The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	0	60090	5274107	terminase,integrase,holin,tail,transposase	Klebsiella_phage(20.75%)	74	45259:45274	68098:68113
WP_001067855.1|986_1691_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|1867_2632_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|3138_3639_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3766_4606_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4599_4947_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|5110_5902_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_015057121.1|6047_7007_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|6897_7602_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|7850_9794_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|10035_10635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|10859_11591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|11594_14549_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|14625_17694_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|17690_18071_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|18080_18563_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_105329745.1|18743_19208_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.1	2.5e-57
WP_004152648.1|19522_19858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|20048_21029_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004217331.1|21141_24039_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|24300_24492_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|24716_25073_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|25149_25356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|25493_25976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|26029_27202_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|27225_27618_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|27614_28166_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|28167_28551_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|28537_28771_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|28780_29035_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|29036_29432_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_142689607.1|29472_29745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190653.1|29753_30707_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|30717_31503_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004227000.1|31616_31793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019405022.1|32033_33146_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|33129_34530_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|34529_35837_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|35814_36819_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|37681_37927_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|38885_39161_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|39157_39502_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|39498_40038_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|40034_40334_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|40812_41859_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|42084_42774_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|42773_42914_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|42910_43549_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|43541_44210_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|44206_44374_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|44354_44822_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243011.1|44954_45233_-	hypothetical protein	NA	NA	NA	NA	NA
45259:45274	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
WP_004218530.1|45342_46371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|46578_46824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|46879_47182_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|47178_48027_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|48023_48884_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|48969_49191_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|49231_49459_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|49570_50269_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201109.1|50556_51633_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|51714_51918_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004219883.1|52228_52354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|52346_52541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|52629_52914_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|52929_53775_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|53771_54059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|54060_54741_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|54737_55166_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|55162_55825_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004190725.1|55821_56136_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004151900.1|56032_57250_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151901.1|57396_58287_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|58286_59279_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|59280_60090_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
68098:68113	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
>prophage 2
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	64720	66655	5274107		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002901787.1|64720_66655_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
>prophage 3
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	72245	72848	5274107		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002901778.1|72245_72848_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 4
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	77688	83054	5274107	protease	Tupanvirus(50.0%)	5	NA	NA
WP_105329747.1|77688_80286_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|80692_80944_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|80991_82038_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_004225168.1|82082_82283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901754.1|82292_83054_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.6e-08
>prophage 5
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	90173	93131	5274107		Acinetobacter_phage(100.0%)	2	NA	NA
WP_004148109.1|90173_91769_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
WP_002901733.1|91772_93131_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
>prophage 6
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	105375	106053	5274107		Cyanophage(100.0%)	1	NA	NA
WP_004151914.1|105375_106053_+	PKHD-type hydroxylase YbiX	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 7
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	116822	119081	5274107		Tupanvirus(100.0%)	1	NA	NA
WP_002901554.1|116822_119081_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
>prophage 8
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	125345	126173	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_004151921.1|125345_126173_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 9
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	132856	134077	5274107		Klosneuvirus(100.0%)	1	NA	NA
WP_002901489.1|132856_134077_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 10
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	140134	140767	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_004151926.1|140134_140767_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.3	1.3e-08
>prophage 11
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	146069	146978	5274107		Streptococcus_phage(100.0%)	1	NA	NA
WP_160463747.1|146069_146978_-	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	30.6	1.8e-30
>prophage 12
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	150719	152083	5274107	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955203.1|150719_152083_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 13
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	155957	160016	5274107		Tupanvirus(50.0%)	4	NA	NA
WP_002901282.1|155957_156599_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	3.2e-18
WP_039111380.1|156636_157995_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901274.1|158136_158895_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901272.1|159032_160016_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.1	1.5e-06
>prophage 14
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	165708	166962	5274107		Artogeia_rapae_granulovirus(100.0%)	1	NA	NA
WP_002901255.1|165708_166962_+	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 15
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	170646	171462	5274107		Indivirus(100.0%)	1	NA	NA
WP_004162686.1|170646_171462_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.5	2.9e-16
>prophage 16
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	174775	186209	5274107		Bacillus_phage(14.29%)	13	NA	NA
WP_004152363.1|174775_176059_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
WP_002901231.1|176104_176668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901230.1|176826_177309_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_002901229.1|177430_177742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004220356.1|177809_177929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152362.1|177999_178881_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152361.1|179056_180274_+	MFS transporter	NA	NA	NA	NA	NA
WP_002901225.1|180270_181020_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_004140447.1|181186_182092_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152360.1|182098_183364_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
WP_002901192.1|183366_183786_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004178082.1|183864_185352_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901096.1|185966_186209_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
>prophage 17
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	193138	196724	5274107		Bacillus_phage(50.0%)	7	NA	NA
WP_004150781.1|193138_194152_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|194209_194311_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|194310_194385_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|194502_194628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|194687_194951_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|195081_195720_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|195809_196724_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 18
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	200013	201798	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_004150787.1|200013_201798_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
>prophage 19
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	216413	217664	5274107		Phage_21(100.0%)	1	NA	NA
WP_004150800.1|216413_217664_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 20
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	220892	222263	5274107		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004150804.1|220892_222263_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.6e-107
>prophage 21
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	228828	229965	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_004150811.1|228828_229965_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 22
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	234397	240463	5274107		Staphylococcus_phage(33.33%)	6	NA	NA
WP_004150815.1|234397_236026_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.5e-27
WP_002900906.1|236277_236622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004176563.1|236712_237543_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
WP_004150816.1|237557_238469_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_002900801.1|238517_239762_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002900798.1|239761_240463_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
>prophage 23
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	260187	260829	5274107		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002900674.1|260187_260829_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 24
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	264108	265290	5274107		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|264108_264345_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_002899294.1|264555_265290_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
>prophage 25
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	284445	284697	5274107		Salmonella_phage(100.0%)	1	NA	NA
WP_002898994.1|284445_284697_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 26
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	287938	288859	5274107		Morganella_phage(100.0%)	1	NA	NA
WP_004150825.1|287938_288859_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	5.6e-56
>prophage 27
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	297210	297738	5274107		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_002898953.1|297210_297738_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 28
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	305476	306535	5274107		Cronobacter_phage(100.0%)	1	NA	NA
WP_004147894.1|305476_306535_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 29
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	323099	326618	5274107		Enterobacteria_phage(100.0%)	4	NA	NA
WP_002898812.1|323099_323594_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
WP_002898810.1|323615_324938_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.8e-201
WP_002898712.1|325344_326235_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002898708.1|326444_326618_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 30
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	350756	351416	5274107	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002898458.1|350756_351416_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 31
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	356358	358413	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_002898429.1|356358_358413_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 32
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	371105	373013	5274107		Tupanvirus(100.0%)	1	NA	NA
WP_004150837.1|371105_373013_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	2.1e-49
>prophage 33
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	381779	386902	5274107		Bacillus_virus(33.33%)	3	NA	NA
WP_004150838.1|381779_382553_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
WP_002898220.1|382757_385373_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_002898217.1|385699_386902_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
>prophage 34
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	392985	396058	5274107	tRNA	Bandra_megavirus(50.0%)	2	NA	NA
WP_002898206.1|392985_394386_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
WP_002898204.1|395083_396058_+	porin	NA	Q1MVN1	Enterobacteria_phage	52.2	1.4e-89
>prophage 35
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	413421	417964	5274107		Bacillus_phage(100.0%)	3	NA	NA
WP_002898170.1|413421_415170_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
WP_002898168.1|415206_417471_-	ComEC family protein	NA	NA	NA	NA	NA
WP_002898165.1|417676_417964_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
>prophage 36
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	422137	423226	5274107		Streptococcus_phage(100.0%)	1	NA	NA
WP_002898155.1|422137_423226_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 37
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	427276	457407	5274107	tRNA,protease	Tetraselmis_virus(13.33%)	23	NA	NA
WP_002898148.1|427276_429559_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
WP_002898145.1|429750_430491_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
WP_004150843.1|430653_431802_-	MFS transporter	NA	NA	NA	NA	NA
WP_004147798.1|431918_432065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150844.1|432076_432940_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_004150845.1|432941_433559_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_002898141.1|433569_436008_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
WP_105329756.1|436208_437501_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	4.7e-93
WP_002898137.1|437591_438935_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|438943_439555_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|439677_443931_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|444066_444561_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|444844_444976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|445093_446062_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|446176_447943_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|447943_449665_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|449691_450411_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|450764_450983_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|451103_453383_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|453413_453731_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|454056_454278_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|454354_456295_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_105329757.1|456291_457407_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 38
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	470223	474573	5274107		Roseobacter_phage(50.0%)	4	NA	NA
WP_002896397.1|470223_471054_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|471085_472225_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|473102_473618_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|473844_474573_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
>prophage 39
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	477673	489262	5274107		Bacillus_phage(33.33%)	12	NA	NA
WP_002896382.1|477673_479146_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|479142_479859_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|479937_481065_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|481106_481595_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|481652_482498_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|482494_483448_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|483458_484592_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|484755_485868_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|486216_486696_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|486784_487687_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|488508_488796_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|488998_489262_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
>prophage 40
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	496734	498734	5274107		Escherichia_phage(50.0%)	2	NA	NA
WP_004151717.1|496734_497493_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
WP_004151716.1|497531_498734_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	5.0e-97
>prophage 41
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	510439	512299	5274107		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151710.1|510439_512299_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 42
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	516542	518975	5274107		Bacteriophage(100.0%)	1	NA	NA
WP_002895891.1|516542_518975_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 43
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	526954	528547	5274107		Tupanvirus(100.0%)	1	NA	NA
WP_002895876.1|526954_528547_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 44
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	531556	532933	5274107		Pandoravirus(100.0%)	1	NA	NA
WP_002895865.1|531556_532933_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	4.2e-23
>prophage 45
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	536934	542086	5274107		Escherichia_phage(33.33%)	7	NA	NA
WP_002895845.1|536934_537447_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
WP_004147700.1|537654_537780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002895842.1|537798_538686_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_002895841.1|538923_539427_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
WP_002895839.1|539835_540582_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_002895837.1|540707_541367_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004142040.1|541363_542086_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
>prophage 46
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	546160	554125	5274107		Erwinia_phage(20.0%)	8	NA	NA
WP_004176771.1|546160_546421_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	9.7e-06
WP_002895824.1|546441_546708_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
WP_002895822.1|546993_547254_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002895821.1|547363_548332_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_002895819.1|548361_550530_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.4	4.4e-43
WP_004151702.1|550717_552073_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
WP_002895757.1|552287_553280_-	transketolase family protein	NA	NA	NA	NA	NA
WP_002895753.1|553279_554125_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
>prophage 47
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	559330	561070	5274107		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002895741.1|559330_561070_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 48
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	571237	572143	5274107		Streptococcus_phage(100.0%)	1	NA	NA
WP_002895662.1|571237_572143_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.2	5.7e-29
>prophage 49
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	578640	579363	5274107		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_004152853.1|578640_579363_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 50
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	583166	588788	5274107		Klosneuvirus(50.0%)	4	NA	NA
WP_002895578.1|583166_584456_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
WP_002895575.1|584526_585003_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_004147672.1|585780_587163_-	amino acid permease	NA	NA	NA	NA	NA
WP_002895420.1|587261_588788_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	2.9e-81
>prophage 51
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	598880	599615	5274107		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151694.1|598880_599615_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.8e-49
>prophage 52
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	604461	605520	5274107		Planktothrix_phage(100.0%)	1	NA	NA
WP_002895161.1|604461_605520_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.2	1.5e-17
>prophage 53
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	609068	610984	5274107		Brazilian_cedratvirus(50.0%)	3	NA	NA
WP_072093152.1|609068_609758_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	9.1e-11
WP_004232527.1|609736_609862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002895150.1|609967_610984_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
>prophage 54
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	615345	618856	5274107		Edwardsiella_phage(33.33%)	4	NA	NA
WP_002895086.1|615345_616398_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
WP_002895084.1|616712_617078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147641.1|617195_618140_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_004151689.1|618136_618856_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
>prophage 55
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	643179	643971	5274107		Kaumoebavirus(100.0%)	1	NA	NA
WP_002894935.1|643179_643971_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 56
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	649780	657210	5274107		Acinetobacter_phage(33.33%)	6	NA	NA
WP_002894917.1|649780_651259_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	8.4e-46
WP_004152225.1|651230_652673_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	1.1e-55
WP_004142243.1|652856_653066_-	DUF2517 family protein	NA	NA	NA	NA	NA
WP_020323459.1|653372_653462_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_004152226.1|653461_655141_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004152227.1|655161_657210_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	6.0e-26
>prophage 57
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	664036	664810	5274107		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004152229.1|664036_664810_+	esterase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.9e-05
>prophage 58
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	669498	673300	5274107	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_002894753.1|669498_671166_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
WP_004147599.1|671344_673300_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
>prophage 59
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	678053	679718	5274107		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002894734.1|678053_679718_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 60
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	683758	684805	5274107		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002894727.1|683758_684805_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	5.4e-47
>prophage 61
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	690809	698775	5274107	tRNA	Planktothrix_phage(33.33%)	5	NA	NA
WP_002894706.1|690809_691535_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
WP_002894704.1|691908_693579_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002894701.1|693644_695438_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.9	9.6e-28
WP_002894699.1|695483_695966_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_039100143.1|696192_698775_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	5.2e-184
>prophage 62
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	705819	708306	5274107		Synechococcus_phage(50.0%)	2	NA	NA
WP_004147579.1|705819_706968_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
WP_002894539.1|707106_708306_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
>prophage 63
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	713184	713845	5274107		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_002894459.1|713184_713568_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
WP_002439184.1|713635_713845_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
>prophage 64
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	717935	720006	5274107		Morganella_phage(50.0%)	2	NA	NA
WP_002894401.1|717935_718364_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
WP_002894398.1|718440_720006_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
>prophage 65
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	723141	736856	5274107		Streptococcus_phage(20.0%)	12	NA	NA
WP_002894369.1|723141_724365_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
WP_004151651.1|724349_724976_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
WP_004220148.1|724976_726122_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002894359.1|726263_726953_+	acireductone synthase	NA	NA	NA	NA	NA
WP_002894357.1|726949_727492_+	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
WP_004151652.1|727599_729909_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.6	1.0e-82
WP_002894353.1|730317_731298_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152854.1|731342_732845_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	9.2e-16
WP_004147555.1|732841_733831_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002894258.1|733827_734832_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002894256.1|734843_735785_+	sugar kinase	NA	NA	NA	NA	NA
WP_002894255.1|735827_736856_-	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
>prophage 66
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	753967	758388	5274107		Staphylococcus_phage(50.0%)	5	NA	NA
WP_004151659.1|753967_755470_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.9e-17
WP_004151660.1|755633_756722_+	oxidoreductase	NA	NA	NA	NA	NA
WP_002893908.1|756779_757523_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_002893907.1|757706_758009_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002893905.1|757983_758388_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	4.7e-07
>prophage 67
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	770730	775471	5274107		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_002893737.1|770730_771525_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
WP_004151663.1|771589_775471_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	3.1e-55
>prophage 68
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	786863	788408	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_002893593.1|786863_788408_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.6e-15
>prophage 69
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	795111	801025	5274107	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_004142478.1|795111_797145_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
WP_004151671.1|797273_797861_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002893471.1|797874_799347_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004142489.1|799360_801025_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
>prophage 70
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	805582	807110	5274107		Planktothrix_phage(100.0%)	2	NA	NA
WP_004151673.1|805582_806419_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.5e-12
WP_004151674.1|806405_807110_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	3.9e-25
>prophage 71
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	810180	814860	5274107		Bacillus_virus(50.0%)	5	NA	NA
WP_004151676.1|810180_810942_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
WP_002893189.1|810934_811600_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002893187.1|811614_812256_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002893184.1|812303_813155_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002893182.1|813396_814860_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.1e-16
>prophage 72
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	819366	820730	5274107	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|819366_820730_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 73
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	825263	827987	5274107		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_004152949.1|825263_827987_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	2.1e-66
>prophage 74
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	870880	871996	5274107		Tupanvirus(100.0%)	1	NA	NA
WP_004151809.1|870880_871996_-	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 75
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	886778	887576	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_002892698.1|886778_887576_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 76
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	894198	899999	5274107		Bacillus_phage(50.0%)	6	NA	NA
WP_004199626.1|894198_895599_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.5	3.3e-15
WP_004153625.1|895622_896633_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151798.1|896680_897289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217899.1|897329_897467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892599.1|897472_898504_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004142660.1|898514_899999_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
>prophage 77
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	908240	911565	5274107	tRNA	Catovirus(50.0%)	2	NA	NA
WP_002892491.1|908240_909758_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|910089_911565_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
>prophage 78
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	917788	918709	5274107		Morganella_phage(100.0%)	1	NA	NA
WP_002892400.1|917788_918709_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 79
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	930397	932909	5274107	tRNA	Enterococcus_phage(50.0%)	3	NA	NA
WP_004143017.1|930397_931264_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|931265_931478_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|931523_932909_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 80
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	941454	942141	5274107		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151324.1|941454_942141_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
>prophage 81
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	945323	950529	5274107		Bacillus_virus(50.0%)	5	NA	NA
WP_002892260.1|945323_946001_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	7.8e-23
WP_002892258.1|946141_947059_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004151325.1|947055_947514_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002892208.1|947510_947921_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004225763.1|947973_950529_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
>prophage 82
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	960674	968485	5274107	transposase	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_002892181.1|960674_962549_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	6.4e-115
WP_002892177.1|962660_963266_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892173.1|963265_963598_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004151328.1|963655_965563_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	2.3e-43
WP_002892145.1|965655_966207_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_002892144.1|966357_966735_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892142.1|966804_967332_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892136.1|967344_967518_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_002892131.1|967585_968485_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
>prophage 83
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	974006	983397	5274107		Leptospira_phage(33.33%)	11	NA	NA
WP_002892069.1|974006_977153_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
WP_002892066.1|977638_978013_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892050.1|978039_978258_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892030.1|978416_978983_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_004147370.1|978954_979095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892026.1|979115_979586_+	membrane protein	NA	NA	NA	NA	NA
WP_002892023.1|979560_981012_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892021.1|981112_981811_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892018.1|981807_981948_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892011.1|981947_982211_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892007.1|982326_983397_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
>prophage 84
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	992571	993681	5274107		Planktothrix_phage(100.0%)	1	NA	NA
WP_002891989.1|992571_993681_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 85
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1004604	1008148	5274107		Bacillus_phage(100.0%)	2	NA	NA
WP_002891880.1|1004604_1006383_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
WP_002891876.1|1006375_1008148_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	9.1e-47
>prophage 86
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1012575	1013277	5274107		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002891863.1|1012575_1013277_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 87
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1016414	1027654	5274107	protease,transposase	Enterobacteria_phage(28.57%)	8	NA	NA
WP_001067855.1|1016414_1017119_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840280.1|1017469_1018024_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|1018257_1018815_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143775.1|1018976_1021982_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_002444653.1|1022485_1022758_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
WP_004151336.1|1022967_1025322_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
WP_002891807.1|1025505_1026780_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
WP_002891804.1|1027030_1027654_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
>prophage 88
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1041960	1043658	5274107		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004151339.1|1041960_1043658_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	7.2e-17
>prophage 89
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1056443	1061103	5274107		Klosneuvirus(33.33%)	6	NA	NA
WP_105329767.1|1056443_1057418_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.6e-08
WP_004191729.1|1057463_1057967_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_002891357.1|1057959_1058931_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_002891356.1|1059002_1059422_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_001021161.1|1059441_1059912_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_002890420.1|1059999_1061103_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	6.5e-51
>prophage 90
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1064701	1069040	5274107	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_002890403.1|1064701_1065673_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
WP_105329769.1|1065683_1067531_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002890398.1|1067557_1067890_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
WP_002890395.1|1067912_1069040_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
>prophage 91
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1085845	1094365	5274107		Bacillus_phage(60.0%)	6	NA	NA
WP_002890344.1|1085845_1087141_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
WP_002890343.1|1087162_1087852_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
WP_002890342.1|1088034_1089240_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
WP_004151346.1|1089236_1092374_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
WP_002890286.1|1092447_1093362_-	fructokinase	NA	NA	NA	NA	NA
WP_002890285.1|1093453_1094365_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
>prophage 92
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1114848	1115616	5274107		Planktothrix_phage(100.0%)	1	NA	NA
WP_002890194.1|1114848_1115616_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 93
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1126619	1130340	5274107		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
WP_004151354.1|1126619_1127402_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
WP_002890126.1|1127394_1128090_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
WP_002890108.1|1128206_1128377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002890106.1|1128710_1129520_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004151355.1|1129521_1130340_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
>prophage 94
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1139413	1140256	5274107		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002890003.1|1139413_1140256_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 95
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1147100	1157210	5274107	integrase	Enterobacteria_phage(70.0%)	13	1148294:1148307	1152507:1152520
WP_004144576.1|1147100_1148153_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
1148294:1148307	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|1148442_1149546_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|1149556_1150810_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|1151162_1152353_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|1152340_1153291_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
1152507:1152520	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|1153290_1153716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|1154062_1154212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|1154284_1154851_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|1154868_1155114_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|1155110_1155848_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_004903606.1|1156147_1156285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|1156389_1156656_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|1156658_1157210_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
>prophage 96
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1168553	1169951	5274107		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002889878.1|1168553_1169951_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	5.7e-44
>prophage 97
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1174598	1175594	5274107		Catovirus(100.0%)	1	NA	NA
WP_002889854.1|1174598_1175594_+	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 98
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1183127	1184411	5274107		Klosneuvirus(100.0%)	1	NA	NA
WP_004147193.1|1183127_1184411_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	6.4e-34
>prophage 99
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1201660	1202242	5274107		Caulobacter_phage(100.0%)	1	NA	NA
WP_004145825.1|1201660_1202242_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 100
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1207750	1211960	5274107		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_004145831.1|1207750_1208491_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.2e-38
WP_002889686.1|1208546_1209014_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
WP_002889685.1|1209010_1209733_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004152035.1|1209765_1210521_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002889632.1|1210592_1211960_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
>prophage 101
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1216025	1216829	5274107		Indivirus(100.0%)	1	NA	NA
WP_002889598.1|1216025_1216829_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	8.4e-40
>prophage 102
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1223333	1224365	5274107		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889450.1|1223333_1224365_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 103
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1237349	1241449	5274107		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_002889378.1|1237349_1240832_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	9.1e-208
WP_002889376.1|1240849_1241449_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
>prophage 104
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1250280	1251039	5274107		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002889316.1|1250280_1251039_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 105
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1262617	1264051	5274107	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002889286.1|1262617_1264051_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 106
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1268006	1268351	5274107		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002889275.1|1268006_1268351_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 107
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1274317	1275115	5274107		Planktothrix_phage(100.0%)	1	NA	NA
WP_002889212.1|1274317_1275115_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 108
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1297250	1304021	5274107	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_004151944.1|1297250_1299680_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.0	5.1e-40
WP_004145901.1|1299752_1300289_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_002888848.1|1300288_1301005_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002888845.1|1301167_1301623_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004145903.1|1301682_1302564_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071526609.1|1302626_1304021_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
>prophage 109
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1309425	1319302	5274107	transposase	Anomala_cuprea_entomopoxvirus(25.0%)	10	NA	NA
WP_002888823.1|1309425_1310352_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
WP_002888821.1|1310536_1311199_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_002888819.1|1311258_1311795_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
WP_012542835.1|1311799_1311919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002888816.1|1311999_1314390_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_002888811.1|1314473_1316072_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
WP_002888808.1|1316217_1316565_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_002888804.1|1316812_1317223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151949.1|1317219_1318062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|1318110_1319302_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
>prophage 110
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1328952	1330377	5274107		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002888731.1|1328952_1330377_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 111
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1341717	1342281	5274107		Sphingobium_phage(100.0%)	1	NA	NA
WP_002888692.1|1341717_1342281_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 112
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1346548	1347592	5274107		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004145938.1|1346548_1347592_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 113
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1373784	1375509	5274107		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002888534.1|1373784_1375509_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 114
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1386908	1387664	5274107		Streptococcus_phage(100.0%)	1	NA	NA
WP_004151365.1|1386908_1387664_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.5	5.5e-25
>prophage 115
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1396363	1397065	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_004145970.1|1396363_1397065_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 116
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1403361	1408813	5274107		Fish_lymphocystis_disease_virus(50.0%)	2	NA	NA
WP_039100403.1|1403361_1405719_+	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	3.0e-13
WP_004151368.1|1405906_1408813_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
>prophage 117
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1421271	1422855	5274107		Pseudomonas_phage(50.0%)	2	NA	NA
WP_002888321.1|1421271_1422120_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
WP_002888320.1|1422375_1422855_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
>prophage 118
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1429196	1430345	5274107		Halovirus(100.0%)	1	NA	NA
WP_002888051.1|1429196_1430345_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 119
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1449142	1459095	5274107	tRNA	Tupanvirus(25.0%)	8	NA	NA
WP_002887972.1|1449142_1451959_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	4.6e-77
WP_002887969.1|1452002_1452941_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002887965.1|1453270_1453534_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004221172.1|1453530_1453644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002887961.1|1453653_1454550_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_002887958.1|1454604_1455780_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	4.9e-89
WP_002887955.1|1455957_1457091_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
WP_004146997.1|1457178_1459095_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
>prophage 120
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1463466	1464420	5274107		Cyanophage(100.0%)	1	NA	NA
WP_002887897.1|1463466_1464420_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 121
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1481577	1486737	5274107		Bacillus_phage(33.33%)	3	NA	NA
WP_002887806.1|1481577_1483515_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
WP_002887805.1|1483743_1485411_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
WP_002887802.1|1485504_1486737_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
>prophage 122
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1493068	1494391	5274107		Geobacillus_virus(100.0%)	1	NA	NA
WP_002887787.1|1493068_1494391_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 123
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1499126	1501847	5274107		Salmonella_phage(50.0%)	3	NA	NA
WP_002887716.1|1499126_1499288_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
WP_004146042.1|1499417_1500038_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002887711.1|1500257_1501847_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
>prophage 124
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1515070	1516350	5274107		Salmonella_phage(50.0%)	2	NA	NA
WP_002887624.1|1515070_1515610_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
WP_002887623.1|1515612_1516350_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
>prophage 125
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1519510	1522678	5274107	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_004221130.1|1519510_1520455_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.9e-68
WP_002887615.1|1520588_1521599_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002887612.1|1521616_1522678_-	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	22.5	2.5e-07
>prophage 126
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1529682	1530705	5274107		Tupanvirus(100.0%)	1	NA	NA
WP_004151386.1|1529682_1530705_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.3	1.7e-13
>prophage 127
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1562806	1563733	5274107	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002887421.1|1562806_1563733_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 128
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1579320	1580805	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_002887350.1|1579320_1580805_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	3.2e-13
>prophage 129
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1584721	1587466	5274107		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004152413.1|1584721_1587466_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
>prophage 130
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1597222	1599329	5274107		Hokovirus(50.0%)	2	NA	NA
WP_002887275.1|1597222_1598656_-	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.0e-12
WP_002887273.1|1598645_1599329_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
>prophage 131
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1602567	1607525	5274107		Leptospira_phage(33.33%)	4	NA	NA
WP_002887262.1|1602567_1605717_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	6.4e-59
WP_002887261.1|1605789_1606137_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002887259.1|1606146_1606680_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
WP_002887258.1|1606796_1607525_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
>prophage 132
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1628335	1634160	5274107		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|1628335_1630669_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|1630683_1631004_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|1631000_1631228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|1631224_1631767_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|1631769_1632036_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|1632596_1633334_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|1633330_1633576_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|1633593_1634160_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 133
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1637535	1638798	5274107	integrase	Stenotrophomonas_phage(100.0%)	1	1632857:1632870	1639964:1639977
1632857:1632870	attL	GCTGGCGCAGGAAT	NA	NA	NA	NA
WP_004152198.1|1637535_1638798_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
WP_004152198.1|1637535_1638798_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
1639964:1639977	attR	GCTGGCGCAGGAAT	NA	NA	NA	NA
>prophage 134
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1641880	1646706	5274107		Tupanvirus(50.0%)	5	NA	NA
WP_002886990.1|1641880_1642900_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	8.4e-45
WP_004152194.1|1643030_1643915_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002886980.1|1643904_1644792_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002886979.1|1644802_1645627_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_002886975.1|1645632_1646706_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	5.2e-29
>prophage 135
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1662478	1671528	5274107	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_002886957.1|1662478_1663981_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
WP_002886956.1|1664029_1665112_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_002886955.1|1665111_1666209_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886954.1|1666598_1668110_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886953.1|1668229_1668673_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002886952.1|1668672_1671528_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
>prophage 136
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1681621	1687679	5274107		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_002886928.1|1681621_1682557_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
WP_002886927.1|1682570_1683032_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002886926.1|1683184_1683571_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_004152273.1|1683643_1686352_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
WP_002886919.1|1686731_1687679_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	1.5e-11
>prophage 137
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1695436	1698568	5274107		Vibrio_phage(33.33%)	3	NA	NA
WP_002886904.1|1695436_1697575_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
WP_002886903.1|1697815_1698280_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
WP_002886902.1|1698283_1698568_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	2.4e-26
>prophage 138
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1714701	1721280	5274107		Klosneuvirus(33.33%)	6	NA	NA
WP_002886827.1|1714701_1715700_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
WP_002886825.1|1715742_1716741_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_004152011.1|1716727_1717753_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002886772.1|1717763_1719266_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_002886769.1|1719389_1720346_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002886766.1|1720749_1721280_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
>prophage 139
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1737779	1738604	5274107		Bordetella_phage(100.0%)	1	NA	NA
WP_002886699.1|1737779_1738604_+	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 140
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1758201	1762545	5274107		Lactococcus_phage(50.0%)	3	NA	NA
WP_002885668.1|1758201_1760634_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
WP_002885667.1|1760670_1761096_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002885665.1|1761246_1762545_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
>prophage 141
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1768475	1771701	5274107		Wolbachia_phage(50.0%)	2	NA	NA
WP_014342863.1|1768475_1770023_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.3	4.1e-27
WP_004152021.1|1770345_1771701_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
>prophage 142
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1776543	1777089	5274107		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002885538.1|1776543_1777089_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 143
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1784443	1789637	5274107		Tupanvirus(33.33%)	6	NA	NA
WP_004146714.1|1784443_1785421_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
WP_004152023.1|1785696_1787487_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
WP_002885531.1|1787479_1788214_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_002885530.1|1788224_1788620_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_002885526.1|1788630_1788990_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_002885523.1|1789103_1789637_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
>prophage 144
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1793751	1794732	5274107	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|1793751_1794732_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 145
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1802016	1807662	5274107		Bacillus_phage(33.33%)	5	NA	NA
WP_002885444.1|1802016_1804140_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.9	7.6e-32
WP_002885443.1|1804152_1805016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152419.1|1805070_1805424_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_002885441.1|1805684_1807331_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
WP_004152420.1|1807368_1807662_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
>prophage 146
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1818575	1819939	5274107	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|1818575_1819939_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 147
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1829180	1834267	5274107	transposase	Escherichia_phage(40.0%)	7	NA	NA
WP_004199298.1|1829180_1829864_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
WP_002885341.1|1829820_1829934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002885338.1|1830009_1830927_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
WP_002885324.1|1830926_1831232_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_085955125.1|1831400_1832763_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_004151723.1|1832929_1833301_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
WP_004146678.1|1833310_1834267_-	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
>prophage 148
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1838631	1840134	5274107		Burkholderia_virus(100.0%)	1	NA	NA
WP_002885227.1|1838631_1840134_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 149
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1845494	1847041	5274107		Bacillus_virus(50.0%)	2	NA	NA
WP_002885198.1|1845494_1846253_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	2.6e-14
WP_002885196.1|1846360_1847041_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
>prophage 150
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1852421	1853942	5274107		Pithovirus(100.0%)	1	NA	NA
WP_002885173.1|1852421_1853942_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	6.7e-06
>prophage 151
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1859883	1866668	5274107		Escherichia_phage(50.0%)	5	NA	NA
WP_077598858.1|1859883_1862031_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
WP_004151733.1|1862260_1862947_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004146659.1|1862983_1864297_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_004226113.1|1864408_1864609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002885145.1|1864709_1866668_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
>prophage 152
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1878951	1880301	5274107		Moraxella_phage(100.0%)	1	NA	NA
WP_002885079.1|1878951_1880301_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 153
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1887830	1888913	5274107		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004151741.1|1887830_1888913_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.7e-19
>prophage 154
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1900841	1906148	5274107		Vibrio_phage(33.33%)	3	NA	NA
WP_002885017.1|1900841_1902422_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
WP_004151744.1|1902546_1903071_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_004146620.1|1903322_1906148_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
>prophage 155
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1909329	1911856	5274107		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_002884943.1|1909329_1910409_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.9e-26
WP_002884942.1|1910440_1911856_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
>prophage 156
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1917851	1918460	5274107		Lactococcus_phage(100.0%)	1	NA	NA
WP_002884822.1|1917851_1918460_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 157
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1925526	1926636	5274107		Mycoplasma_phage(100.0%)	1	NA	NA
WP_002884743.1|1925526_1926636_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 158
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1943145	1943949	5274107		Moumouvirus(100.0%)	1	NA	NA
WP_002884614.1|1943145_1943949_+	SDR family oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	24.2	1.8e-05
>prophage 159
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1950517	1954201	5274107		Dickeya_phage(100.0%)	1	NA	NA
WP_004151753.1|1950517_1954201_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 160
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1967744	1969334	5274107		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002884359.1|1967744_1969334_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 161
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1974755	1976519	5274107		Bacillus_phage(50.0%)	3	NA	NA
WP_002884342.1|1974755_1975028_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
WP_002884331.1|1975214_1975805_-	YjaG family protein	NA	NA	NA	NA	NA
WP_004152311.1|1975847_1976519_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
>prophage 162
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	1984944	1997388	5274107		Bacillus_phage(33.33%)	6	NA	NA
WP_004171439.1|1984944_1986477_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.2e-12
WP_002884150.1|1986649_1986955_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002884149.1|1986958_1987276_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002884148.1|1987318_1988659_-	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_002884146.1|1989059_1993283_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
WP_004152306.1|1993359_1997388_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
>prophage 163
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2001615	2004736	5274107		Tupanvirus(50.0%)	2	NA	NA
WP_004174069.1|2001615_2002800_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
WP_002883524.1|2003785_2004736_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
>prophage 164
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2014672	2015287	5274107		Streptococcus_phage(100.0%)	1	NA	NA
WP_002883449.1|2014672_2015287_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 165
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2024005	2027349	5274107		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_002883427.1|2024005_2024785_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
WP_002883426.1|2024787_2025324_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_002883425.1|2025327_2025579_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_002883424.1|2025708_2027349_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
>prophage 166
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2039350	2042812	5274107	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_002883410.1|2039350_2040259_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	6.3e-68
WP_004152056.1|2040303_2040924_-	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_004152055.1|2040985_2042812_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
>prophage 167
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2046647	2050492	5274107		Bacillus_phage(50.0%)	3	NA	NA
WP_002883398.1|2046647_2048810_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
WP_002883397.1|2048873_2049590_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002883396.1|2049589_2050492_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
>prophage 168
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2066859	2073001	5274107		uncultured_marine_virus(20.0%)	6	NA	NA
WP_002883310.1|2066859_2067990_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
WP_004146507.1|2067995_2068670_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_002883307.1|2068647_2069529_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
WP_002883303.1|2069547_2070615_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
WP_002883302.1|2070611_2071874_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
WP_002883297.1|2071870_2073001_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
>prophage 169
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2077051	2085674	5274107	transposase	Indivirus(25.0%)	7	NA	NA
WP_002883224.1|2077051_2077381_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
WP_002883222.1|2077722_2078988_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
WP_004150419.1|2079106_2080615_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002883211.1|2080634_2081561_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|2081860_2082841_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002883185.1|2082925_2083648_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_004152491.1|2083652_2085674_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.1e-112
>prophage 170
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2093777	2095424	5274107		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002883142.1|2093777_2095424_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 171
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2105486	2107325	5274107		Acinetobacter_phage(100.0%)	1	NA	NA
WP_002883025.1|2105486_2107325_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
>prophage 172
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2121955	2122618	5274107		Cyanophage(100.0%)	1	NA	NA
WP_002882982.1|2121955_2122618_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	1.0e-27
>prophage 173
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2127389	2128946	5274107		Pandoravirus(100.0%)	1	NA	NA
WP_002882946.1|2127389_2128946_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	5.6e-08
>prophage 174
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2140010	2141345	5274107		Erwinia_phage(100.0%)	1	NA	NA
WP_002882917.1|2140010_2141345_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 175
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2145847	2149350	5274107		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_002882901.1|2145847_2146546_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_002882898.1|2146542_2147916_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882896.1|2147982_2148657_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882894.1|2148729_2149350_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 176
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2157688	2159200	5274107		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_004151860.1|2157688_2159200_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	2.3e-14
>prophage 177
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2182171	2183089	5274107		Pandoravirus(100.0%)	1	NA	NA
WP_002882812.1|2182171_2183089_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.8	7.9e-18
>prophage 178
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2189911	2192379	5274107		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_004146229.1|2189911_2190961_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
WP_002882749.1|2190969_2192379_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
>prophage 179
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2196267	2199060	5274107		uncultured_virus(100.0%)	1	NA	NA
WP_002882729.1|2196267_2199060_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	6.4e-71
>prophage 180
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2213354	2219233	5274107		Enterobacteria_phage(33.33%)	5	NA	NA
WP_002882536.1|2213354_2214245_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
WP_002882531.1|2214272_2215238_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_002882529.1|2215243_2216749_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	4.0e-19
WP_002882527.1|2216759_2217179_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_002882520.1|2217364_2219233_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
>prophage 181
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2222398	2223391	5274107		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_002882514.1|2222398_2223391_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 182
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2235741	2243301	5274107		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_004151550.1|2235741_2237112_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
WP_004151549.1|2237295_2239125_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	1.6e-123
WP_004150308.1|2239461_2240502_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
WP_004145004.1|2240630_2241590_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004151547.1|2241589_2242480_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004145006.1|2242527_2243301_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
>prophage 183
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2249077	2250415	5274107		Moraxella_phage(100.0%)	1	NA	NA
WP_004145100.1|2249077_2250415_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 184
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2257907	2265437	5274107		Staphylococcus_phage(33.33%)	7	NA	NA
WP_004151536.1|2257907_2258165_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
WP_004151535.1|2258128_2258488_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|2258503_2258644_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004151534.1|2259265_2260669_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004151533.1|2260673_2261774_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_004151532.1|2261920_2262994_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004151531.1|2263022_2265437_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	1.1e-114
>prophage 185
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2271204	2272353	5274107		Oenococcus_phage(100.0%)	1	NA	NA
WP_004150286.1|2271204_2272353_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 186
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2275788	2277708	5274107		Cyanophage(33.33%)	3	NA	NA
WP_004151523.1|2275788_2276202_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_004145074.1|2276318_2276747_+	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
WP_004151522.1|2276883_2277708_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.4	8.2e-91
>prophage 187
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2288717	2294156	5274107		Salmonella_phage(50.0%)	7	NA	NA
WP_002923297.1|2288717_2289902_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.5	3.7e-12
WP_002923296.1|2290077_2290911_-	EamA family transporter	NA	NA	NA	NA	NA
WP_002923294.1|2290978_2291425_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_164074086.1|2291515_2291635_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_014343455.1|2292087_2292255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002923286.1|2292267_2292363_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004198592.1|2292467_2294156_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	1.7e-58
>prophage 188
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2306333	2307446	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_002923193.1|2306333_2307446_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-26
>prophage 189
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2325881	2327045	5274107		Salmonella_phage(100.0%)	1	NA	NA
WP_002923107.1|2325881_2327045_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 190
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2344305	2345355	5274107		Tupanvirus(100.0%)	1	NA	NA
WP_002922967.1|2344305_2345355_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 191
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2358614	2360006	5274107		environmental_Halophage(100.0%)	1	NA	NA
WP_002922950.1|2358614_2360006_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 192
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2363140	2363992	5274107		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002922941.1|2363140_2363992_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 193
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2374973	2383263	5274107		Bordetella_phage(25.0%)	7	NA	NA
WP_004151503.1|2374973_2377094_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|2377112_2377388_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002922664.1|2377442_2378066_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
WP_002922662.1|2378324_2380001_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	1.5e-22
WP_002922654.1|2380006_2380624_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_004151501.1|2380898_2382149_+	chloride channel protein	NA	NA	NA	NA	NA
WP_004151500.1|2382204_2383263_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
>prophage 194
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2388819	2389800	5274107	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|2388819_2389800_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 195
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2393527	2398269	5274107		Xanthomonas_phage(25.0%)	7	NA	NA
WP_004145270.1|2393527_2393986_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
WP_004198431.1|2393963_2395181_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.5	8.5e-44
WP_002922589.1|2395350_2396016_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|2396232_2396469_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922510.1|2396489_2396657_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002922508.1|2396792_2397602_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
WP_002922501.1|2397789_2398269_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
>prophage 196
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2411037	2420187	5274107		Prochlorococcus_phage(20.0%)	9	NA	NA
WP_002922463.1|2411037_2411970_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
WP_002922462.1|2412183_2413377_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
WP_002922461.1|2413389_2414415_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
WP_002922460.1|2414583_2415372_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002922459.1|2415377_2416325_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002922458.1|2416328_2417600_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
WP_004152046.1|2417609_2419154_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002922436.1|2419399_2419831_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002922429.1|2419935_2420187_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
>prophage 197
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2436024	2437866	5274107		Tupanvirus(100.0%)	1	NA	NA
WP_002922367.1|2436024_2437866_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 198
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2445839	2447381	5274107		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002922346.1|2445839_2447381_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 199
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2452849	2453845	5274107		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004152039.1|2452849_2453845_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	3.6e-08
>prophage 200
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2457748	2461253	5274107	transposase	Mannheimia_phage(33.33%)	4	NA	NA
WP_004173931.1|2457748_2458795_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_002922102.1|2458868_2459021_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_004152429.1|2459322_2460942_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.7	4.0e-25
WP_000014594.1|2461040_2461253_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 201
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2464656	2465628	5274107		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002921928.1|2464656_2465628_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 202
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2470787	2473527	5274107		Escherichia_phage(50.0%)	2	NA	NA
WP_004152428.1|2470787_2473118_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	5.7e-65
WP_002921915.1|2473086_2473527_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.9	1.7e-15
>prophage 203
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2480346	2481709	5274107	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_085955125.1|2480346_2481709_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 204
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2486033	2492006	5274107		Planktothrix_phage(33.33%)	6	NA	NA
WP_002921785.1|2486033_2487017_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
WP_002921784.1|2487013_2488027_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
WP_004145206.1|2488045_2488225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151436.1|2488542_2489082_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_002921735.1|2489083_2489875_+	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_002921733.1|2489894_2492006_+	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
>prophage 205
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2535735	2537778	5274107		Indivirus(100.0%)	1	NA	NA
WP_004151426.1|2535735_2537778_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 206
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2546319	2547111	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_002921186.1|2546319_2547111_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	24.0	2.9e-13
>prophage 207
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2553213	2557320	5274107		Tupanvirus(66.67%)	3	NA	NA
WP_002921037.1|2553213_2554353_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
WP_002921035.1|2554354_2555338_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
WP_002921032.1|2555334_2557320_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
>prophage 208
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2563620	2567757	5274107		Dickeya_phage(50.0%)	4	NA	NA
WP_002920860.1|2563620_2564286_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
WP_002920858.1|2564492_2564738_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
WP_004151416.1|2564841_2567052_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
WP_002920827.1|2567130_2567757_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
>prophage 209
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2570841	2576642	5274107		Staphylococcus_phage(25.0%)	5	NA	NA
WP_002920817.1|2570841_2571510_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
WP_002920816.1|2571502_2572558_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920815.1|2572827_2573682_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_004151415.1|2573734_2575258_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.8	1.1e-13
WP_002920814.1|2575376_2576642_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
>prophage 210
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2583963	2586196	5274107		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_002920803.1|2583963_2584731_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
WP_004145133.1|2584732_2585446_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
WP_002920802.1|2585609_2585831_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002920800.1|2585827_2586196_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
>prophage 211
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2589622	2591430	5274107		Planktothrix_phage(50.0%)	2	NA	NA
WP_002920787.1|2589622_2590693_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
WP_002920785.1|2590689_2591430_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
>prophage 212
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2609175	2611623	5274107		Dickeya_phage(100.0%)	1	NA	NA
WP_002920561.1|2609175_2611623_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 213
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2615480	2616239	5274107		Escherichia_phage(100.0%)	1	NA	NA
WP_105329789.1|2615480_2616239_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	3.0e-23
>prophage 214
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2619584	2621975	5274107		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004151407.1|2619584_2621975_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 215
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2634801	2638573	5274107		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|2634801_2635521_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_002920333.1|2635517_2636873_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
WP_002920331.1|2636950_2638573_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.0e-140
>prophage 216
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2653396	2654224	5274107		Vibrio_phage(100.0%)	1	NA	NA
WP_002920260.1|2653396_2654224_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 217
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2665625	2675269	5274107		Acinetobacter_phage(25.0%)	10	NA	NA
WP_002920229.1|2665625_2666189_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
WP_002920226.1|2666279_2667500_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_004151402.1|2667489_2669568_-	membrane protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
WP_000242758.1|2669619_2670252_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_002920158.1|2670558_2670963_+	OsmC family protein	NA	NA	NA	NA	NA
WP_002920153.1|2671017_2671887_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_002920151.1|2671923_2672142_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
WP_021468514.1|2672138_2673137_-	hydrolase	NA	NA	NA	NA	NA
WP_014343437.1|2673101_2673302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002920148.1|2673364_2675269_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
>prophage 218
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2683114	2686483	5274107		Streptococcus_phage(50.0%)	2	NA	NA
WP_002920103.1|2683114_2685229_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
WP_004174069.1|2685298_2686483_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 219
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2706386	2740710	5274107	terminase,integrase,transposase,tRNA,head,tail,portal,protease	uncultured_Caudovirales_phage(68.75%)	34	2723994:2724011	2741055:2741072
WP_002919147.1|2706386_2707334_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|2707348_2707858_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|2707986_2709111_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|2709082_2709556_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|2709581_2710124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|2710128_2710701_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|2710704_2711523_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|2711519_2711777_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|2711752_2712307_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|2718102_2718324_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|2718617_2721728_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|2721740_2722880_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|2723258_2723909_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
2723994:2724011	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|2724184_2725411_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|2725503_2726445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|2726626_2726911_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|2726921_2727701_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|2728203_2728422_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|2728414_2728603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|2728679_2728808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|2728906_2729275_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|2729271_2729637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|2729636_2731772_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|2732114_2732450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|2732498_2733011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2734184_2735153_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_001547826.1|2735558_2736119_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|2736120_2737362_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|2737358_2737694_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|2737690_2737990_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|2737989_2738433_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|2738425_2738578_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|2738708_2739065_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|2739048_2740710_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
2741055:2741072	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 220
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2752269	2753313	5274107		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|2752269_2753313_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 221
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2771022	2772390	5274107	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002918566.1|2771022_2772390_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
>prophage 222
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2776335	2776830	5274107	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_002918465.1|2776335_2776830_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 223
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2784275	2785208	5274107		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002918455.1|2784275_2785208_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 224
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2789152	2802083	5274107		Hokovirus(16.67%)	15	NA	NA
WP_002918444.1|2789152_2791492_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
WP_002918442.1|2791725_2792379_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002918435.1|2792375_2793101_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002918431.1|2793164_2793437_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002918428.1|2793433_2794288_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_002918425.1|2794333_2794822_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002918423.1|2794892_2795180_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_002918420.1|2795202_2796636_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002918417.1|2796683_2797409_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_002918415.1|2797415_2797961_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002918413.1|2797929_2798505_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002918405.1|2798501_2799068_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
WP_002918399.1|2799082_2800069_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
WP_002918397.1|2800083_2801061_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004150950.1|2801270_2802083_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
>prophage 225
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2806132	2807574	5274107		Vibrio_phage(50.0%)	2	NA	NA
WP_002918381.1|2806132_2806405_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
WP_002918380.1|2806602_2807574_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
>prophage 226
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2814172	2817049	5274107	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_002918372.1|2814172_2816107_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
WP_002918371.1|2816200_2817049_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
>prophage 227
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2821313	2827932	5274107		Dickeya_phage(50.0%)	5	NA	NA
WP_004144895.1|2821313_2822657_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_004228374.1|2822636_2822792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918364.1|2823249_2823702_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002918252.1|2823729_2825217_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002918250.1|2825241_2827932_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
>prophage 228
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2833346	2835278	5274107		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004150943.1|2833346_2835278_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 229
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2840971	2850669	5274107		Invertebrate_iridovirus(20.0%)	12	NA	NA
WP_002918226.1|2840971_2841262_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	3.1e-13
WP_002918223.1|2841311_2841755_+	YhbP family protein	NA	NA	NA	NA	NA
WP_002918221.1|2841716_2842253_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
WP_002918218.1|2842381_2843029_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002918216.1|2843104_2844145_+	permease	NA	NA	NA	NA	NA
WP_002918214.1|2844266_2844842_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002918211.1|2844851_2845442_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_002918206.1|2845467_2845854_-	YraN family protein	NA	NA	NA	NA	NA
WP_004160309.1|2845811_2847929_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_004144878.1|2847992_2848856_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
WP_004150941.1|2848970_2849861_+	Fic family protein	NA	NA	NA	NA	NA
WP_002918124.1|2849895_2850669_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.2e-22
>prophage 230
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2866775	2867921	5274107		Streptococcus_phage(100.0%)	1	NA	NA
WP_002917950.1|2866775_2867921_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	6.7e-51
>prophage 231
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2884944	2885916	5274107		Escherichia_phage(100.0%)	1	NA	NA
WP_002917893.1|2884944_2885916_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	2.0e-35
>prophage 232
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2895479	2896967	5274107		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002917730.1|2895479_2896967_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	28.7	1.3e-09
>prophage 233
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2901238	2902618	5274107		Klosneuvirus(100.0%)	1	NA	NA
WP_004174227.1|2901238_2902618_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 234
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2920696	2935050	5274107	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	13	NA	NA
WP_002917658.1|2920696_2921500_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
WP_002917655.1|2921551_2921857_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_002917651.1|2921883_2922459_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_004188513.1|2922699_2923371_+	YfdX family protein	NA	NA	NA	NA	NA
WP_004150925.1|2923461_2926704_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	3.3e-34
WP_002917647.1|2926708_2927323_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004144804.1|2927624_2927990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002917638.1|2928058_2928331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917636.1|2929066_2929573_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004144518.1|2929672_2931508_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917631.1|2931726_2933472_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|2933583_2933799_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002916879.1|2934036_2935050_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 235
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2944343	2945585	5274107		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002916864.1|2944343_2945585_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 236
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2950696	2957577	5274107		uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_002916858.1|2950696_2952130_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
WP_004144536.1|2952207_2952357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002916857.1|2952348_2952546_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_002916856.1|2952581_2952854_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002916855.1|2953231_2953885_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.8e-45
WP_002916852.1|2953946_2954717_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_002916851.1|2954903_2955695_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_002916850.1|2955739_2956900_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.4e-88
WP_002916849.1|2956905_2957577_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
>prophage 237
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2961919	2963815	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_002916844.1|2961919_2963815_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 238
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2967126	2977029	5274107		Stx_converting_phage(25.0%)	8	NA	NA
WP_002916833.1|2967126_2967522_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
WP_002916831.1|2967599_2968469_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002916828.1|2968590_2970849_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
WP_002916826.1|2971040_2971778_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_004144547.1|2971861_2973274_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_002916798.1|2973397_2975581_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
WP_004150920.1|2975638_2976166_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002916796.1|2976201_2977029_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
>prophage 239
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	2996738	2998115	5274107		Lactococcus_phage(100.0%)	1	NA	NA
WP_004217775.1|2996738_2998115_-	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JHY1	Lactococcus_phage	36.7	8.7e-45
>prophage 240
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3002998	3004366	5274107		Escherichia_phage(100.0%)	1	NA	NA
WP_004150905.1|3002998_3004366_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.0	3.7e-120
>prophage 241
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3010646	3011402	5274107		Lactobacillus_prophage(100.0%)	1	NA	NA
WP_022644655.1|3010646_3011402_+	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	34.7	6.9e-12
>prophage 242
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3032957	3034325	5274107		Morganella_phage(100.0%)	1	NA	NA
WP_004150873.1|3032957_3034325_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	34.2	5.9e-62
>prophage 243
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3044719	3046255	5274107		Vibrio_phage(100.0%)	4	NA	NA
WP_004152612.1|3044719_3044971_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	4.0e-17
WP_004155677.1|3045074_3045320_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152613.1|3045398_3045854_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004152614.1|3045994_3046255_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	1.1e-17
>prophage 244
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3052954	3053935	5274107		Caulobacter_phage(100.0%)	1	NA	NA
WP_004151764.1|3052954_3053935_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.4	1.3e-47
>prophage 245
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3061481	3062567	5274107		Geobacillus_virus(100.0%)	1	NA	NA
WP_004144786.1|3061481_3062567_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	1.0e-11
>prophage 246
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3077438	3078593	5274107		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004149807.1|3077438_3078593_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 247
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3092348	3093143	5274107		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002916526.1|3092348_3093143_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 248
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3110396	3111629	5274107		Catovirus(100.0%)	1	NA	NA
WP_002916493.1|3110396_3111629_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 249
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3119572	3122446	5274107		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002916478.1|3119572_3122446_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 250
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3127021	3128455	5274107		Pandoravirus(100.0%)	1	NA	NA
WP_002916322.1|3127021_3128455_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.6e-33
>prophage 251
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3133151	3141053	5274107	tRNA	Brevibacillus_phage(20.0%)	8	NA	NA
WP_004144729.1|3133151_3134048_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
WP_002916301.1|3134070_3134784_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004151783.1|3134789_3136523_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
WP_095858446.1|3136608_3137706_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_002916299.1|3137716_3139234_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
WP_002916298.1|3139468_3140023_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_004218859.1|3140163_3140289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004157874.1|3140339_3141053_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
>prophage 252
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3145021	3146041	5274107		Klosneuvirus(100.0%)	1	NA	NA
WP_002916289.1|3145021_3146041_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 253
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3149119	3153251	5274107		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_002916281.1|3149119_3149449_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
WP_002916279.1|3149500_3150793_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.2	1.0e-164
WP_002916278.1|3150802_3151225_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	4.5e-45
WP_002916277.1|3151697_3153251_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
>prophage 254
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3168277	3170604	5274107	integrase,transposase	Escherichia_phage(100.0%)	2	3168210:3168269	3175175:3176370
3168210:3168269	attL	GGAAGGTGCGAACAAGTTCCTGATATGAGATCATCATATTCATCCGGAGCGCATCCCAGA	NA	NA	NA	NA
WP_000019473.1|3168277_3169258_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004151951.1|3169998_3170604_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
3175175:3176370	attR	GGAAGGTGCGAACAAGTTCCTGATATGAGATCATCATATTCATCCGGAGCGCATCCCAGAGGGACATCATGAGCCATCAACTCACCTTCGCCGATAGTGAATTCAGCACTAAGCGCCGTCAGACCCGAAAAGAGATTTTCCTCTCCCGCATGGAGCAGATTCTGCCATGGCAAAACATGGTGGAAGTCATCGAGCCGTTTTATCCCAAGGCGGGCAATGGCCGACGGCCCTATCCGCTGGAGACCATGCTGCGTATTCACTGCATGCAGCATTGGTACAACCTGAGCGACGGTGCCATGGAAGATGCCCTGTACGAAATCGCCTCCATGCGCCTGTTTGCCCGATTATCCCTGGATAGCGCCCTGCCGGATCGCACCACCATCATGAATTTCCGCCACCTGCTCGAGCAGCATCAACTGGCCCGTCAATTGTTCAAGACCATCAATCGCTGGCTGGCCGAAGCAGGCGTCATGATGACCCAAGGCACTTTGGTGGATGCCACCATCATTGAGGCACCCAGCTCTACCAAGAACAAAGAGCAGCAACGCGATCCGGAGATGCATCAGACCAAGAAAGGCAATCAGTGGCACTTTGGCATGAAGGCCCACATTGGTGTCGATGCCAAGAGTGGCCTGACCCACAGCCTAGTCACCACCGCGGCCAACGAGCATGACCTCAATCAGCTGGGTAATCTGCTTCATGGAGAGGAGCAATTTGTCTCAGCCGATGCCGGCTACCAAGGAGCGCCACAGCGCGAGGAGCTGGCCGAGGTGGATGTGGACTGGCTGATCGCCGAGCGTCCCGGCAAGGTAAAAACCTTGAAGCAGCATCCGCGCAAGAACAAAACGGCCATCAACATCGAATACATGAAAGCCAGCATCCGTGCCAGGGTGGAGCACCCGTTTCGCATCATCAAGCGGCAGTTCGGCTTCGTGAAAGCCAGATACAAAGGGCTGCTGAAAAACGATAACCAACTGGCGATGTTATTCACCCTGGCCAACCTGTTTCGGGTGGACCAAATGATACGTCAGTGGGAGAGATCTCAGTAAAAACCGGAAATAACGCCAGAAATGGTGGAAAAAATAGCCTAAATAGGCTGATTCGATGTGTTTGCGGGAAAAAAATCGGCCCAGATCCGCGAAATTTTAATCAGCGAGTCAGCTTGGGAAGAAATGACCTGCTTATTCGCACCTTCC	NA	NA	NA	NA
>prophage 255
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3175242	3176223	5274107	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|3175242_3176223_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 256
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3192400	3195871	5274107		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_002916003.1|3192400_3193162_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
WP_002916001.1|3193457_3194879_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
WP_004149647.1|3194875_3195871_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
>prophage 257
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3201634	3202762	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_002915997.1|3201634_3202762_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 258
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3208476	3209478	5274107		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004229436.1|3208476_3209478_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.5	5.9e-27
>prophage 259
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3215465	3227383	5274107		Staphylococcus_phage(25.0%)	11	NA	NA
WP_002915977.1|3215465_3217625_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
WP_002915976.1|3217617_3218811_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_002915975.1|3218913_3219954_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_002915974.1|3220174_3220393_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_002915973.1|3220516_3221230_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
WP_004143967.1|3221293_3221989_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_004218186.1|3222074_3222218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002915936.1|3222671_3223202_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002915935.1|3223214_3225461_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
WP_002915934.1|3225706_3226582_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002915933.1|3226588_3227383_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
>prophage 260
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3232896	3235782	5274107		Hokovirus(100.0%)	1	NA	NA
WP_002915886.1|3232896_3235782_+	pitrilysin	NA	A0A1V0SH69	Hokovirus	22.1	2.2e-45
>prophage 261
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3239311	3244576	5274107		Brevibacillus_phage(50.0%)	4	NA	NA
WP_004188670.1|3239311_3241156_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
WP_002915873.1|3241213_3241534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004149616.1|3241763_3243095_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_002915870.1|3243322_3244576_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
>prophage 262
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3277227	3278052	5274107		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_002915614.1|3277227_3278052_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 263
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3282997	3285498	5274107	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_002915577.1|3282997_3283819_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
WP_004151086.1|3283861_3284293_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_002915551.1|3284292_3285498_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	4.4e-69
>prophage 264
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3297043	3297799	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_004142871.1|3297043_3297799_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 265
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3304203	3305226	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_004151072.1|3304203_3305226_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	33.0	1.3e-13
>prophage 266
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3315481	3316327	5274107		Vibrio_phage(100.0%)	1	NA	NA
WP_002915255.1|3315481_3316327_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 267
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3323741	3329207	5274107		Streptococcus_phage(33.33%)	3	NA	NA
WP_002915222.1|3323741_3324881_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
WP_004151066.1|3325038_3327789_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
WP_002915220.1|3327902_3329207_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.7e-34
>prophage 268
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3332749	3338086	5274107		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_002915214.1|3332749_3334387_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.8e-153
WP_002915213.1|3334468_3335767_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_002915212.1|3335830_3336940_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004149555.1|3337123_3337252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002915210.1|3337414_3338086_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
>prophage 269
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3346852	3348885	5274107		Hokovirus(50.0%)	2	NA	NA
WP_002915159.1|3346852_3348280_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.4e-34
WP_002915158.1|3348279_3348885_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
>prophage 270
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3351955	3358374	5274107		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
WP_002915109.1|3351955_3352717_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
WP_002915108.1|3352710_3353337_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
WP_002915107.1|3353462_3354599_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_002915106.1|3354756_3355749_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
WP_002915104.1|3355801_3356179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151062.1|3356175_3357378_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151061.1|3357486_3358374_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	2.5e-05
>prophage 271
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3361843	3367007	5274107		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_004151059.1|3361843_3364405_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
WP_002915096.1|3364673_3365021_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_004188736.1|3365005_3365455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002915094.1|3365466_3365949_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004151058.1|3366227_3367007_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	1.2e-11
>prophage 272
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3378751	3379573	5274107		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002915033.1|3378751_3379573_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 273
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3389938	3391339	5274107		Pandoravirus(100.0%)	1	NA	NA
WP_002914970.1|3389938_3391339_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 274
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3418280	3419246	5274107		Tetraselmis_virus(100.0%)	1	NA	NA
WP_002914818.1|3418280_3419246_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 275
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3424998	3433236	5274107	tRNA	Bodo_saltans_virus(20.0%)	8	NA	NA
WP_004217109.1|3424998_3425709_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	2.4e-06
WP_002914775.1|3425705_3426569_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002914773.1|3426576_3427455_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002914771.1|3427594_3428092_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	8.3e-30
WP_002914769.1|3428182_3429241_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_002914767.1|3429308_3429809_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002914765.1|3430059_3432687_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_000906486.1|3433050_3433236_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 276
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3447954	3453253	5274107		Bacillus_virus(25.0%)	5	NA	NA
WP_002914328.1|3447954_3449157_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
WP_002914327.1|3449513_3450476_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914325.1|3450486_3452628_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914321.1|3452600_3453011_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|3453007_3453253_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
>prophage 277
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3458434	3459337	5274107		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002914281.1|3458434_3459337_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 278
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3481495	3483016	5274107		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151026.1|3481495_3483016_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 279
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3497183	3497666	5274107		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002914164.1|3497183_3497666_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
>prophage 280
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3513013	3514084	5274107		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_002914114.1|3513013_3514084_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
>prophage 281
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3520874	3523448	5274107		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004150973.1|3520874_3523448_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
>prophage 282
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3529413	3530712	5274107		Burkholderia_virus(100.0%)	1	NA	NA
WP_002914097.1|3529413_3530712_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
>prophage 283
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3536019	3540555	5274107	tRNA	Streptomyces_phage(25.0%)	5	NA	NA
WP_002914091.1|3536019_3536445_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914089.1|3536648_3537734_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914088.1|3537791_3538481_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914084.1|3538794_3539178_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914082.1|3539223_3540555_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
>prophage 284
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3546324	3568392	5274107	tRNA	Bacillus_phage(25.0%)	19	NA	NA
WP_002914069.1|3546324_3548124_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
WP_002914067.1|3548139_3549114_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002914065.1|3549363_3550044_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914063.1|3550040_3550946_+	GTPase Era	NA	NA	NA	NA	NA
WP_002914062.1|3550957_3551695_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002914059.1|3551706_3552438_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004144351.1|3552437_3552818_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002914053.1|3552830_3553091_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	6.5e-18
WP_002914052.1|3553147_3553996_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914050.1|3554209_3554845_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_002914049.1|3554874_3555417_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
WP_002914046.1|3555413_3557030_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_004185139.1|3557205_3561093_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
WP_002914044.1|3561683_3563105_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
WP_002914033.1|3563134_3563821_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004149357.1|3563807_3565145_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
WP_002914032.1|3565210_3565549_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_002914028.1|3565622_3566813_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914027.1|3567138_3568392_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
>prophage 285
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3583639	3589960	5274107		Faustovirus(20.0%)	8	NA	NA
WP_002913992.1|3583639_3584854_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
WP_002913991.1|3584880_3585267_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_002913979.1|3585284_3585608_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913974.1|3585682_3586198_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004151987.1|3586213_3588064_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.9e-103
WP_002913956.1|3588065_3588401_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002913954.1|3588402_3588603_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002913953.1|3588673_3589960_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
>prophage 286
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3600472	3600904	5274107		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004144312.1|3600472_3600904_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 287
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3611224	3617849	5274107		Bodo_saltans_virus(33.33%)	4	NA	NA
WP_004151981.1|3611224_3612616_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|3612774_3614241_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|3614308_3615886_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004152009.1|3615980_3617849_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 288
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3621618	3621792	5274107		Escherichia_phage(100.0%)	1	NA	NA
WP_004174861.1|3621618_3621792_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
>prophage 289
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3628221	3629897	5274107		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_004152007.1|3628221_3628863_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913836.1|3628859_3629897_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
>prophage 290
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3633436	3636431	5274107	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_002913824.1|3633436_3634723_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|3634821_3635523_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|3635519_3636431_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
>prophage 291
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3643075	3643789	5274107		Cyanophage(100.0%)	1	NA	NA
WP_002913801.1|3643075_3643789_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 292
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3678688	3682265	5274107		Paenibacillus_phage(50.0%)	5	NA	NA
WP_002913639.1|3678688_3679561_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
WP_002913637.1|3679772_3680198_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_002913635.1|3680184_3680634_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_002913630.1|3680695_3681271_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_004145614.1|3681365_3682265_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
>prophage 293
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3685618	3687743	5274107		Planktothrix_phage(50.0%)	2	NA	NA
WP_002913623.1|3685618_3686713_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
WP_002913621.1|3686831_3687743_+	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.8e-52
>prophage 294
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3691351	3701278	5274107		Hokovirus(25.0%)	10	NA	NA
WP_002913506.1|3691351_3693079_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
WP_002913505.1|3693123_3693381_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_004218972.1|3693424_3693550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913498.1|3693761_3694733_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_002913495.1|3694909_3695671_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_004151995.1|3695901_3696963_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002913442.1|3697032_3699048_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	2.8e-145
WP_002913440.1|3699049_3699268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002913439.1|3699264_3700263_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_002913438.1|3700351_3701278_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
>prophage 295
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3715768	3718215	5274107		Clostridioides_phage(50.0%)	2	NA	NA
WP_004145587.1|3715768_3716521_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|3716517_3718215_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
>prophage 296
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3721485	3726068	5274107		Pandoravirus(25.0%)	5	NA	NA
WP_002913370.1|3721485_3721944_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
WP_002913369.1|3722076_3722985_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
WP_004188919.1|3722994_3723876_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_002913367.1|3724243_3724726_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_002913363.1|3725138_3726068_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.1	4.4e-133
>prophage 297
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3735183	3736269	5274107		Pandoravirus(100.0%)	1	NA	NA
WP_002913342.1|3735183_3736269_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 298
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3744751	3745888	5274107		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002913228.1|3744751_3745888_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
>prophage 299
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3752330	3753848	5274107		Mollivirus(100.0%)	1	NA	NA
WP_002913213.1|3752330_3753848_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 300
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3758139	3758913	5274107		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002913206.1|3758139_3758913_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 301
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3771315	3771915	5274107		Salmonella_phage(100.0%)	1	NA	NA
WP_002913188.1|3771315_3771915_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 302
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3799941	3800895	5274107	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_002913072.1|3799941_3800895_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.1	1.1e-67
>prophage 303
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3813061	3825192	5274107		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002913018.1|3813061_3814132_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
WP_002913017.1|3814595_3814850_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_004140835.1|3814849_3815980_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913016.1|3816081_3818367_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_002913014.1|3818711_3819440_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002913012.1|3819586_3822220_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	6.0e-95
WP_002913009.1|3822351_3825192_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
>prophage 304
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3829331	3832729	5274107		Enterobacteria_phage(50.0%)	3	NA	NA
WP_002913005.1|3829331_3830435_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.4	2.8e-118
WP_002913003.1|3830538_3831591_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_002913002.1|3831664_3832729_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	2.0e-17
>prophage 305
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3836649	3837810	5274107		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004151114.1|3836649_3837810_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	8.6e-78
>prophage 306
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3844175	3845183	5274107		Vibrio_phage(100.0%)	1	NA	NA
WP_004144267.1|3844175_3845183_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 307
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3849419	3855506	5274107		Vibrio_phage(33.33%)	5	NA	NA
WP_002912978.1|3849419_3851177_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
WP_002912977.1|3851324_3852044_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_039100470.1|3852040_3853237_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
WP_002912974.1|3853568_3853913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158534.1|3853916_3855506_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
>prophage 308
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3861261	3865573	5274107		Clostridioides_phage(50.0%)	4	NA	NA
WP_002912967.1|3861261_3861831_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
WP_002912965.1|3862257_3862971_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_039100471.1|3863008_3863986_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_039100472.1|3864106_3865573_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	5.4e-45
>prophage 309
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3873405	3874260	5274107		Catovirus(100.0%)	1	NA	NA
WP_002912937.1|3873405_3874260_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
>prophage 310
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3878658	3882565	5274107		Acinetobacter_phage(50.0%)	3	NA	NA
WP_023285372.1|3878658_3880632_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
WP_004151123.1|3880702_3881536_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004184878.1|3881896_3882565_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
>prophage 311
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3886328	3887849	5274107		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002912876.1|3886328_3887849_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 312
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3903870	3904425	5274107		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_039100481.1|3903870_3904425_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	2.3e-20
>prophage 313
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3910959	3918013	5274107	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
WP_039100484.1|3910959_3911907_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.2e-24
WP_004180609.1|3911890_3912628_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002912762.1|3912602_3912716_-	protein YohO	NA	NA	NA	NA	NA
WP_002912760.1|3912945_3914634_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	5.5e-259
WP_004144215.1|3914627_3915347_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002912756.1|3915394_3915865_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
WP_002912753.1|3915979_3918013_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
>prophage 314
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3925385	3930245	5274107		Tetraselmis_virus(100.0%)	3	NA	NA
WP_039100488.1|3925385_3927362_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.0	1.6e-161
WP_039100489.1|3927565_3928201_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_039100490.1|3928268_3930245_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.8	9.5e-162
>prophage 315
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3944794	3951240	5274107	tRNA,transposase	Bacillus_phage(60.0%)	5	NA	NA
WP_105329802.1|3944794_3946157_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	3.0e-74
WP_004151134.1|3946223_3947120_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|3947362_3948724_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_039111271.1|3949042_3949765_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|3949761_3951240_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 316
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3968360	3975430	5274107		Catovirus(25.0%)	5	NA	NA
WP_002912442.1|3968360_3969002_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
WP_004151145.1|3969092_3969674_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_039111277.1|3969704_3971552_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004151147.1|3972190_3973774_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_014599212.1|3974539_3975430_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	5.6e-45
>prophage 317
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	3988510	4014676	5274107		Cafeteria_roenbergensis_virus(14.29%)	22	NA	NA
WP_024193811.1|3988510_3989629_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	65.5	7.3e-135
WP_023286703.1|3989632_3990598_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	4.2e-86
WP_023286702.1|3990601_3991048_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_023286701.1|3991054_3992281_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
WP_023286700.1|3992318_3993947_+	hypothetical protein	NA	K9L8K6	Klebsiella_phage	43.9	4.2e-115
WP_014907233.1|3994120_3995527_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_000926396.1|3995763_3997179_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	8.9e-53
WP_023286699.1|3997201_3998572_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.0	1.9e-31
WP_023286698.1|3998735_3999902_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	2.7e-111
WP_023286697.1|4000094_4001102_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.5e-30
WP_004144151.1|4001667_4001790_-	small membrane protein	NA	NA	NA	NA	NA
WP_044531964.1|4001926_4002121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021440436.1|4002189_4003194_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.8	8.0e-32
WP_002912373.1|4004240_4005008_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004175264.1|4005007_4005748_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	25.7	3.0e-07
WP_019724801.1|4005763_4007659_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_021440433.1|4007674_4008829_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.5	6.5e-78
WP_023286696.1|4008825_4009719_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_074160401.1|4009719_4010862_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_039111287.1|4010955_4012164_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.1	5.7e-08
WP_039111289.1|4012233_4013694_-	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	43.4	5.5e-106
WP_105329806.1|4013695_4014676_-	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	34.8	5.8e-43
>prophage 318
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4021386	4022286	5274107		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002912152.1|4021386_4022286_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 319
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4026792	4033892	5274107		Streptococcus_phage(33.33%)	4	NA	NA
WP_002912106.1|4026792_4028895_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.8e-63
WP_039100205.1|4029118_4030543_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_004153104.1|4030723_4031887_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.6	2.2e-182
WP_004178082.1|4032404_4033892_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 320
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4049317	4050154	5274107		Mycobacterium_phage(100.0%)	1	NA	NA
WP_002911800.1|4049317_4050154_+	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 321
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4054127	4054346	5274107		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_002911792.1|4054127_4054346_+	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	2.5e-07
>prophage 322
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4060962	4061382	5274107		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000208713.1|4060962_4061382_-	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	33.3	9.2e-06
>prophage 323
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4072245	4079994	5274107	integrase	Erysipelothrix_phage(66.67%)	4	4076382:4076396	4085871:4085885
WP_004151473.1|4072245_4075206_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	38.1	1.9e-161
WP_004151472.1|4075215_4077066_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	38.4	9.4e-103
4076382:4076396	attL	TTTTAATGCCTCTGC	NA	NA	NA	NA
WP_004151471.1|4077259_4078648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151470.1|4078719_4079994_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.2	6.1e-69
4085871:4085885	attR	GCAGAGGCATTAAAA	NA	NA	NA	NA
>prophage 324
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4098434	4106878	5274107		Burkholderia_phage(40.0%)	9	NA	NA
WP_002911596.1|4098434_4099580_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004148893.1|4099971_4100238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151461.1|4100118_4100400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|4100442_4101150_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_164074078.1|4101226_4102627_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.9e-101
WP_002911592.1|4102607_4103102_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
WP_004151459.1|4103076_4103988_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|4104171_4105083_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_002911590.1|4105198_4106878_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 325
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4113479	4114232	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_004151455.1|4113479_4114232_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 326
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4130840	4132355	5274107		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_002911516.1|4130840_4132355_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 327
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4139293	4155840	5274107	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_004151452.1|4139293_4141027_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|4141262_4141832_+	VOC family protein	NA	NA	NA	NA	NA
WP_002911488.1|4141908_4142652_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_004151451.1|4142733_4143738_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|4143734_4144478_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|4144517_4144913_-	membrane protein	NA	NA	NA	NA	NA
WP_002911483.1|4144965_4145784_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_002911481.1|4145780_4146347_-	hydrolase	NA	NA	NA	NA	NA
WP_002911479.1|4146614_4148402_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_002911477.1|4148403_4148847_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002911459.1|4148874_4149615_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911456.1|4149649_4150171_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911454.1|4150250_4150862_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004148860.1|4150870_4151881_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_002911451.1|4151944_4152730_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_002911449.1|4152729_4153482_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
WP_039111299.1|4153560_4154505_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002911444.1|4154520_4155840_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
>prophage 328
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4159765	4161241	5274107		Cyanophage(100.0%)	1	NA	NA
WP_002911427.1|4159765_4161241_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 329
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4168666	4169635	5274107		Pseudoalteromonas_phage(50.0%)	2	NA	NA
WP_002911407.1|4168666_4169326_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
WP_002911406.1|4169404_4169635_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
>prophage 330
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4173357	4174011	5274107		Escherichia_phage(100.0%)	1	NA	NA
WP_023280291.1|4173357_4174011_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	1.4e-56
>prophage 331
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4181518	4183567	5274107		Moraxella_phage(100.0%)	1	NA	NA
WP_004145536.1|4181518_4183567_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.0e-86
>prophage 332
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4188803	4189013	5274107		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4188803_4189013_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 333
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4196453	4198013	5274107		Moraxella_phage(100.0%)	1	NA	NA
WP_004145524.1|4196453_4198013_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 334
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4201915	4209284	5274107	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_023286633.1|4201915_4203271_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	2.3e-42
WP_004145519.1|4203359_4203545_+	YoaH family protein	NA	NA	NA	NA	NA
WP_002910910.1|4203545_4203890_-	RidA family protein	NA	NA	NA	NA	NA
WP_039111305.1|4204021_4205932_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.8	3.2e-90
WP_004151443.1|4206077_4206773_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002910905.1|4206811_4207393_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_105329817.1|4207598_4209284_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	6.5e-34
>prophage 335
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4224909	4225521	5274107		Geobacillus_virus(100.0%)	1	NA	NA
WP_002910846.1|4224909_4225521_+	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 336
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4233255	4289752	5274107	plate,protease,transposase	Staphylococcus_phage(16.67%)	55	NA	NA
WP_002910830.1|4233255_4234002_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_032445203.1|4234441_4235428_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_039111307.1|4235420_4236221_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|4236258_4236381_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004219597.1|4236678_4236822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|4236998_4237940_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|4238033_4239023_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004200322.1|4239048_4240380_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_004145484.1|4240407_4241616_+	propionate kinase	NA	NA	NA	NA	NA
WP_039111309.1|4241644_4243939_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	4.4e-158
WP_004225356.1|4243990_4244137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189329.1|4244426_4245485_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|4245594_4246509_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_039111311.1|4246518_4247805_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|4247801_4248677_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|4248673_4249393_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|4249398_4250292_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044531958.1|4250575_4252219_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	4.4e-136
WP_002910717.1|4252268_4252745_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|4252843_4253770_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|4254073_4255369_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|4255380_4256190_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|4256164_4257064_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|4257173_4257656_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004219568.1|4257753_4258545_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	3.0e-05
WP_002910652.1|4258570_4259110_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|4259224_4259554_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004148795.1|4259724_4259886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910645.1|4260122_4261463_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|4261459_4262113_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|4262116_4263814_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|4266777_4268133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|4268133_4268643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|4268639_4269146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|4269240_4269393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|4269382_4269892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|4271497_4272466_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|4272607_4272790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|4272786_4273116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|4273112_4273619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199323.1|4275128_4275440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|4275461_4276355_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004217423.1|4276400_4276517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|4276538_4277432_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|4277457_4277586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910539.1|4277607_4278501_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|4278676_4279567_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|4279903_4280884_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_072093175.1|4281109_4281244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|4281504_4281690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|4281987_4282254_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|4282257_4283415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|4283398_4286809_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|4286942_4288706_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|4288735_4289752_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 337
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4297300	4300052	5274107		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004152259.1|4297300_4298980_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910407.1|4299104_4300052_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
>prophage 338
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4303264	4308978	5274107		Pseudomonas_phage(33.33%)	7	NA	NA
WP_002910403.1|4303264_4304347_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
WP_002910402.1|4304346_4305195_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002910397.1|4305194_4305587_+	SirB family protein	NA	NA	NA	NA	NA
WP_002910395.1|4305590_4306403_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002910393.1|4306442_4307297_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
WP_002910392.1|4307383_4308484_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_072093173.1|4308726_4308978_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	7.6e-08
>prophage 339
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4314489	4315278	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_004145418.1|4314489_4315278_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 340
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4331741	4333277	5274107		Escherichia_phage(100.0%)	1	NA	NA
WP_002910193.1|4331741_4333277_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 341
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4337290	4343560	5274107		Synechococcus_phage(25.0%)	8	NA	NA
WP_004151854.1|4337290_4338133_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
WP_002910109.1|4338175_4338634_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002910108.1|4338746_4339649_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_002910107.1|4339738_4340752_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
WP_002910105.1|4340949_4341852_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
WP_002910103.1|4341973_4342381_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004145401.1|4342803_4342935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910100.1|4342942_4343560_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
>prophage 342
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4351818	4354716	5274107		Planktothrix_phage(33.33%)	3	NA	NA
WP_004151853.1|4351818_4352832_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
WP_002910083.1|4352828_4353833_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
WP_002910080.1|4353888_4354716_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
>prophage 343
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4364373	4371542	5274107	tRNA	Tupanvirus(25.0%)	8	NA	NA
WP_002910026.1|4364373_4366302_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
WP_004189469.1|4366305_4366848_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_001124225.1|4366940_4367138_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|4367188_4367545_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|4367668_4367713_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002909105.1|4367851_4368835_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_002909101.1|4368850_4371238_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002909098.1|4371242_4371542_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
>prophage 344
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4378608	4386577	5274107		Brazilian_cedratvirus(25.0%)	8	NA	NA
WP_002909083.1|4378608_4379358_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	6.4e-10
WP_002909082.1|4379439_4379904_+	lipoprotein	NA	NA	NA	NA	NA
WP_002909081.1|4380017_4381460_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	5.1e-56
WP_002909070.1|4381489_4381717_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_002909064.1|4381824_4382871_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	46.6	2.3e-82
WP_002909061.1|4383025_4383859_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002909058.1|4384003_4384123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002909055.1|4384198_4386577_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
>prophage 345
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4396586	4397348	5274107		Indivirus(100.0%)	1	NA	NA
WP_002909000.1|4396586_4397348_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 346
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4411848	4412595	5274107		Indivirus(100.0%)	1	NA	NA
WP_002908876.1|4411848_4412595_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	3.0e-07
>prophage 347
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4424981	4425731	5274107		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004215276.1|4424981_4425731_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	8.1e-05
>prophage 348
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4433168	4435132	5274107		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_039111336.1|4433168_4434119_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.7	1.6e-34
WP_032423945.1|4434115_4435132_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	7.3e-41
>prophage 349
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4445782	4450295	5274107		Bacillus_virus(50.0%)	3	NA	NA
WP_002908439.1|4445782_4446556_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
WP_074194330.1|4446895_4448968_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_004184377.1|4449473_4450295_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 350
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4469813	4470884	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_032418860.1|4469813_4470884_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 351
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4476900	4477524	5274107		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004151165.1|4476900_4477524_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.8e-05
>prophage 352
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4485854	4486706	5274107		Staphylococcus_phage(100.0%)	1	NA	NA
WP_017879886.1|4485854_4486706_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.5	2.2e-51
>prophage 353
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4505223	4506054	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_002908132.1|4505223_4506054_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 354
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4520095	4522044	5274107		Planktothrix_phage(50.0%)	2	NA	NA
WP_004151191.1|4520095_4521067_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	1.1e-17
WP_004151192.1|4521063_4522044_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
>prophage 355
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4527228	4527999	5274107		Escherichia_phage(100.0%)	1	NA	NA
WP_002907813.1|4527228_4527999_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 356
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4533475	4545661	5274107	transposase	Burkholderia_virus(16.67%)	13	NA	NA
WP_002907799.1|4533475_4534360_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	1.5e-21
WP_002907798.1|4534957_4535176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227871.1|4535085_4535346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002907797.1|4535399_4535570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|4535781_4536762_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002907796.1|4537449_4538028_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.1	2.0e-19
WP_002907794.1|4538168_4538519_-	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_004151201.1|4538694_4540068_-	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_002907792.1|4540297_4540933_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
WP_002907788.1|4540969_4542118_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
WP_039100185.1|4542410_4543592_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002907780.1|4543704_4544709_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002907778.1|4544635_4545661_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
>prophage 357
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4548932	4549805	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_004151204.1|4548932_4549805_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 358
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4553992	4555480	5274107		Indivirus(50.0%)	2	NA	NA
WP_002907760.1|4553992_4554889_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	1.8e-06
WP_002907759.1|4554958_4555480_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	3.1e-51
>prophage 359
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4559286	4560648	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_004151205.1|4559286_4560648_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	6.9e-18
>prophage 360
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4563984	4565259	5274107	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_002907740.1|4563984_4565259_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 361
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4576513	4577884	5274107		Pandoravirus(100.0%)	1	NA	NA
WP_004151208.1|4576513_4577884_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.8e-67
>prophage 362
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4583435	4585487	5274107		Escherichia_phage(50.0%)	3	NA	NA
WP_002907640.1|4583435_4583963_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
WP_002907563.1|4584068_4584344_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_002907560.1|4584368_4585487_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.3	2.1e-33
>prophage 363
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4592310	4594951	5274107		Moumouvirus(100.0%)	2	NA	NA
WP_004151211.1|4592310_4593816_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.0	7.3e-29
WP_002907491.1|4593862_4594951_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.9	6.9e-05
>prophage 364
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4605377	4607339	5274107		Phage_TP(100.0%)	1	NA	NA
WP_002907469.1|4605377_4607339_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 365
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4614210	4615224	5274107		Mycoplasma_phage(100.0%)	1	NA	NA
WP_039100182.1|4614210_4615224_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 366
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4630946	4633052	5274107		Salmonella_phage(100.0%)	1	NA	NA
WP_164074083.1|4630946_4633052_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 367
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4644107	4644887	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_002906697.1|4644107_4644887_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 368
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4653320	4654025	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_004189827.1|4653320_4654025_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-31
>prophage 369
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4659306	4660851	5274107		Escherichia_phage(100.0%)	1	NA	NA
WP_002906546.1|4659306_4660851_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 370
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4666958	4668458	5274107		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004167624.1|4666958_4668458_+	efflux MFS transporter KmrA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	4.6e-31
>prophage 371
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4674937	4675711	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_004151234.1|4674937_4675711_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 372
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4686982	4688599	5274107		Planktothrix_phage(100.0%)	1	NA	NA
WP_004151237.1|4686982_4688599_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	2.1e-18
>prophage 373
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4692187	4696923	5274107		Tupanvirus(66.67%)	4	NA	NA
WP_002906221.1|4692187_4693198_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
WP_002906218.1|4693450_4694050_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
WP_004151239.1|4694217_4695171_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004170841.1|4695207_4696923_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.8	3.6e-32
>prophage 374
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4702772	4705109	5274107		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
WP_004151242.1|4702772_4703687_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.4e-83
WP_004143718.1|4704342_4704528_+	general stress protein	NA	NA	NA	NA	NA
WP_004143717.1|4704893_4705109_+	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
>prophage 375
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4709980	4711521	5274107	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000019473.1|4709980_4710961_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002906035.1|4711116_4711521_+	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 376
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4722105	4722786	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_002906011.1|4722105_4722786_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 377
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4739307	4741388	5274107		Bacillus_phage(100.0%)	2	NA	NA
WP_002905680.1|4739307_4740048_+	response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.9e-30
WP_004151887.1|4740044_4741388_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	5.2e-10
>prophage 378
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4745523	4749640	5274107		Klosneuvirus(50.0%)	4	NA	NA
WP_002905540.1|4745523_4746909_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
WP_002905537.1|4747215_4748151_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004151885.1|4748175_4748871_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002905535.1|4748911_4749640_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	2.1e-18
>prophage 379
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4755580	4756837	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_004169988.1|4755580_4756837_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.9	1.2e-19
>prophage 380
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4788032	4788770	5274107		Planktothrix_phage(100.0%)	1	NA	NA
WP_002905293.1|4788032_4788770_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 381
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4804372	4805425	5274107		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004151868.1|4804372_4805425_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 382
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4809089	4810058	5274107	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_022644641.1|4809089_4810058_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
>prophage 383
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4821164	4821911	5274107		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004198552.1|4821164_4821911_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.3e-15
>prophage 384
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4835359	4835878	5274107		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002904896.1|4835359_4835878_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	1.3e-25
>prophage 385
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4849941	4850715	5274107		Escherichia_phage(100.0%)	1	NA	NA
WP_002904861.1|4849941_4850715_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	2.0e-22
>prophage 386
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4858010	4859567	5274107		Catovirus(100.0%)	1	NA	NA
WP_002904845.1|4858010_4859567_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	1.5e-16
>prophage 387
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4866929	4868105	5274107		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904836.1|4866929_4868105_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	1.6e-39
>prophage 388
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4893895	4895275	5274107		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002904785.1|4893895_4895275_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.6	1.5e-17
>prophage 389
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4899132	4902730	5274107	transposase	Ralstonia_phage(50.0%)	2	NA	NA
WP_105329814.1|4899132_4899738_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	30.7	4.3e-12
WP_063434134.1|4899832_4902730_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	1.4e-182
>prophage 390
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4909438	4910230	5274107		Bacillus_virus(100.0%)	1	NA	NA
WP_002904635.1|4909438_4910230_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.0	7.2e-20
>prophage 391
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4923264	4924689	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_002904600.1|4923264_4924689_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	3.0e-16
>prophage 392
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4930085	4930847	5274107		Escherichia_phage(100.0%)	1	NA	NA
WP_002904489.1|4930085_4930847_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 393
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4942795	4943170	5274107		Streptococcus_phage(100.0%)	1	NA	NA
WP_002904397.1|4942795_4943170_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 394
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4946416	4947922	5274107		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004151618.1|4946416_4947115_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-15
WP_002904321.1|4947124_4947922_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
>prophage 395
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4952073	4967968	5274107		Escherichia_phage(70.0%)	16	NA	NA
WP_002904248.1|4952073_4953177_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
WP_002904247.1|4953325_4953724_-	rhodanese	NA	NA	NA	NA	NA
WP_004198831.1|4953791_4954889_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_004205985.1|4954857_4955073_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_002904139.1|4955125_4955566_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014343051.1|4955704_4955824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151614.1|4955820_4956885_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
WP_160463746.1|4958554_4960189_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004151612.1|4960243_4961509_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|4961539_4962628_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|4962714_4962975_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|4963272_4964133_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|4964153_4964915_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|4965175_4966078_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|4966089_4967355_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|4967347_4967968_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 396
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4971265	4972246	5274107	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019473.1|4971265_4972246_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 397
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4978311	4978986	5274107		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002903739.1|4978311_4978986_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.1	2.5e-82
>prophage 398
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	4984124	4995183	5274107		Escherichia_phage(57.14%)	12	NA	NA
WP_002903728.1|4984124_4984556_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
WP_002903726.1|4984820_4986284_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	7.8e-44
WP_002903724.1|4986537_4987821_-	MFS transporter	NA	NA	NA	NA	NA
WP_004219442.1|4987934_4988297_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.6e-22
WP_002903720.1|4988405_4988747_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_002903719.1|4988824_4989385_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_004219441.1|4989378_4990089_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_002903714.1|4990190_4990460_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_004884984.1|4990610_4993046_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	3.5e-214
WP_004152235.1|4993056_4993674_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_002903710.1|4993675_4994533_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
WP_004152236.1|4994574_4995183_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	3.2e-23
>prophage 399
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5012307	5013267	5274107		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|5012307_5013267_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 400
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5022710	5025488	5274107		Lactobacillus_phage(100.0%)	1	NA	NA
WP_004152245.1|5022710_5025488_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
>prophage 401
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5044833	5045349	5274107		Streptococcus_phage(100.0%)	1	NA	NA
WP_002903396.1|5044833_5045349_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 402
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5056592	5057894	5274107		Bacillus_phage(100.0%)	1	NA	NA
WP_004151564.1|5056592_5057894_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 403
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5070714	5074242	5274107		Salmonella_phage(50.0%)	6	NA	NA
WP_002903241.1|5070714_5070918_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	71.6	2.8e-21
WP_004151567.1|5070987_5071467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903236.1|5071703_5072057_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_002903234.1|5072160_5073369_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002903233.1|5073365_5073599_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_002903231.1|5073849_5074242_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	2.3e-19
>prophage 404
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5086416	5087622	5274107		Klosneuvirus(100.0%)	1	NA	NA
WP_004151572.1|5086416_5087622_-	acetylornithine/succinylornithine family transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.6e-21
>prophage 405
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5096308	5100946	5274107		Bacillus_phage(50.0%)	2	NA	NA
WP_004151576.1|5096308_5096983_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	4.6e-31
WP_004198150.1|5097043_5100946_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.0	8.4e-53
>prophage 406
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5127126	5128116	5274107		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002902515.1|5127126_5128116_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 407
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5133234	5140381	5274107	tRNA	Escherichia_phage(40.0%)	7	NA	NA
WP_002902433.1|5133234_5134389_+	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
WP_002902432.1|5134532_5134745_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004140161.1|5134826_5135261_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
WP_002902422.1|5135494_5136430_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_004151591.1|5136475_5137849_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_004148192.1|5138374_5139358_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_105329820.1|5139637_5140381_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	1.3e-15
>prophage 408
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5147988	5149002	5274107		Planktothrix_phage(100.0%)	1	NA	NA
WP_004152912.1|5147988_5149002_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 409
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5177928	5182954	5274107		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_004228410.1|5177928_5180298_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|5180299_5182954_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
>prophage 410
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5190380	5238164	5274107	integrase,transposase,terminase	Klebsiella_phage(32.0%)	72	5226349:5226363	5232358:5232372
WP_002902136.1|5190380_5190629_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|5190851_5191136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|5191240_5191450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|5191446_5192178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343022.1|5192188_5195212_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|5195267_5195465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|5195439_5195571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|5195691_5195856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152575.1|5196330_5197104_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|5197100_5198297_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|5198296_5198650_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|5198651_5199305_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|5199358_5199709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|5199961_5200147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|5200199_5200541_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|5200540_5201563_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|5201565_5201793_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|5201868_5202282_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|5202467_5204471_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|5204460_5204613_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|5204648_5205074_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|5205400_5206592_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|5206533_5206824_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|5206834_5207980_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|5207983_5208424_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|5208518_5208905_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|5208904_5209411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|5209407_5209827_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|5209795_5210077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|5210116_5211058_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|5211069_5211564_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|5211567_5212770_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|5212821_5213370_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|5213425_5214877_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|5215114_5216515_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|5216465_5216954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|5217319_5217640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|5217874_5218264_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|5218260_5218791_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|5218793_5219042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|5219059_5219188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|5219225_5219381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|5219447_5220230_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|5220226_5220703_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|5220699_5221662_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|5221663_5223322_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|5223898_5224120_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|5224217_5224886_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|5225056_5225371_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|5225363_5225552_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|5225925_5226087_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|5226079_5226334_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
5226349:5226363	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|5226401_5226524_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|5226520_5226946_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|5226942_5227137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|5227133_5227961_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|5228065_5228584_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|5228589_5229300_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|5229289_5229514_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|5229609_5229723_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|5229965_5230199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|5230271_5230418_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|5230377_5230620_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|5230600_5231782_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|5231978_5232527_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
5232358:5232372	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|5232725_5234258_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|5234474_5235236_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152143.1|5235344_5236259_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|5236559_5236748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004176440.1|5236818_5237109_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004218009.1|5237132_5237270_+	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
WP_004152141.1|5237294_5238164_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
>prophage 411
NZ_CP027146	Klebsiella pneumoniae strain AR_0363 chromosome, complete genome	5274107	5268169	5273184	5274107		Salmonella_phage(40.0%)	5	NA	NA
WP_002901815.1|5268169_5268841_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|5269027_5269855_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|5269930_5271196_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|5271197_5271617_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004178082.1|5271696_5273184_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 1
NZ_CP027152	Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence	208849	104226	160295	208849	bacteriocin,transposase,integrase	Stx2-converting_phage(18.75%)	47	133618:133631	160489:160502
WP_004178051.1|104226_106548_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|106549_106828_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|107168_107648_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|107968_108247_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|108463_108541_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|108533_109391_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_072093215.1|109441_109600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408758.1|109684_109819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029505403.1|110027_110237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093087.1|110837_113033_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|113029_114346_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152290.1|114349_116659_-	ATPase	NA	NA	NA	NA	NA
WP_003846917.1|118364_119618_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|119669_122744_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|122865_123948_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152284.1|124408_125419_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_071527925.1|125797_126040_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|126370_126664_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|126762_127530_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|127530_128487_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|128483_129482_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|129478_130381_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|130425_132750_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|132835_133789_-	fec operon regulator FecR	NA	NA	NA	NA	NA
133618:133631	attL	TGCGCAGGTTTTCA	NA	NA	NA	NA
WP_004118235.1|133785_134307_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_161989521.1|135268_135481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118231.1|135409_135577_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|135861_136989_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|136985_137579_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|137575_138424_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|138423_139344_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|139356_140961_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|141005_141953_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|141960_143694_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004152557.1|147516_147864_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|147860_148247_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|148794_149430_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|149426_150539_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|150531_151920_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_016197752.1|151919_152150_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|153127_153787_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|153987_154365_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|154431_157398_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|157400_157961_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|158086_158437_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|158639_159653_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|159797_160295_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
160489:160502	attR	TGCGCAGGTTTTCA	NA	NA	NA	NA
>prophage 1
NZ_CP027147	Klebsiella pneumoniae strain AR_0363 plasmid unnamed2	4223	122	4223	4223	tail	Salmonella_phage(75.0%)	8	NA	NA
WP_072196454.1|122_479_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
WP_021313115.1|484_1150_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_023279422.1|1469_2027_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	43.2	4.0e-33
WP_072271794.1|2087_2231_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	68.1	2.0e-13
WP_023279424.1|2223_2475_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	72.3	7.6e-24
WP_023279425.1|2477_3170_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.1	9.2e-120
WP_004109805.1|3183_3507_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_164074109.1|3597_4223_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	41.4	2.2e-32
>prophage 1
NZ_CP027150	Klebsiella pneumoniae strain AR_0363 plasmid unnamed3	65684	0	62677	65684	transposase,integrase	Escherichia_phage(34.62%)	59	4582:4596	54802:54816
WP_105329838.1|0_1241_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|1279_1948_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|1983_2220_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|2216_2579_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|2596_4291_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|4342_4765_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
4582:4596	attL	AGGCCAGCGCGGCAA	NA	NA	NA	NA
WP_072093211.1|4800_4926_-	mercury transporter	NA	NA	NA	NA	NA
WP_004152334.1|5657_6368_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|6441_6858_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|6854_7085_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072202616.1|7041_7503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|7646_7997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|8047_8791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|8787_9564_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_001143775.1|9835_12841_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001217881.1|13002_13560_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_063840280.1|13792_14347_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|14696_15401_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032409716.1|15983_16088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|16617_17484_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|17660_17930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|18344_19550_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000064119.1|19549_20524_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_001754953.1|20605_21877_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_000776034.1|21876_22308_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004178082.1|22713_24201_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_072196731.1|24193_24319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030005799.1|26770_27739_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	5.5e-179
WP_001039464.1|27878_28265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138014.1|29112_32079_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|32082_32643_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|32631_32799_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_000454193.1|32818_33169_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|33371_34385_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|34551_35394_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|35489_36098_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|36155_36947_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|37208_38468_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|38560_39352_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|39521_39854_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000019473.1|41047_42028_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_001354008.1|42352_42598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|42635_43499_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|43644_43884_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001067858.1|43956_44661_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001199192.1|44774_45551_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|45779_46805_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|47226_47979_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_004193160.1|49219_49438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152390.1|50036_50198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001445937.1|50224_51181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001404092.1|51265_51421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152391.1|51715_53431_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|53540_56570_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
54802:54816	attR	TTGCCGCGCTGGCCT	NA	NA	NA	NA
WP_004199214.1|56676_57702_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|57698_58478_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|58765_59647_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|59896_61216_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|61492_62677_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP027156	Klebsiella pneumoniae strain AR_0363 plasmid unnamed4	184525	142969	150573	184525		Escherichia_phage(33.33%)	13	NA	NA
WP_004197207.1|142969_143242_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_004197220.1|143325_143532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032451279.1|143833_144028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040222757.1|145264_145480_-	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	4.7e-14
WP_105329871.1|146177_146564_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	84.8	2.4e-16
WP_004197234.1|146980_147625_-	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_004197209.1|147621_147849_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
WP_004026413.1|148326_148515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065810717.1|148511_149009_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	57.0	2.0e-23
WP_004026415.1|149102_149321_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_065810716.1|149485_149737_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026416.1|149857_150172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087588306.1|150252_150573_-	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.9e-28
>prophage 1
NZ_CP027155	Klebsiella pneumoniae strain AR_0363 plasmid unnamed6	49000	7247	35949	49000	portal,tail,terminase	Salmonella_phage(97.14%)	39	NA	NA
WP_019704527.1|7247_7859_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_004109817.1|7846_8644_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_023279428.1|8636_9335_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	2.0e-122
WP_004109823.1|9421_9757_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
WP_023279429.1|9800_14336_-	tape measure protein	NA	J9Q712	Salmonella_phage	70.0	0.0e+00
WP_014342129.1|14343_14568_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_004109835.1|14693_15011_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_023279430.1|15072_15819_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	82.6	8.1e-106
WP_023279431.1|15886_16279_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	68.3	5.9e-47
WP_021313126.1|16280_16754_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|16744_17089_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_023279432.1|17186_18020_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	2.4e-130
WP_160552724.1|18019_18400_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.7	3.4e-52
WP_014342133.1|18337_18526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279434.1|18501_18930_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	70.6	1.8e-28
WP_004109857.1|19008_19887_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_023279435.1|19913_20813_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_164074117.1|20835_22410_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.5	1.1e-274
WP_004109863.1|22442_23699_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|23701_24343_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|24518_24785_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109872.1|24794_25685_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_023279436.1|25681_26233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279437.1|26222_26864_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.2	2.3e-109
WP_023279438.1|26860_27529_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
WP_023279439.1|27528_28233_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	1.4e-107
WP_023279440.1|28292_29852_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	93.1	3.1e-280
WP_004109887.1|29854_30130_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
WP_072274521.1|30180_30615_-	hypothetical protein	NA	A0A1V0E8D6	Vibrio_phage	37.0	9.5e-14
WP_014342147.1|30773_31304_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_123827665.1|31313_31613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109892.1|31937_32588_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_004109904.1|32638_32842_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_023279442.1|33434_33917_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.0	3.8e-64
WP_014342151.1|34122_34320_-	hypothetical protein	NA	J9Q753	Salmonella_phage	81.5	2.9e-26
WP_072196390.1|34530_34950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162565110.1|35057_35357_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.7	6.5e-30
WP_023279445.1|35505_35718_-	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
WP_023279446.1|35730_35949_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	80.6	1.1e-26
>prophage 2
NZ_CP027155	Klebsiella pneumoniae strain AR_0363 plasmid unnamed6	49000	40002	49000	49000		Salmonella_phage(100.0%)	12	NA	NA
WP_019704565.1|40002_40590_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_023279508.1|41162_41396_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	7.8e-31
WP_023279507.1|41593_42187_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
WP_023279506.1|42371_43205_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	5.1e-64
WP_023279505.1|43330_43888_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_023279504.1|43897_44317_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_023279503.1|44380_45025_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.6	4.7e-94
WP_072196936.1|45024_45495_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.4	5.4e-71
WP_072196937.1|45497_45893_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	75.6	5.2e-51
WP_023279500.1|45912_47016_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
WP_023279499.1|47209_48085_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	85.1	1.2e-140
WP_105329850.1|48162_49000_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	94.6	3.8e-152
>prophage 1
NZ_CP027149	Klebsiella pneumoniae strain AR_0363 plasmid unnamed8	33772	16314	33029	33772		Salmonella_phage(93.75%)	16	NA	NA
WP_023279485.1|16314_18594_+	hypothetical protein	NA	J9Q7G6	Salmonella_phage	61.9	1.0e-244
WP_019704545.1|18690_19923_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.6	1.3e-212
WP_023279486.1|20103_23622_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.3	0.0e+00
WP_023279487.1|23636_24062_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	82.3	2.8e-58
WP_023279488.1|24214_24430_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.5e-25
WP_023279489.1|24779_25211_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	90.9	3.1e-65
WP_023279490.1|25330_26338_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	87.6	2.3e-143
WP_023279491.1|26398_27343_+	hypothetical protein	NA	J9Q7S6	Salmonella_phage	93.0	3.1e-171
WP_023279492.1|27342_27609_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	83.0	1.9e-33
WP_162869883.1|27638_28688_+	recombinase	NA	J9Q736	Salmonella_phage	96.0	3.6e-192
WP_032414136.1|28858_29035_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	6.1e-12
WP_021313780.1|29396_29732_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	1.0e-36
WP_014342074.1|29731_29944_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_072198669.1|30395_31613_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	49.7	1.0e-73
WP_023279495.1|31814_32459_+	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	2.2e-99
WP_021313777.1|32534_33029_+	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
