5.6e-229
WP_004239754.1|3534930_3535092_-	hypothetical protein	NA	A0A1W6JP78	Morganella_phage	100.0	3.8e-21
WP_004239752.1|3535088_3536819_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	93.8	0.0e+00
WP_004239751.1|3536822_3537293_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	89.7	1.7e-77
WP_004239750.1|3537428_3537632_-	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	95.5	3.4e-30
WP_036420859.1|3537628_3537979_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	97.4	1.8e-63
WP_036420857.1|3538211_3538790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105369963.1|3538839_3539346_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	42.1	6.7e-19
WP_004239747.1|3539363_3539522_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	88.9	4.0e-15
WP_105369919.1|3539503_3539980_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.1	9.9e-81
WP_004240322.1|3539972_3540164_-	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
WP_004240607.1|3540587_3541397_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	47.5	4.3e-68
WP_036421160.1|3542058_3542268_-	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	67.2	1.1e-20
WP_036421164.1|3542538_3542988_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.6	1.5e-22
WP_004240609.1|3543217_3543895_-	antiterminator Q	NA	A0A1W6JP37	Morganella_phage	96.4	8.4e-126
WP_004240610.1|3543925_3544942_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	89.3	2.3e-180
WP_036421204.1|3544941_3545733_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	84.4	4.3e-121
WP_004240612.1|3545775_3546171_-	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	38.8	5.4e-16
WP_105369964.1|3546170_3547049_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	85.6	3.6e-129
WP_004238677.1|3547051_3547246_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	82.8	1.5e-24
WP_123805127.1|3547238_3547439_-	hypothetical protein	NA	A0A1W6JP45	Morganella_phage	66.7	1.4e-20
WP_004238678.1|3547502_3547967_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.7	2.7e-35
WP_036421167.1|3547996_3548197_-	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	71.2	1.8e-20
WP_036421170.1|3548306_3548954_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	61.0	1.6e-70
WP_004240617.1|3549082_3549295_+	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	75.7	1.6e-22
WP_036421173.1|3549401_3549635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240619.1|3549784_3550012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421176.1|3550074_3550317_+	excisionase	NA	NA	NA	NA	NA
WP_004240620.1|3550297_3551425_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.1	9.4e-122
WP_036421179.1|3551700_3552330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164091686.1|3552322_3553066_-	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	36.1	7.0e-33
WP_105369921.1|3553110_3553749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240623.1|3554165_3555419_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	8.0e-21
WP_105369965.1|3555586_3556249_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_036421210.1|3556202_3556667_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004238115.1|3556849_3557953_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3558916:3558930	attR	GCCGAAGCCGTGCCT	NA	NA	NA	NA
>prophage 12
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	3667134	3743614	4139887	transposase,integrase,capsid,terminase	Escherichia_phage(16.98%)	80	3707721:3707736	3747898:3747913
WP_001339197.1|3667134_3668343_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_080634085.1|3668790_3669582_+	hypothetical protein	NA	A0A1V0SL98	Klosneuvirus	32.0	7.3e-12
WP_004240356.1|3671077_3671740_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.2	4.5e-39
WP_004240355.1|3671736_3672924_-	phage-related protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	39.2	2.3e-78
WP_004240354.1|3672916_3673261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240352.1|3673257_3673950_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	43.1	1.0e-33
WP_004240349.1|3673963_3674779_-	hypothetical protein	NA	A0A0H4M7L6	Pseudomonas_phage	28.7	9.8e-20
WP_004240348.1|3674771_3675065_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	34.4	1.8e-08
WP_004240345.1|3675061_3675592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105369968.1|3675588_3677715_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.1	3.1e-17
WP_004240342.1|3677806_3678268_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.3	3.3e-25
WP_004240341.1|3678308_3678761_-	hypothetical protein	NA	A0A2H4P6T4	Pseudomonas_phage	43.5	1.5e-25
WP_004240340.1|3678770_3680258_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.1	1.9e-82
WP_004240339.1|3680267_3680783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240338.1|3680772_3681141_-	phage protein	NA	I7A8K9	Escherichia_phage	34.5	1.5e-15
WP_004240337.1|3681140_3681599_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	40.6	7.9e-19
WP_036421070.1|3681595_3682000_-	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	30.9	6.1e-07
WP_004240335.1|3682033_3682387_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	34.3	1.2e-06
WP_004240334.1|3682442_3683510_-	DUF2184 domain-containing protein	NA	A0A2H4P6S2	Pseudomonas_phage	40.2	7.2e-55
WP_004240332.1|3684005_3685286_-	DUF2213 domain-containing protein	NA	A0A2H5BG39	Pseudoalteromonas_phage	41.0	3.0e-39
WP_036415920.1|3685282_3685996_-|capsid	minor capsid protein	capsid	Q6IWU3	Burkholderia_phage	39.1	2.9e-36
WP_004240330.1|3686018_3687533_-	DUF1073 domain-containing protein	NA	J7M2P3	Pseudomonas_phage	47.1	5.3e-104
WP_004240329.1|3687534_3688935_-|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	41.3	3.2e-87
WP_004240328.1|3689135_3690152_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	38.9	1.5e-33
WP_004240327.1|3690209_3690395_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	63.0	2.4e-11
WP_052005519.1|3690692_3691220_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	40.4	1.6e-18
WP_004240324.1|3691356_3691833_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	93.0	1.4e-82
WP_004240322.1|3691825_3692017_-	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
WP_036421050.1|3692574_3692988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105369922.1|3694049_3694322_-	DUF1133 family protein	NA	M1FPN0	Enterobacteria_phage	50.6	6.8e-10
WP_001067855.1|3694414_3695119_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|3695777_3696335_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|3697884_3698589_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|3699782_3700325_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|3700337_3701198_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|3701304_3702009_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_105369923.1|3702048_3702939_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|3702935_3704174_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|3704173_3704758_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|3705250_3706015_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|3706521_3707022_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3707149_3707989_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
3707721:3707736	attL	CGCTGGGTTTCCGGTT	NA	NA	NA	NA
WP_000679427.1|3707982_3708330_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|3708493_3709285_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|3709290_3709536_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|3709692_3710190_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001067855.1|3711255_3711960_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201164.1|3712518_3713331_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|3713334_3713700_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|3713704_3714343_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|3714353_3715385_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_000050481.1|3715697_3717239_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|3717643_3718483_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3718476_3718824_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|3719029_3719818_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|3719948_3720422_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000845048.1|3720579_3721593_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|3721994_3722699_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|3725020_3725353_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|3725399_3726275_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001067855.1|3726930_3727635_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004240320.1|3727914_3728226_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	69.8	7.0e-35
WP_004240319.1|3728238_3728832_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	58.2	7.5e-62
WP_004240315.1|3733208_3734579_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.8	7.2e-100
WP_004240314.1|3734581_3735154_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	51.4	3.5e-48
WP_004240313.1|3735146_3735998_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	54.8	5.0e-35
WP_004240312.1|3735999_3736224_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	63.5	1.1e-21
WP_004240310.1|3736241_3736694_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	57.0	1.1e-33
WP_004240308.1|3736737_3736986_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	47.2	5.6e-11
WP_004240305.1|3737091_3737844_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	33.3	7.1e-25
WP_123805131.1|3738096_3738411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036415342.1|3738403_3738622_-	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	60.6	8.1e-14
WP_004240302.1|3738879_3739212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240301.1|3739227_3741225_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.5	1.5e-125
WP_004240299.1|3741221_3741719_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	65.1	1.9e-50
WP_004240298.1|3741784_3741952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421064.1|3741951_3742137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036415351.1|3742207_3742387_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	47.3	1.3e-06
WP_004240296.1|3742370_3742589_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	48.6	1.5e-12
WP_004240295.1|3742591_3743614_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	63.1	5.9e-123
3747898:3747913	attR	CGCTGGGTTTCCGGTT	NA	NA	NA	NA
>prophage 13
NZ_CP027177	Morganella morganii strain AR_0057 chromosome, complete genome	4139887	3783832	3930839	4139887	tail,terminase,tRNA,transposase,protease,lysis,holin,integrase,plate	Acinetobacter_phage(25.33%)	176	3774918:3774934	3897366:3897382
3774918:3774934	attL	ATCGTTCTCCACCTCAT	NA	NA	NA	NA
WP_004240231.1|3783832_3784060_+	DNA polymerase III theta subunit	NA	H9C187	Pectobacterium_phage	58.2	7.4e-18
WP_164091687.1|3784056_3784446_-|tail	tail fiber assembly protein	tail	E7EKV7	Edwardsiella_phage	51.4	9.4e-13
WP_105369925.1|3784478_3785540_-	hypothetical protein	NA	K4I0L0	Acinetobacter_phage	43.3	2.1e-22
WP_004241110.1|3785547_3786180_-	DUF2612 domain-containing protein	NA	K4HYS2	Acinetobacter_phage	47.6	4.4e-44
WP_004241108.1|3786179_3787370_-	hypothetical protein	NA	E2GM17	Acinetobacter_phage	45.5	9.4e-88
WP_036421492.1|3787366_3787720_-	hypothetical protein	NA	K4IBY0	Acinetobacter_phage	49.6	4.6e-27
WP_105369969.1|3787721_3788366_-|plate	phage baseplate protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	36.9	9.4e-26
WP_004241105.1|3788394_3789282_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	42.6	4.9e-65
WP_004241104.1|3789271_3789544_-	hypothetical protein	NA	A0A191ZDK0	Acinetobacter_phage	47.8	3.4e-17
WP_004241103.1|3789545_3790442_-	hypothetical protein	NA	A0A1V0DZ59	Acinetobacter_phage	49.5	3.3e-45
WP_004241102.1|3790465_3791248_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	42.9	3.0e-42
WP_004241101.1|3791314_3792043_-	Phage Rha protein	NA	H6WRU8	Salmonella_phage	65.2	2.5e-35
WP_123805133.1|3792116_3792290_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_105369926.1|3792411_3792876_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_036421482.1|3792822_3793359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036421479.1|3793345_3793843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036421476.1|3793982_3794462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105369927.1|3794839_3796963_-	hypothetical protein	NA	A0A1W6JPF2	Morganella_phage	62.8	4.0e-198
WP_004241097.1|3796986_3797157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004241096.1|3797198_3797609_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	43.0	2.7e-18
WP_123805134.1|3797608_3798055_-	hypothetical protein	NA	E2GLU0	Acinetobacter_phage	48.3	7.7e-35
WP_004241092.1|3798069_3799530_-	DUF3383 domain-containing protein	NA	E2GLU1	Acinetobacter_phage	41.1	2.0e-92
WP_004241091.1|3799539_3800025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036421514.1|3800012_3800390_-	hypothetical protein	NA	E2GLU4	Acinetobacter_phage	40.3	8.5e-19
WP_004241089.1|3800385_3800817_-	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	43.1	2.0e-24
WP_052005528.1|3800809_3801265_-	DUF4054 domain-containing protein	NA	K4HYQ8	Acinetobacter_phage	45.2	6.6e-18
WP_004241087.1|3801288_3801606_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	30.4	1.8e-06
WP_004241086.1|3801665_3802661_-	hypothetical protein	NA	I2GUD7	Acinetobacter_phage	51.1	1.1e-81
WP_004241085.1|3802670_3803153_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	48.1	3.4e-20
WP_080634096.1|3803164_3804355_-	DUF2213 domain-containing protein	NA	K4I393	Acinetobacter_phage	54.0	1.2e-66
WP_036421464.1|3804367_3804622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004241083.1|3804632_3805334_-	phage protein	NA	A0A068CBK2	Acinetobacter_phage	46.1	6.8e-54
WP_004241082.1|3805395_3806928_-	DUF1073 domain-containing protein	NA	A0A192RWX3	Acinetobacter_phage	50.8	1.6e-116
WP_052005526.1|3806927_3808325_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	1.3e-189
WP_004241079.1|3809173_3809716_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	60.4	2.3e-49
WP_164091688.1|3810013_3810181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071592744.1|3810159_3810375_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	48.6	1.4e-10
WP_105369970.1|3810404_3810797_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	62.5	1.1e-34
WP_004241075.1|3810855_3811338_-	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	70.5	1.0e-61
WP_036419316.1|3811330_3811636_-|holin	holin	holin	NA	NA	NA	NA
WP_036421462.1|3811955_3812480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080634099.1|3812996_3813449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004241072.1|3813580_3813781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036421460.1|3813770_3814136_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	66.9	3.1e-42
WP_036421457.1|3814132_3814423_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	76.0	1.5e-36
WP_080634098.1|3814614_3814836_-	hypothetical protein	NA	A0A1X9Y877	Proteus_phage	52.1	1.4e-13
WP_036421454.1|3814904_3815297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036421451.1|3815293_3815491_-	hypothetical protein	NA	A0A1W6JP14	Morganella_phage	89.2	1.2e-29
WP_036421447.1|3815487_3815931_-	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	84.9	2.1e-29
WP_004241067.1|3815939_3816197_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	36.7	4.4e-11
WP_004241066.1|3816200_3816404_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_004241065.1|3816405_3816624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004241064.1|3816623_3816998_-	ASCH domain-containing protein	NA	A0A1S6L2Y8	Erwinia_phage	51.2	1.6e-30
WP_036421444.1|3816997_3817198_-	DUF551 domain-containing protein	NA	G9L658	Escherichia_phage	43.9	3.9e-07
WP_004241063.1|3817184_3817394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004241062.1|3817418_3818795_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	59.6	2.1e-160
WP_004241061.1|3818794_3819883_-	Replication protein O	NA	E5AGE9	Erwinia_phage	50.1	3.1e-77
WP_004241058.1|3819872_3820043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025154244.1|3820069_3820396_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	91.7	6.1e-50
WP_071592742.1|3820515_3820725_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	77.9	4.4e-25
WP_036421442.1|3820832_3821477_+	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	63.6	6.2e-78
WP_123805135.1|3821586_3821847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421439.1|3821843_3822332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004241050.1|3822700_3823000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085987535.1|3823283_3823448_+	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	87.0	7.1e-23
WP_162837892.1|3823488_3823641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421432.1|3823650_3823914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421431.1|3823910_3824141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004241047.1|3824118_3824937_+	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	78.7	5.2e-130
WP_004241046.1|3824929_3825730_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	89.4	9.3e-132
WP_036421430.1|3825774_3826782_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	59.8	1.3e-114
WP_004241044.1|3826784_3827318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004241043.1|3827317_3827680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004241041.1|3827686_3827842_+	hypothetical protein	NA	A0A1P8DTI7	Proteus_phage	64.6	8.5e-10
WP_004241040.1|3827838_3828111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421428.1|3828094_3828433_+	DUF2591 family protein	NA	E9NID9	Enterobacter_phage	44.5	5.6e-14
WP_071592739.1|3828814_3829171_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004241036.1|3829071_3830139_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	52.9	2.6e-113
WP_004241032.1|3831539_3832910_+	tyrosine phenol-lyase	NA	NA	NA	NA	NA
WP_004241031.1|3833044_3834313_+	tyrosine permease	NA	NA	NA	NA	NA
WP_004241029.1|3834776_3835784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015422902.1|3835986_3837255_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_004241027.1|3837385_3838093_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_004241026.1|3838164_3838674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024474922.1|3839010_3839496_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_036421494.1|3839548_3840697_-	MFS transporter	NA	NA	NA	NA	NA
WP_004241022.1|3840992_3841853_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004242308.1|3842670_3844710_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.3	3.4e-13
WP_004242309.1|3845002_3846007_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004242310.1|3846105_3846438_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_004242312.1|3846490_3847561_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_004242313.1|3847572_3848727_-	galactokinase	NA	NA	NA	NA	NA
WP_164091689.1|3848740_3849799_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_004242315.1|3849866_3850883_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	49.2	5.2e-87
WP_036421893.1|3851124_3852114_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_004242318.1|3852379_3855442_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.8	5.3e-159
WP_004242319.1|3855438_3855888_+	beta-galactosidase subunit beta	NA	NA	NA	NA	NA
WP_001339197.1|3856016_3857225_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000428546.1|3857738_3858332_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|3858444_3859650_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|3859731_3860355_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|3860332_3861019_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000429836.1|3862182_3862617_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|3862688_3863039_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|3863052_3863328_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|3863363_3863786_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|3863837_3865532_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|3865549_3865912_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|3865908_3866145_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|3866180_3866849_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|3868238_3868943_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|3869574_3870405_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|3870535_3871090_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|3871233_3871938_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|3872158_3872863_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001347546.1|3872874_3873300_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|3873449_3874310_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|3874894_3875599_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|3875788_3876604_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|3876754_3877459_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|3877519_3878356_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001145207.1|3878355_3879114_-	APH(3'') family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	34.4	6.7e-23
WP_001043265.1|3879218_3880034_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|3880340_3881192_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|3881947_3882652_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000134999.1|3883611_3884253_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000147567.1|3884825_3885386_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|3885388_3888355_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|3888421_3888799_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|3888999_3889659_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_105369928.1|3890645_3891791_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	3.3e-223
WP_004238594.1|3891902_3893369_+	amino acid permease	NA	NA	NA	NA	NA
WP_004238593.1|3893598_3894099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240873.1|3894193_3895498_-	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_015422905.1|3895606_3896584_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	NA	NA	NA	NA
WP_004240876.1|3896812_3897013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032098824.1|3897050_3897923_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3897366:3897382	attR	ATCGTTCTCCACCTCAT	NA	NA	NA	NA
WP_004240878.1|3898053_3899001_-	cation transporter	NA	NA	NA	NA	NA
WP_004238583.1|3899447_3899885_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	46.2	5.4e-25
WP_004238582.1|3899934_3900336_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_004240879.1|3900474_3900999_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004238289.1|3901322_3901535_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004240880.1|3901678_3901927_+	YecH family protein	NA	NA	NA	NA	NA
WP_004238291.1|3902002_3902254_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	39.5	2.8e-10
WP_004240881.1|3902373_3902730_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_004240883.1|3902720_3903275_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004240884.1|3903346_3904060_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_004240885.1|3904480_3905104_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	31.3	1.3e-16
WP_004240886.1|3905090_3905879_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004238300.1|3905893_3906655_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015422911.1|3907283_3908108_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004240889.1|3908206_3908941_+	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_004238304.1|3909091_3909466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004238305.1|3909475_3910216_-	cyclase family protein	NA	NA	NA	NA	NA
WP_004238308.1|3910349_3910640_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004238311.1|3910672_3911308_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_004240890.1|3911382_3912321_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036421309.1|3912434_3912887_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004238314.1|3912886_3913315_+	membrane protein	NA	NA	NA	NA	NA
WP_004240892.1|3913394_3913703_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004240893.1|3913717_3914413_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004238319.1|3914413_3914680_-	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_004240894.1|3914861_3916283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032098834.1|3916367_3917000_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032098853.1|3917122_3918451_-	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_015422912.1|3918514_3920677_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_107678959.1|3921056_3921164_-	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_004238325.1|3921969_3923487_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.4	2.3e-86
WP_096862115.1|3923496_3924595_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_004240900.1|3924699_3926433_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.6	1.8e-63
WP_004238330.1|3926455_3927148_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004240901.1|3927160_3928075_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.5	4.7e-31
WP_004238332.1|3928208_3928727_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_004240903.1|3928732_3929140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240904.1|3929291_3929579_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_004240906.1|3929855_3930839_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
