The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	568759	634449	7240677	lysis,capsid,tail,terminase,head,holin,integrase,plate,portal	Pseudomonas_virus(67.35%)	72	620348:620393	634545:634590
WP_003096184.1|568759_569305_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.0	2.5e-51
WP_003135922.1|569304_570186_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.6	2.7e-100
WP_003135921.1|570182_571091_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_003096179.1|571087_572146_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.9	1.0e-85
WP_022580400.1|572544_573687_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	40.4	6.3e-73
WP_022580401.1|573683_573899_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_034075681.1|573895_574084_-	hypothetical protein	NA	Q38017	Pseudomonas_virus	70.6	5.9e-05
WP_034075682.1|574094_575327_-	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	71.3	3.6e-175
WP_034075683.1|575323_577102_-	DNA methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	94.7	5.4e-289
WP_034075684.1|577094_577346_-	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	91.6	4.7e-34
WP_022580406.1|577405_577612_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	95.6	1.8e-31
WP_023127766.1|577623_577977_-	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	95.7	1.4e-60
WP_022580408.1|578036_578309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087847464.1|578353_581074_-	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	99.1	0.0e+00
WP_034075594.1|581070_581304_-	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	98.7	3.8e-38
WP_034075596.1|581375_581726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023127762.1|581722_582016_-	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	97.9	3.2e-50
WP_034075605.1|582012_582483_-	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	92.9	1.6e-75
WP_023876135.1|582512_582725_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	48.4	1.1e-07
WP_031633864.1|582810_583152_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	45.0	6.5e-18
WP_034075598.1|583470_583821_+	hypothetical protein	NA	Q9ZXJ5	Pseudomonas_virus	85.3	2.1e-51
WP_079387858.1|583877_584951_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	38.7	9.7e-52
WP_123809161.1|584950_585850_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	33.1	2.4e-27
WP_079391475.1|585846_586845_-	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	63.4	2.8e-117
WP_034075599.1|587008_588283_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.6	2.1e-234
WP_034075600.1|588279_588720_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	99.3	4.0e-76
WP_034075601.1|588725_591440_-|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	98.7	0.0e+00
WP_003098394.1|591429_591549_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_034070824.1|591557_591887_-|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	99.1	5.6e-51
WP_023093077.1|591941_592457_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	98.8	1.9e-93
WP_034075602.1|592513_593689_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	99.5	9.2e-221
WP_034075603.1|593789_594224_-|tail	phage tail protein	tail	A0A291LAV4	Bordetella_phage	49.6	1.7e-26
WP_033985172.1|596047_596665_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	75.8	1.6e-86
WP_087847463.1|596661_597579_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	87.5	1.9e-144
WP_033976915.1|597575_597920_-|plate	baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	95.6	2.3e-55
WP_087847462.1|597916_598489_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	90.5	7.9e-93
WP_087847461.1|598558_599017_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	89.5	4.1e-68
WP_033976909.1|599009_599546_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
WP_022580428.1|599623_600085_-|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	94.1	9.9e-70
WP_022580429.1|600081_600324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034075446.1|600320_601127_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	97.3	2.4e-143
WP_003098380.1|601123_601396_-|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_003098379.1|601397_601751_-	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_034075717.1|601775_601988_-|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	91.2	5.4e-31
WP_034075716.1|601987_602449_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	98.7	6.2e-80
WP_023096268.1|602552_603254_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.3	1.1e-123
WP_023091259.1|603259_604276_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.4	1.7e-191
WP_022580434.1|604311_605133_-|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	98.9	1.2e-129
WP_034075640.1|605288_607049_+|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	94.9	0.0e+00
WP_034075641.1|607048_608104_+|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	96.8	3.4e-198
WP_003096173.1|609092_610622_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_003135919.1|610632_611817_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003135917.1|611831_613310_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003110596.1|613313_613784_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021263146.1|614182_615403_-	methyltransferase	NA	NA	NA	NA	NA
WP_003096163.1|615471_616164_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003135913.1|616160_616856_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003096156.1|616917_617670_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003096153.1|617684_618458_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	9.3e-20
WP_003135910.1|618706_619396_-	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_003096148.1|619553_620291_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
620348:620393	attL	TGGTGCCCAGGGACGGAATCGAACCGCCGACACGGGGATTTTCAAT	NA	NA	NA	NA
WP_025986364.1|620595_621798_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	29.2	7.4e-32
WP_041108783.1|621794_622442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016852236.1|622585_623413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123809162.1|623990_624212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019416279.1|625413_627678_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_123809163.1|627678_628014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123809164.1|628283_629330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123809165.1|629512_630370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077688106.1|630369_632586_-	AAA family ATPase	NA	Q7Y4B3	Escherichia_virus	25.6	5.2e-15
WP_016852232.1|632786_633188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025986365.1|633333_634449_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	34.6	5.2e-48
634545:634590	attR	TGGTGCCCAGGGACGGAATCGAACCGCCGACACGGGGATTTTCAAT	NA	NA	NA	NA
>prophage 2
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	1196429	1231496	7240677	integrase,coat,tRNA	Pseudomonas_phage(66.67%)	38	1201132:1201152	1226187:1226207
WP_031757220.1|1196429_1196720_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	96.9	5.6e-55
WP_003133732.1|1196723_1197101_+	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	94.4	9.3e-58
WP_003133730.1|1197235_1197670_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	86.1	8.7e-60
WP_003115130.1|1197686_1197779_+	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003115979.1|1197791_1198043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003125072.1|1198055_1198304_+|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_031759488.1|1198455_1199763_+	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	55.5	5.9e-51
WP_003114150.1|1199767_1200124_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_023127811.1|1200127_1201411_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	99.3	2.7e-234
1201132:1201152	attL	TGACCCTGCCGGCCGGCACCT	NA	NA	NA	NA
WP_004352686.1|1201640_1202933_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_003135135.1|1202929_1203937_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	47.1	6.3e-77
WP_023094967.1|1203983_1204421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003099270.1|1204739_1205840_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003099278.1|1205880_1206465_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003095013.1|1206506_1207121_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099281.1|1207237_1208179_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003135132.1|1208345_1209194_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003095005.1|1209195_1209813_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_003135130.1|1209817_1211590_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095001.1|1211733_1213002_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003094997.1|1213019_1214102_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	4.3e-07
WP_003114694.1|1214103_1214934_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003135128.1|1214927_1215686_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003099300.1|1215675_1216473_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003099307.1|1216606_1217128_+	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_003135126.1|1217253_1218699_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	28.0	1.4e-45
WP_003135124.1|1218695_1219595_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_023094965.1|1219604_1220561_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003094987.1|1220713_1221697_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003135111.1|1222110_1223028_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003094982.1|1223024_1224047_+	ferrochelatase	NA	NA	NA	NA	NA
WP_003135108.1|1224326_1225700_+	MFS transporter	NA	NA	NA	NA	NA
WP_003135106.1|1225701_1226649_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
1226187:1226207	attR	AGGTGCCGGCCGGCAGGGTCA	NA	NA	NA	NA
WP_023124830.1|1226645_1229018_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003099335.1|1229034_1229823_-	molecular chaperone	NA	NA	NA	NA	NA
WP_003125348.1|1229841_1230384_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003135089.1|1230383_1230917_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003135087.1|1230947_1231496_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	1806973	1815528	7240677	coat	Pseudomonas_phage(81.82%)	14	NA	NA
WP_123809168.1|1806973_1807267_-	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	38.5	2.3e-11
WP_003125079.1|1807396_1807666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023086597.1|1807787_1808003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034047698.1|1808372_1808657_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	86.0	6.1e-46
WP_003133746.1|1808664_1809309_+	DNA cytosine methyltransferase	NA	E3SMD8	Cyanophage	64.4	4.3e-63
WP_049237859.1|1809312_1809690_+	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	94.4	1.1e-58
WP_003140508.1|1809824_1810259_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_003115130.1|1810275_1810368_+	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003115979.1|1810380_1810632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003125072.1|1810644_1810893_+|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_031757282.1|1811044_1812358_+	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	54.8	3.7e-45
WP_003114150.1|1812362_1812719_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_023127773.1|1812722_1814006_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	96.5	1.1e-227
WP_003134394.1|1814235_1815528_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.7	1.0e-244
>prophage 4
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	2297436	2324807	7240677	integrase,transposase	Salmonella_phage(42.86%)	27	2322231:2322290	2328412:2328834
WP_003133840.1|2297436_2297970_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003086547.1|2298329_2299577_-	ribonucleotide-diphosphate reductase subunit beta	NA	K4K678	Caulobacter_phage	29.0	7.6e-32
WP_015648365.1|2300037_2300736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019396235.1|2300817_2301990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161791575.1|2301999_2303658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737748.1|2303702_2304104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164705397.1|2304362_2304515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004423958.1|2304647_2305919_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075116581.1|2306626_2306890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075116585.1|2307010_2307307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138064.1|2307315_2310282_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|2310284_2310845_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|2310970_2311321_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845054.1|2311523_2312537_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000381803.1|2312682_2313216_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_013263788.1|2313274_2313733_+	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_001007673.1|2313876_2314704_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_001206317.1|2314740_2315532_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|2315695_2316043_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259032.1|2316036_2316876_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2317003_2317504_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000935451.1|2318009_2319725_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003155746.1|2319727_2320636_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_006122485.1|2320632_2321850_+	TniQ family protein	NA	NA	NA	NA	NA
WP_003155741.1|2321911_2322535_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	47.6	1.7e-35
2322231:2322290	attL	CCGGCAAGCTTGTGTTCGGTATTTTTGCCGCGCTGGCCGAGTTCGAGCGTGAGTTGATTT	NA	NA	NA	NA
WP_013250881.1|2322750_2323614_-	class A extended-spectrum beta-lactamase GES-1	NA	A0A1B0VBP7	Salmonella_phage	39.0	4.3e-42
WP_000845048.1|2323793_2324807_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
2328412:2328834	attR	CCGGCAAGCTTGTGTTCGGTATTTTTGCCGCGCTGGCCGAGTTCGAGCGTGAGTTGATTTCCGAGCGAACAGTCGCTGGACTTATCTCGGCGCGCGCTCGCGGCAGGAAAGGGGGGCGCCCCTTCAAGATGACCGCCGCCAAGCTACGCCTGGCGATGGCCAGCATGGGGCAACCGGAAACCAAGGTGGGCGATCTCTGCGAAGAACTCGGGATTACCCGGCAGACGCTCTACCGGCACGTGTCGCCCAAGGGCGAACTGCGGCCAGACGGCGTAAAGCTGCTCTCCCTCGGTTCAGCCGCATAAATGGAGGCGACCTGGAACGGGGCGCTGTTCAGTGCGGCAACGATCCGATTACCGGTGTCGACCCAGAGCAGCCGTAGAGCTTTTGGGAAAGCTGTCGTTCAACGCCTGAGTTAAGCCG	NA	NA	NA	NA
>prophage 5
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	4309657	4362578	7240677	integrase,terminase,head,holin	Pseudomonas_phage(76.67%)	66	4309338:4309397	4358661:4358752
4309338:4309397	attL	AAGAAAAAAGCCCCGTAACTCACTGAGCTACGGGGCTTTCCTGTTGGAGGCTGAGGTCGG	NA	NA	NA	NA
WP_023094700.1|4309657_4310170_+	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	89.9	1.2e-89
WP_023094699.1|4310207_4310894_+	hypothetical protein	NA	A0A2K8I970	Pseudomonas_phage	89.9	8.8e-123
WP_023094698.1|4310875_4311139_-	hypothetical protein	NA	J7I447	Pseudomonas_phage	94.3	2.9e-42
WP_023094697.1|4311174_4311438_-	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	91.9	5.3e-36
WP_003088479.1|4311434_4311803_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	82.0	2.3e-45
WP_031690640.1|4311799_4312429_-	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	94.7	9.3e-111
WP_023124725.1|4312495_4314553_-	hypothetical protein	NA	A0A127KNR5	Pseudomonas_phage	91.8	0.0e+00
WP_023094694.1|4314613_4317337_-	hypothetical protein	NA	A0A127KNI3	Pseudomonas_phage	83.8	0.0e+00
WP_003131216.1|4317308_4317716_-	hypothetical protein	NA	J7HX80	Pseudomonas_phage	95.6	7.1e-72
WP_023094693.1|4317720_4318212_-	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	96.3	1.1e-87
WP_023094692.1|4318195_4318663_-	hypothetical protein	NA	H2BD92	Pseudomonas_phage	98.1	9.3e-92
WP_023124724.1|4318659_4321158_-	tape measure protein	NA	J7HXG0	Pseudomonas_phage	98.1	0.0e+00
WP_023094690.1|4321157_4321775_-	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	98.5	1.3e-112
WP_023094689.1|4321771_4322767_-	hypothetical protein	NA	J7HX84	Pseudomonas_phage	93.1	1.8e-156
WP_003127992.1|4322781_4323156_-	hypothetical protein	NA	J7I407	Pseudomonas_phage	100.0	5.7e-68
WP_023124723.1|4323152_4323557_-	hypothetical protein	NA	J7I0Q5	Pseudomonas_phage	99.3	2.1e-68
WP_023094688.1|4323558_4323897_-	hypothetical protein	NA	A0A125RNM7	Pseudomonas_phage	99.1	8.0e-61
WP_003131204.1|4323893_4324295_-	hypothetical protein	NA	J7HX89	Pseudomonas_phage	97.0	2.3e-70
WP_003127995.1|4324368_4324833_-	hypothetical protein	NA	A0A125RNM4	Pseudomonas_phage	77.0	2.7e-51
WP_003127996.1|4324843_4325938_-	hypothetical protein	NA	A0A125RNM3	Pseudomonas_phage	98.9	7.0e-207
WP_023094687.1|4325953_4326403_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	99.3	1.6e-77
WP_023094686.1|4326406_4327684_-	hypothetical protein	NA	A0A125RNM1	Pseudomonas_phage	99.3	2.4e-214
WP_031632796.1|4327687_4328617_-|head	SPP1 gp7 family phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	99.0	3.4e-170
WP_003127999.1|4328573_4329944_-	DUF1073 domain-containing protein	NA	J7I414	Pseudomonas_phage	99.3	4.0e-268
WP_016852759.1|4329946_4330144_-	hypothetical protein	NA	H2BD77	Pseudomonas_phage	98.5	5.2e-28
WP_023094684.1|4330143_4331397_-|terminase	PBSX family phage terminase large subunit	terminase	J7I4J3	Pseudomonas_phage	99.8	2.9e-249
WP_003131202.1|4331380_4331923_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	98.3	5.0e-97
WP_016852757.1|4331931_4332216_-|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	97.9	5.9e-41
WP_023124722.1|4332208_4332598_-	hypothetical protein	NA	H2BD73	Pseudomonas_phage	97.7	2.4e-61
WP_023094683.1|4332712_4333582_-	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	99.0	4.8e-166
WP_023094682.1|4333610_4334054_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.0	1.4e-76
WP_016263334.1|4334046_4335462_-	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	99.4	2.6e-262
WP_023094681.1|4335454_4336303_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	97.8	1.1e-74
WP_031632346.1|4336302_4336824_-	HNH endonuclease	NA	Q7Y3U9	Yersinia_phage	39.7	3.9e-06
WP_016263332.1|4336816_4336999_-	hypothetical protein	NA	A0A127KNC5	Pseudomonas_phage	100.0	4.5e-26
WP_023094680.1|4337036_4337288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003136886.1|4337278_4337851_-	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	98.9	4.6e-101
WP_023103954.1|4337933_4338446_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	97.1	9.0e-88
WP_023094678.1|4338991_4339657_+	helix-turn-helix transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	41.5	3.5e-44
WP_071536250.1|4339703_4340192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105447006.1|4340795_4342118_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	94.4	8.3e-61
WP_003126916.1|4342346_4342559_+	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	95.7	2.0e-33
WP_003131166.1|4342594_4342966_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	80.5	8.3e-51
WP_023094675.1|4343483_4343636_+	hypothetical protein	NA	J7HXJ0	Pseudomonas_phage	96.8	9.9e-11
WP_003099037.1|4343619_4343841_+	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_010793152.1|4343837_4344047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023094674.1|4344057_4344966_+	hypothetical protein	NA	Q858E0	Salmonella_phage	71.6	2.1e-124
WP_003126907.1|4344978_4345869_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.2	9.1e-104
WP_003116739.1|4345875_4346076_+	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_003126905.1|4346088_4346853_+	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	67.8	6.0e-104
WP_023103950.1|4346856_4347444_+	hypothetical protein	NA	A0A2I7RT07	Vibrio_phage	39.9	6.8e-23
WP_003131149.1|4347443_4349186_+	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	92.7	2.3e-284
WP_003126892.1|4349235_4349949_+	DNA exonuclease	NA	A0A059VJT9	Pseudomonas_phage	47.3	7.2e-51
WP_153549535.1|4350119_4350446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003126891.1|4350561_4352247_+	DNA methyltransferase	NA	L7TH64	Pseudomonas_virus	98.2	4.0e-310
WP_003126889.1|4352243_4352738_+	hypothetical protein	NA	A0A2K8HVL6	Pseudomonas_phage	95.1	5.4e-74
WP_108116075.1|4352828_4352930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003126888.1|4353124_4353751_+	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	58.8	8.7e-61
WP_003126887.1|4353747_4354308_+	hypothetical protein	NA	H2BD41	Pseudomonas_phage	93.7	3.8e-100
WP_003126885.1|4354304_4354670_+	hypothetical protein	NA	H2BD40	Pseudomonas_phage	97.3	3.0e-61
WP_003131143.1|4354666_4355173_+	hypothetical protein	NA	L7TI83	Pseudomonas_virus	95.8	1.2e-87
WP_003130970.1|4356550_4357030_+	hypothetical protein	NA	I6NVL3	Burkholderia_virus	55.3	3.6e-22
WP_003158549.1|4357306_4357540_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	50.7	5.6e-13
WP_031631149.1|4357541_4358606_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.4	1.4e-114
WP_003090076.1|4359068_4359602_-	hypothetical protein	NA	NA	NA	NA	NA
4358661:4358752	attR	AAGAAAAAAGCCCCGTAACTCACTGAGCTACGGGGCTTTCCTGTTGGAGGCTGAGGTCGGAATCGAACCGGCGTTCACGGATTTGCAATCCG	NA	NA	NA	NA
WP_023094666.1|4359692_4362578_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.4	1.9e-33
>prophage 6
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	4478985	4485879	7240677	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003090386.1|4478985_4479654_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_003090387.1|4479764_4480160_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090389.1|4480156_4480516_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090391.1|4480515_4480821_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090393.1|4480817_4481153_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003108776.1|4481149_4482133_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003108775.1|4482220_4483195_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003131135.1|4483199_4484597_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097631.1|4484598_4485879_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
>prophage 7
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	4662733	4696337	7240677	integrase,protease,transposase	Salmonella_phage(20.0%)	31	4671687:4671703	4699085:4699101
WP_000935451.1|4662733_4664449_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|4664451_4665444_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000376623.1|4665412_4665913_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|4666040_4666880_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4666873_4667221_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_108092422.1|4667337_4667616_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_022675713.1|4667657_4668503_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA6	NA	NA	NA	NA	NA
WP_000845048.1|4668648_4669662_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003090771.1|4670036_4670597_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	96.8	1.8e-57
WP_003090772.1|4670600_4673567_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	96.8	0.0e+00
4671687:4671703	attL	AGCGTCAGCGAGGCCGA	NA	NA	NA	NA
WP_077565896.1|4673563_4674583_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.1e-36
WP_023104035.1|4674808_4676002_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_087920913.1|4676112_4677444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920912.1|4677820_4678399_-	TerD family protein	NA	NA	NA	NA	NA
WP_087920911.1|4678434_4679013_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	8.7e-31
WP_003090778.1|4679041_4680076_-	TerC/Alx family metal homeostasis membrane protein	NA	A0A291LBC5	Escherichia_phage	45.9	6.5e-69
WP_003090780.1|4680088_4680538_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_087920910.1|4680585_4681776_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_087920909.1|4681772_4682366_-	TerD family protein	NA	A0A2I7QY07	Vibrio_phage	37.4	2.4e-23
WP_023098554.1|4682368_4683097_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_003090783.1|4683096_4684044_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_003090784.1|4684043_4685138_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	8.2e-38
WP_003090785.1|4685130_4685889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154854.1|4685878_4687006_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.3	6.7e-27
WP_003154856.1|4687074_4688214_-	peptidase S1	NA	W5SAB9	Pithovirus	32.4	1.1e-05
WP_031629774.1|4688289_4689288_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_023098552.1|4689765_4690872_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_034082648.1|4691259_4691667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090790.1|4691659_4693534_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071534604.1|4693533_4695195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920908.1|4695197_4696337_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4699085:4699101	attR	TCGGCCTCGCTGACGCT	NA	NA	NA	NA
>prophage 8
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	5621838	5667662	7240677	capsid,tail,terminase,head,holin,protease,integrase,portal	Pseudomonas_phage(81.03%)	68	5617280:5617298	5676356:5676374
5617280:5617298	attL	GCCGCCGGTATCGACGGCC	NA	NA	NA	NA
WP_087920896.1|5621838_5622096_-	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	97.3	1.8e-33
WP_023124666.1|5622092_5622395_-	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	88.0	2.2e-41
WP_003159085.1|5622394_5622958_-	hypothetical protein	NA	A0A0A0YRS1	Pseudomonas_phage	98.4	3.3e-99
WP_003159084.1|5622950_5623232_-	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	97.8	3.0e-45
WP_087920895.1|5623231_5623792_-	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	97.3	1.0e-97
WP_023110598.1|5623794_5623986_-	hypothetical protein	NA	A0A1W6JT89	Pseudomonas_phage	98.4	3.5e-29
WP_023103658.1|5623978_5624566_-	hypothetical protein	NA	A0A1B0Z051	Pseudomonas_phage	91.8	5.3e-100
WP_087920894.1|5624587_5626081_-	hypothetical protein	NA	A0A1B0YZU9	Pseudomonas_phage	99.0	1.8e-285
WP_087920893.1|5626067_5626490_-	hypothetical protein	NA	A0A1B0YZV1	Pseudomonas_phage	97.1	1.0e-68
WP_046094892.1|5626502_5627045_-	hypothetical protein	NA	A0A0A0YWE1	Pseudomonas_phage	95.6	1.3e-92
WP_023103823.1|5627044_5627455_-	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	94.1	4.7e-55
WP_087920892.1|5627457_5629161_-	hypothetical protein	NA	A0A0U4JP39	Pseudomonas_phage	96.3	0.0e+00
WP_023118122.1|5629162_5629666_-	hypothetical protein	NA	A0A0U4IIK1	Pseudomonas_phage	99.4	9.1e-93
WP_034083369.1|5629675_5631817_-	tape measure protein	NA	A0A0U3TH20	Pseudomonas_phage	99.4	0.0e+00
WP_003098505.1|5631806_5631956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920891.1|5632000_5632366_-	hypothetical protein	NA	A0A0U4KLC4	Pseudomonas_phage	97.5	1.2e-57
WP_087920890.1|5632421_5633207_-	hypothetical protein	NA	A0A0U4ISK2	Pseudomonas_phage	96.2	7.4e-142
WP_023092524.1|5633230_5633668_-	hypothetical protein	NA	A0A0U4IBQ1	Pseudomonas_phage	95.9	2.0e-72
WP_087920889.1|5633680_5634274_-	hypothetical protein	NA	A0A0U4J906	Pseudomonas_phage	97.5	3.7e-101
WP_031801609.1|5634270_5634822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031801610.1|5634822_5635155_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0U4JEH2	Pseudomonas_phage	83.6	3.9e-44
WP_031801611.1|5635165_5635345_-	hypothetical protein	NA	A0A0U4K5G7	Pseudomonas_phage	71.2	1.2e-15
WP_058168663.1|5635348_5635567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031801613.1|5635613_5636870_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	49.5	8.3e-95
WP_031801614.1|5636881_5637580_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.8	7.4e-69
WP_079993109.1|5637579_5638914_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	54.9	6.9e-132
WP_087920888.1|5638906_5639071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087921018.1|5639073_5640834_-|terminase	terminase large subunit	terminase	A0A0U4B0M7	Pseudomonas_phage	95.2	0.0e+00
WP_087920887.1|5640826_5641237_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_020989244.1|5641366_5641708_-	HNH endonuclease	NA	A0A0U4B0J6	Pseudomonas_phage	97.3	2.6e-59
WP_042854199.1|5641877_5642357_-	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	88.5	1.3e-51
WP_087920886.1|5642326_5642944_-	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	91.2	5.7e-105
WP_087920885.1|5642940_5643276_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	99.1	8.2e-58
WP_087920884.1|5643455_5643995_-	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	83.8	3.7e-76
WP_087920883.1|5644189_5644864_-	hypothetical protein	NA	A0A1B0YZZ3	Pseudomonas_phage	98.7	1.3e-118
WP_087920882.1|5644901_5645198_-	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	85.7	3.3e-42
WP_042854197.1|5645194_5645776_-	recombination protein NinG	NA	A0A0U4KL68	Pseudomonas_phage	99.5	2.2e-106
WP_042854195.1|5645772_5645979_-	hypothetical protein	NA	A0A1B0YZY8	Pseudomonas_phage	92.6	4.5e-30
WP_087920881.1|5645975_5646659_-	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	89.9	9.7e-114
WP_087920880.1|5646655_5647417_-	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	98.4	3.0e-95
WP_087920879.1|5648013_5648769_+	helix-turn-helix transcriptional regulator	NA	L7TH81	Pseudomonas_virus	73.6	6.4e-74
WP_031642139.1|5648881_5649175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023101754.1|5649192_5649531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012613693.1|5649583_5649838_-	DUF1654 domain-containing protein	NA	A0A127KNY9	Pseudomonas_phage	69.5	4.8e-26
WP_164705406.1|5650361_5650520_+	hypothetical protein	NA	B5M9Y8	Pseudomonas_phage	96.0	6.4e-21
WP_123809179.1|5650610_5650793_+	hypothetical protein	NA	W6MYA9	Pseudomonas_phage	100.0	7.2e-32
WP_087920878.1|5651066_5651777_+	transcription elongation protein SprT	NA	A0A088FRV0	Escherichia_phage	47.8	1.5e-53
WP_087920877.1|5651766_5652636_+	ParB N-terminal domain-containing protein	NA	A0A1B0YZX8	Pseudomonas_phage	89.9	6.3e-142
WP_034005692.1|5652840_5653227_+	LuxR family transcriptional regulator	NA	A0A1B0YZX7	Pseudomonas_phage	98.4	4.0e-64
WP_047689520.1|5653237_5653486_+	hypothetical protein	NA	A0A0U3TGX2	Pseudomonas_phage	90.2	5.5e-35
WP_087920876.1|5653699_5654374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003105586.1|5654373_5654676_+	hypothetical protein	NA	A0A0U4ISH7	Pseudomonas_phage	96.0	1.1e-40
WP_087920875.1|5654742_5655120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087920874.1|5655116_5656541_+	DNA cytosine methyltransferase	NA	A0A2I7QRH3	Vibrio_phage	48.9	3.0e-109
WP_087920873.1|5656537_5657074_+	DUF4406 domain-containing protein	NA	A0A0U4IBL4	Pseudomonas_phage	96.0	2.6e-98
WP_087920872.1|5657131_5657482_+	hypothetical protein	NA	H2BD40	Pseudomonas_phage	89.7	1.3e-58
WP_087920871.1|5657564_5657813_+	hypothetical protein	NA	H2BD39	Pseudomonas_phage	95.1	2.8e-39
WP_003124822.1|5657776_5657983_+	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	87.0	4.2e-28
WP_087920870.1|5657979_5659548_+	hypothetical protein	NA	H2BDF1	Pseudomonas_virus	73.9	8.0e-71
WP_023109419.1|5659540_5659924_+	hypothetical protein	NA	A0A2H5BQE7	Pseudomonas_phage	96.8	9.6e-10
WP_034069863.1|5659916_5660255_+	hypothetical protein	NA	A0A0U3TGW4	Pseudomonas_phage	65.0	2.5e-38
WP_023118159.1|5660251_5660455_+	hypothetical protein	NA	A0A125RNQ4	Pseudomonas_phage	86.6	3.1e-28
WP_034069866.1|5660499_5660817_+	hypothetical protein	NA	A0A0U4JNZ9	Pseudomonas_phage	90.5	6.6e-49
WP_034069868.1|5661210_5662377_+|integrase	site-specific integrase	integrase	A0A1B0Z061	Pseudomonas_phage	97.9	2.0e-220
WP_003092090.1|5662558_5663476_+	ornithine carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	27.6	2.0e-21
WP_003092092.1|5663480_5664563_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	1.3e-22
WP_003092094.1|5664669_5665449_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003110461.1|5666351_5667662_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	O41091	Paramecium_bursaria_Chlorella_virus	29.6	1.1e-36
5676356:5676374	attR	GGCCGTCGATACCGGCGGC	NA	NA	NA	NA
>prophage 9
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	5756595	5765623	7240677		Bacillus_phage(33.33%)	8	NA	NA
WP_003092260.1|5756595_5757636_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
WP_003129950.1|5757769_5758276_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	1.8e-56
WP_003098486.1|5758423_5759431_+	TolB family protein	NA	NA	NA	NA	NA
WP_003113873.1|5759556_5762124_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003092272.1|5762190_5762514_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113871.1|5762939_5763944_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003129949.1|5764048_5764942_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003098558.1|5764987_5765623_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
>prophage 10
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	6517075	6563761	7240677	tRNA,plate,holin,tail	Pseudomonas_phage(41.18%)	53	NA	NA
WP_003129242.1|6517075_6518275_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003129241.1|6518559_6519903_+	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_003129240.1|6519905_6520997_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003085254.1|6521050_6521401_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_003120826.1|6521478_6521901_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_087920864.1|6521901_6522621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003101649.1|6522620_6523655_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003085245.1|6523945_6524368_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003085244.1|6524384_6525353_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_023094502.1|6525474_6526557_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003129228.1|6526617_6527418_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003129227.1|6527457_6528939_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	5.1e-67
WP_003129226.1|6529017_6529356_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003085224.1|6529455_6530103_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003085223.1|6530157_6530952_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003085219.1|6531271_6531694_-	OsmC family protein	NA	NA	NA	NA	NA
WP_003085214.1|6531965_6532610_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003129225.1|6532671_6533508_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	3.6e-70
WP_003085203.1|6533504_6534554_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003129224.1|6534555_6535161_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003129222.1|6535566_6535794_-	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	89.0	5.4e-29
WP_023094501.1|6535790_6536102_-	hypothetical protein	NA	A0A1W6JTB1	Pseudomonas_phage	84.5	4.8e-44
WP_003129221.1|6536101_6537202_-	hypothetical protein	NA	A0A1W6JTA8	Pseudomonas_phage	77.6	2.6e-116
WP_003129220.1|6538187_6541841_-|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	57.3	0.0e+00
WP_003118924.1|6541899_6542502_-|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
WP_003129219.1|6542556_6543327_-	peptidase P60	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
WP_003118922.1|6543329_6544025_-|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003113186.1|6544032_6544374_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003129218.1|6544366_6546205_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113188.1|6546251_6546506_-	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003113189.1|6546535_6546883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003113190.1|6546894_6547389_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003118919.1|6547704_6547962_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003129216.1|6547958_6548321_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.1	5.5e-15
WP_003129215.1|6548317_6548947_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003129214.1|6548979_6549969_-	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.5	6.3e-106
WP_003101635.1|6550026_6550233_-	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003085182.1|6550207_6551080_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003129213.1|6551089_6553327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085178.1|6553496_6553841_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003129212.1|6553855_6554359_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	6.1e-65
WP_003109051.1|6554371_6555532_-|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003085172.1|6555574_6556015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003129211.1|6556023_6558132_-	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_003129210.1|6558133_6558667_-|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.0	6.7e-62
WP_003085151.1|6558659_6559547_-	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003085143.1|6559543_6559870_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003129209.1|6560022_6560580_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.9	1.7e-44
WP_003101620.1|6560576_6561092_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003129208.1|6561113_6561563_-|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003085135.1|6561925_6562285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085132.1|6562332_6562533_-	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003113202.1|6562990_6563761_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
>prophage 11
NZ_CP027172	Pseudomonas aeruginosa strain AR_0353 chromosome, complete genome	7240677	7008133	7053585	7240677	integrase,transposase	Staphylococcus_phage(33.33%)	30	7004572:7004587	7036042:7036057
7004572:7004587	attL	CTGCAGCGCGTCGAAG	NA	NA	NA	NA
WP_033982774.1|7008133_7009294_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	30.7	1.4e-35
WP_003292744.1|7009286_7009520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003292745.1|7009667_7009880_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033982772.1|7009898_7013012_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071534483.1|7013008_7013968_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033982769.1|7018737_7020180_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_033982767.1|7020185_7020953_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033982765.1|7021137_7022247_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033982764.1|7022322_7024308_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033982762.1|7024304_7025090_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.9	2.4e-15
WP_033982761.1|7025086_7025830_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	6.8e-12
WP_049878502.1|7025826_7026957_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_087920861.1|7026959_7027955_+	hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	33.0	4.8e-21
WP_023083523.1|7027947_7029534_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_023083524.1|7029593_7030631_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_023083525.1|7031004_7031610_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_023083526.1|7031612_7031876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023083527.1|7031994_7032177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023083528.1|7033572_7034730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023083529.1|7034713_7038019_-	AAA family ATPase	NA	NA	NA	NA	NA
7036042:7036057	attR	CTTCGACGCGCTGCAG	NA	NA	NA	NA
WP_031668292.1|7038015_7038678_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_071534481.1|7038767_7040267_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_031668293.1|7040918_7041410_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_003294185.1|7041406_7041883_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_079868537.1|7043033_7044410_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	7.6e-41
WP_003294186.1|7044920_7045166_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003083317.1|7046867_7047386_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_003133034.1|7047565_7050064_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	43.5	1.0e-43
WP_003126179.1|7050077_7051874_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004423958.1|7052313_7053585_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
