The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	7991	14023	5539612		uncultured_Caudovirales_phage(83.33%)	6	NA	NA
WP_001116156.1|7991_8378_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_171910834.1|8916_10062_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.6	3.1e-165
WP_004199809.1|10072_10513_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|10516_10942_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152567.1|13120_13720_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|13795_14023_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
>prophage 2
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	247610	254039	5539612		Escherichia_phage(100.0%)	6	NA	NA
WP_002210516.1|247610_248231_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_171910849.1|248223_249489_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.5e-232
WP_004151610.1|249500_250403_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004176269.1|251445_252306_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|252603_252864_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|252950_254039_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
>prophage 3
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	1297220	1312480	5539612		Bacillus_phage(18.18%)	12	NA	NA
WP_012967600.1|1297220_1298603_-	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	25.8	4.2e-31
WP_004180506.1|1298625_1300041_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_004184806.1|1301118_1302123_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_004144151.1|1302523_1302646_+	small membrane protein	NA	NA	NA	NA	NA
WP_023278827.1|1303069_1304236_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	5.3e-112
WP_023278826.1|1304416_1304971_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.5e-51
WP_004189149.1|1304985_1305876_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_023278825.1|1305907_1306777_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_023278824.1|1306803_1307868_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	7.5e-105
WP_023288453.1|1308024_1309395_-	O9 family phosphomannomutase RfbK1	NA	A0A127AWJ1	Bacillus_phage	26.0	6.4e-32
WP_004180506.1|1309417_1310833_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_000043543.1|1311073_1312480_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 4
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	1356254	1363158	5539612	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_019705218.1|1356254_1357733_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|1357729_1358452_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|1358770_1360132_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|1360374_1361271_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004899467.1|1361510_1362284_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004180551.1|1362294_1363158_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 5
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	1700000	1740299	5539612	integrase,tail,terminase	Salmonella_phage(30.95%)	49	1731443:1731457	1742037:1742051
WP_060617789.1|1700000_1700297_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	62.8	9.0e-24
WP_071561468.1|1700395_1700548_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	85.7	1.9e-14
WP_004200533.1|1700582_1700879_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	94.8	4.4e-47
WP_060617788.1|1701077_1703552_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	86.9	0.0e+00
WP_060617787.1|1703555_1705358_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	77.1	2.0e-251
WP_060617786.1|1705354_1708168_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	92.6	0.0e+00
WP_032447858.1|1708178_1708718_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_060617785.1|1708717_1709182_-	hypothetical protein	NA	Q858G2	Salmonella_phage	80.5	5.8e-70
WP_060617784.1|1709181_1711659_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.2	0.0e+00
WP_060617783.1|1711658_1712264_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	1.1e-87
WP_060617782.1|1712263_1712587_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	3.1e-46
WP_004152442.1|1712637_1712979_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_060617781.1|1712989_1713427_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	89.7	1.5e-64
WP_060617780.1|1713478_1714465_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	87.2	8.7e-164
WP_060617779.1|1714482_1715184_-	peptidase	NA	G9L6C4	Escherichia_phage	85.4	5.9e-74
WP_060617778.1|1715186_1715483_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	77.6	3.5e-36
WP_060617777.1|1715479_1717153_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	90.3	9.5e-288
WP_060617776.1|1717167_1717374_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	83.8	4.3e-09
WP_060617775.1|1718129_1718498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131729179.1|1718629_1718893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060617773.1|1718994_1720470_-	hypothetical protein	NA	Q858H3	Salmonella_phage	92.7	5.4e-279
WP_032441400.1|1720466_1721051_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_032418540.1|1721128_1721386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1723368_1723707_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_032441458.1|1723699_1723903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050491799.1|1723902_1724523_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_029602865.1|1724519_1724813_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_072200041.1|1724812_1725280_-	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_032441402.1|1726213_1726405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060617721.1|1726388_1726799_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.6	7.3e-16
WP_060617722.1|1727615_1727969_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	70.7	1.3e-37
WP_032418532.1|1728088_1728874_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_023285446.1|1728870_1729638_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|1729637_1729847_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_023285447.1|1729993_1730227_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
WP_060617723.1|1730381_1730963_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.8e-64
WP_004164037.1|1731191_1731341_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_060617724.1|1731337_1731637_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	52.5	1.1e-18
1731443:1731457	attL	GCAATCAAGTTCCAT	NA	NA	NA	NA
WP_060617725.1|1731633_1732455_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	82.8	7.0e-135
WP_060596280.1|1732451_1733333_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.9	7.1e-133
WP_009485476.1|1733381_1733630_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	70.7	1.0e-28
WP_060617726.1|1733739_1734033_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_032439437.1|1734025_1734184_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	4.3e-17
WP_060617727.1|1734180_1734774_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	9.6e-110
WP_060617728.1|1734770_1735541_+	hypothetical protein	NA	D5LH17	Escherichia_phage	52.0	2.7e-64
WP_004200579.1|1735537_1735729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060617729.1|1735745_1736996_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	3.1e-206
WP_004151979.1|1737187_1738765_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|1738832_1740299_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1742037:1742051	attR	GCAATCAAGTTCCAT	NA	NA	NA	NA
>prophage 6
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	1813266	1944468	5539612	integrase,capsid,terminase,lysis,portal,head,tail,holin,plate,tRNA	Salmonella_phage(47.52%)	154	1907654:1907700	1946129:1946175
WP_029602978.1|1813266_1816329_-	kinase	NA	A0A286S259	Klebsiella_phage	93.8	0.0e+00
WP_004190616.1|1816325_1816706_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
WP_029602979.1|1816715_1817198_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.0	1.8e-82
WP_029602980.1|1817378_1817843_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.9e-58
WP_029602981.1|1817842_1821409_-|tail	phage tail length tape measure family protein	tail	K7PMB9	Enterobacterial_phage	29.7	7.4e-80
WP_029602982.1|1821504_1821867_-	membrane protein	NA	S4TR42	Salmonella_phage	72.4	2.3e-05
WP_050486020.1|1821912_1822410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602984.1|1822491_1823022_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	6.1e-63
WP_077255250.1|1823198_1823396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313117.1|1823533_1824016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602985.1|1824069_1825242_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	3.2e-24
WP_029602986.1|1825265_1825658_-	electron transfer flavoprotein subunit beta	NA	A0A059VK45	Pseudomonas_phage	34.6	2.4e-16
WP_134920973.1|1825654_1826206_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.8	8.6e-28
WP_029602988.1|1826207_1826591_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	5.4e-21
WP_029602989.1|1826592_1827003_-	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	40.4	6.0e-10
WP_032438199.1|1827006_1827273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602991.1|1827322_1828459_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	74.9	6.9e-157
WP_029602992.1|1828546_1829311_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.8	1.1e-78
WP_029602993.1|1829417_1830530_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.8	2.1e-110
WP_029602994.1|1830513_1831938_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.5	1.5e-193
WP_004146208.1|1831942_1833247_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	4.8e-146
WP_029602995.1|1833224_1834229_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.0	2.8e-37
WP_029602997.1|1834479_1834716_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.1	2.2e-17
WP_029602998.1|1835114_1835315_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	3.4e-19
WP_029602999.1|1835625_1835898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029497196.1|1836030_1836315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134920972.1|1836550_1836826_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	92.3	1.3e-08
WP_171910884.1|1836822_1837167_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	4.4e-38
WP_004184488.1|1837163_1837703_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_024940884.1|1837699_1837999_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_029602868.1|1838259_1839081_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.4e-98
WP_134920971.1|1839196_1839553_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	8.8e-42
WP_004892208.1|1839549_1839846_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
WP_029602867.1|1840054_1840651_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.6	1.9e-89
WP_071557491.1|1840685_1840934_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_004184503.1|1841039_1841273_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_040241897.1|1841648_1841876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032438203.1|1842041_1842293_-	hypothetical protein	NA	A0A2P1MXF0	Escherichia_phage	42.7	5.3e-09
WP_110570673.1|1842285_1842819_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	53.2	2.0e-42
WP_029602865.1|1842938_1843232_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_023328761.1|1843752_1843959_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	100.0	1.6e-32
WP_032438205.1|1843955_1844369_-	hypothetical protein	NA	T1SBJ7	Salmonella_phage	52.8	1.4e-19
WP_029602862.1|1844496_1845282_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	1.6e-64
WP_016160790.1|1845274_1845610_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	7.6e-11
WP_029602861.1|1845617_1846367_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	84.3	3.1e-121
WP_029602860.1|1846369_1847278_-	DNA-binding protein	NA	V5URT9	Shigella_phage	49.2	2.9e-89
WP_071826821.1|1847292_1847481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602859.1|1847825_1848389_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	44.1	3.6e-29
WP_029602858.1|1848391_1848622_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	85.9	3.2e-29
WP_029602857.1|1848725_1849112_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	92.9	1.0e-56
WP_032438209.1|1849238_1849649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602856.1|1849677_1849881_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	76.1	1.1e-20
WP_004179600.1|1850346_1850538_+	YebW family protein	NA	NA	NA	NA	NA
WP_023282477.1|1850546_1850702_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_029602855.1|1850839_1853938_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	57.6	6.0e-296
WP_029602854.1|1853950_1855039_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.0	1.4e-106
WP_029602853.1|1855073_1855757_+	hypothetical protein	NA	R9VWB9	Serratia_phage	64.3	6.2e-76
WP_012542038.1|1855753_1856062_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
WP_071557557.1|1856069_1856309_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
WP_023301228.1|1856345_1856621_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
WP_023301229.1|1856598_1857828_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.3e-238
WP_004144354.1|1858259_1858739_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_002914070.1|1858735_1859692_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_002914072.1|1859691_1860342_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_002914074.1|1860374_1860950_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_121980491.1|1860946_1861042_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_002914076.1|1861370_1862990_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_002914079.1|1862974_1863712_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004174811.1|1863843_1865169_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|1865214_1865598_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|1865910_1866600_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|1866657_1867743_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|1867946_1868372_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|1868441_1869140_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|1869174_1871826_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|1871946_1873302_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|1873343_1873667_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|1873670_1874969_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|1880926_1883500_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|1883629_1884361_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|1884357_1885338_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|1885469_1886207_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|1886477_1886813_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|1886919_1886967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|1887067_1888228_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|1888224_1889097_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|1889159_1890281_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|1890290_1891361_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|1891703_1892213_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|1892205_1893429_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|1893442_1893925_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|1893933_1895304_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|1895360_1895819_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|1895938_1896286_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|1896325_1897093_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|1897124_1897673_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|1897691_1897940_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|1898199_1899564_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|1899727_1900519_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|1900538_1901825_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|1901944_1902535_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|1902659_1903538_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|1903624_1905286_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|1905433_1905775_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|1905841_1906132_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|1906121_1906598_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|1906708_1907191_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1907654:1907700	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|1907794_1908172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|1908199_1908418_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|1908484_1909579_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|1909575_1910061_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_171910885.1|1910057_1912454_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_002896220.1|1912680_1912800_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|1912814_1913114_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|1913166_1913682_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|1913691_1914864_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|1915012_1916086_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|1916137_1917256_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|1917265_1919215_-	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|1919216_1919888_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|1919880_1920789_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|1920775_1921138_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|1921134_1921707_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|1921801_1922668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|1922690_1923137_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|1923129_1923552_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|1923514_1923673_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|1923647_1924076_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|1924072_1924456_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|1924460_1924970_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|1924950_1925166_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|1925169_1925373_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|1925372_1925837_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_134920983.1|1925932_1926586_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	79.5	7.2e-90
WP_004151003.1|1926589_1927642_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|1927658_1928492_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|1928632_1930396_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|1930395_1931439_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|1931495_1931765_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|1932286_1933288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1933287_1934367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|1934353_1935037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|1935132_1935366_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|1935377_1935566_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_060617653.1|1937636_1940021_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.8	0.0e+00
WP_004151013.1|1940017_1940869_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|1940865_1941093_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|1941092_1941326_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|1941393_1941732_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|1941695_1941896_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|1941903_1942413_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|1942445_1942688_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|1942810_1943440_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_060617654.1|1943442_1944468_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.5	7.3e-190
1946129:1946175	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 7
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	2664101	2712944	5539612	capsid,protease,terminase,portal,head,tail,tRNA	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|2664101_2664596_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|2664599_2665238_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|2665207_2665492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|2665549_2665942_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|2665957_2666386_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|2666651_2667779_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|2667969_2668368_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|2668541_2669909_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|2669996_2671055_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|2671191_2672130_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|2672544_2673015_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|2673390_2673654_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|2673752_2674019_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|2674069_2674345_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|2674424_2676392_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|2676397_2677330_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|2677337_2677541_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|2677672_2678602_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|2678637_2680083_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|2680171_2683969_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|2684006_2685476_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|2685478_2686060_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|2686067_2686556_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|2686555_2687548_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|2687618_2688662_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|2688967_2690908_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|2690987_2691179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|2691407_2692409_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|2692408_2693017_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|2693240_2693693_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|2693715_2694183_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|2694193_2695543_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|2695653_2695896_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|2695885_2697337_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|2697348_2698230_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|2698587_2699553_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|2699577_2699874_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|2700027_2700219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|2700221_2701883_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|2701866_2702223_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|2702353_2702506_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|2702498_2702942_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|2702941_2703241_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|2703237_2703573_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|2703569_2704811_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|2704812_2705373_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|2705424_2706591_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|2706854_2707367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|2707415_2707751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|2708093_2710229_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|2710228_2710594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|2710590_2710959_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|2710955_2711270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|2711262_2711451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|2711443_2711713_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|2712164_2712944_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 8
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	4278337	4289991	5539612	integrase	Enterobacteria_phage(70.0%)	13	4266472:4266486	4289528:4289542
4266472:4266486	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|4278337_4280671_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|4280682_4281003_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|4280999_4281227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072028197.1|4281223_4281775_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|4281777_4282044_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|4282585_4283323_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|4283319_4283565_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|4283582_4284149_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|4284717_4285143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|4285142_4286093_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|4286080_4287271_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|4287623_4288877_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|4288887_4289991_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4289528:4289542	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 9
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	4499549	4547204	5539612	tRNA,capsid,terminase,plate	Salmonella_phage(17.65%)	62	NA	NA
WP_004143010.1|4499549_4500935_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|4500980_4501193_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|4501194_4502061_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004151317.1|4503532_4503868_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|4503869_4504085_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|4504086_4504305_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_069135318.1|4504301_4505072_-	dcm methylase	NA	D5LH17	Escherichia_phage	52.4	8.5e-66
WP_039108983.1|4505068_4505596_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	3.8e-57
WP_064323882.1|4505624_4506248_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	59.7	5.3e-58
WP_023342707.1|4506244_4506991_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_100091652.1|4507007_4507292_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	80.9	8.6e-40
WP_004151303.1|4507380_4507575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171910920.1|4507567_4507726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065799713.1|4508012_4508216_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	68.7	1.0e-18
WP_064174666.1|4508253_4509111_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	40.6	2.2e-38
WP_032420811.1|4509513_4510224_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	71.4	2.9e-92
WP_001548452.1|4510328_4510520_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_038435002.1|4510599_4510884_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	56.2	1.3e-19
WP_004151298.1|4510918_4511065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040220032.1|4511057_4512143_+	replication protein	NA	E5AGE9	Erwinia_phage	45.6	1.2e-84
WP_058343155.1|4512139_4513513_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	64.2	5.2e-167
WP_058343166.1|4513517_4513817_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	55.8	1.1e-18
WP_064766632.1|4513813_4514326_+	hypothetical protein	NA	K7PKY4	Enterobacterial_phage	38.3	3.4e-18
WP_014342897.1|4514439_4514571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342898.1|4514563_4515238_+	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	63.0	7.8e-07
WP_041937862.1|4515237_4515756_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	2.3e-91
WP_014342899.1|4515752_4516706_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	42.8	2.5e-51
WP_004151288.1|4517206_4517662_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_023342724.1|4517661_4517832_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_134920947.1|4517824_4518463_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.8	2.9e-75
WP_041937861.1|4518459_4518639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342901.1|4518635_4518758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041937860.1|4518754_4519534_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	76.7	6.3e-101
WP_004146347.1|4520171_4520486_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_117090884.1|4520488_4520992_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	77.8	3.2e-74
WP_134920949.1|4520988_4521378_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	48.4	7.7e-23
WP_032444939.1|4521836_4522472_+	hypothetical protein	NA	I6S676	Salmonella_phage	82.1	4.2e-103
WP_043875689.1|4522502_4522988_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	78.3	1.8e-66
WP_040218288.1|4522989_4524666_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.4	1.8e-249
WP_134920950.1|4524666_4526187_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.8	2.2e-105
WP_171910921.1|4526239_4526929_+|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	53.5	1.6e-63
WP_134920951.1|4526991_4528809_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.5	6.9e-58
WP_065803132.1|4528810_4529293_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	50.3	5.9e-33
WP_019724831.1|4529292_4530330_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	1.9e-84
WP_134920952.1|4530331_4530658_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.6	1.3e-10
WP_012542596.1|4530657_4531101_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.3	1.8e-12
WP_012542595.1|4531103_4531667_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.9	3.7e-18
WP_029497286.1|4531663_4532032_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	1.2e-06
WP_104466756.1|4532013_4532565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171910922.1|4532568_4534050_+	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	35.0	2.1e-60
WP_004196864.1|4534049_4534493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134920953.1|4534674_4535232_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	85.3	1.7e-84
WP_134920962.1|4535311_4535788_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	7.2e-07
WP_134920954.1|4535992_4538005_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	54.4	6.1e-39
WP_134920955.1|4538008_4538848_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	31.4	1.3e-27
WP_019725008.1|4538849_4539155_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_134920956.1|4539151_4540021_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	28.3	8.8e-27
WP_134920957.1|4540010_4540601_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	1.1e-25
WP_134920958.1|4541055_4541412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101881433.1|4541419_4542652_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	51.0	2.3e-105
WP_134920959.1|4542644_4543232_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	42.9	2.9e-34
WP_134920960.1|4544624_4547204_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	63.1	1.2e-31
>prophage 10
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	4989700	5019833	5539612	integrase,capsid,terminase,lysis,portal,head,tail,plate	Salmonella_phage(86.67%)	36	4989608:4989626	5019906:5019924
4989608:4989626	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|4989700_4990681_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_001154434.1|4992754_4992943_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|4992953_4993187_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|4993301_4993979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|4994254_4995997_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|4996059_4997085_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|4997084_4998851_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|4998993_4999827_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|4999843_5000902_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|5000905_5001556_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|5001651_5002116_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|5002115_5002319_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|5002322_5002538_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|5002518_5003028_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|5003032_5003416_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|5003412_5003841_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|5003827_5003974_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|5003936_5004368_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|5004360_5004807_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|5004803_5005496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|5005590_5006163_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|5006159_5006522_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|5006508_5007417_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|5007409_5008009_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_019724930.1|5010227_5010962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171482189.1|5011322_5011697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|5011693_5011897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171910931.1|5011926_5013003_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|5013141_5014314_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|5014323_5014839_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|5014891_5015191_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|5015205_5015325_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_014342962.1|5015550_5017944_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896224.1|5017940_5018426_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|5018422_5019523_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|5019614_5019833_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
5019906:5019924	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 11
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	5054245	5063710	5539612	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|5054245_5055361_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|5055357_5057298_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|5057374_5057596_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|5057921_5058239_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|5058269_5060549_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|5060670_5060889_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|5061242_5061944_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|5061988_5063710_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 12
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	5163072	5185530	5539612	head,integrase,tail	Pectobacterium_phage(25.0%)	34	5161975:5161989	5194626:5194640
5161975:5161989	attL	TCAGTTTGCGCAGTT	NA	NA	NA	NA
WP_029602741.1|5163072_5164101_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	3.4e-94
WP_004191087.1|5164104_5164329_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	66.7	5.9e-20
WP_025712917.1|5164538_5164724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025712916.1|5164725_5165292_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	3.3e-51
WP_060617682.1|5165291_5167433_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.3	3.5e-101
WP_060617681.1|5167465_5167756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077260001.1|5167799_5168033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025712912.1|5169006_5169393_-	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	57.8	3.4e-15
WP_022644596.1|5169473_5169668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644597.1|5169728_5170175_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
WP_046387639.1|5170258_5170417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060617680.1|5170419_5171412_+	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	55.5	2.6e-30
WP_048293424.1|5171408_5172797_+	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.2	1.7e-104
WP_060617679.1|5172835_5173486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191074.1|5173489_5173723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602733.1|5173762_5174548_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.4	1.5e-62
WP_029602732.1|5174675_5175266_+	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	83.4	2.5e-94
WP_004141582.1|5175268_5175499_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	5.0e-06
WP_029602730.1|5176171_5176486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602729.1|5176478_5176817_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	81.1	3.6e-45
WP_029602728.1|5176998_5177190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199500.1|5177258_5177852_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.1	7.2e-81
WP_072002479.1|5177841_5178165_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	54.7	2.3e-25
WP_023316634.1|5178152_5178509_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_029602726.1|5178505_5178799_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	9.8e-31
WP_004199520.1|5178867_5179101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023316637.1|5179084_5179345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060617678.1|5179351_5179804_+	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	3.2e-49
WP_060617677.1|5179888_5181283_+	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	6.9e-58
WP_060617676.1|5181282_5182947_+|head,tail	head-tail connector protein	head,tail	A0A221SAN2	Ralstonia_phage	39.3	2.0e-104
WP_029503969.1|5182949_5183273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060617675.1|5183259_5184012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191051.1|5184022_5185018_+	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_004191050.1|5185056_5185530_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
5194626:5194640	attR	TCAGTTTGCGCAGTT	NA	NA	NA	NA
>prophage 13
NZ_CP053364	Klebsiella pneumoniae strain BA2275 chromosome, complete genome	5539612	5190535	5201095	5539612	holin	Salmonella_phage(50.0%)	9	NA	NA
WP_060617670.1|5190535_5193043_+	transglycosylase SLT domain-containing protein	NA	Q775D3	Bordetella_phage	27.1	3.5e-28
WP_060617669.1|5193042_5194884_+	hypothetical protein	NA	Q858F9	Salmonella_phage	32.6	8.0e-78
WP_060617668.1|5194883_5197601_+	hypothetical protein	NA	Q858F8	Salmonella_phage	51.0	1.4e-259
WP_060617667.1|5197597_5197906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060617666.1|5197945_5198158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064764910.1|5198353_5199604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060617664.1|5199811_5200027_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	61.0	1.1e-12
WP_004199518.1|5200028_5200568_+	lysozyme	NA	H6WRZ4	Salmonella_phage	78.7	4.5e-82
WP_060617663.1|5200564_5201095_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	49.7	1.6e-34
>prophage 1
NZ_CP053365	Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence	329160	17209	73933	329160	transposase,integrase	Stx2-converting_phage(22.22%)	51	50693:50708	76981:76996
WP_000427623.1|17209_18214_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_071527925.1|18511_18754_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|19084_19378_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|19476_20244_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|20244_21201_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|21197_22196_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|22192_23095_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|23139_25464_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|25549_26503_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|26499_27021_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004118231.1|28123_28291_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|28575_29703_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|29699_30293_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|30289_31138_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|31137_32058_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|32070_33675_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|33719_34667_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004230378.1|35504_36407_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	3.6e-15
WP_171910942.1|38642_40181_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	3.6e-273
WP_004152557.1|40230_40578_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|40574_40961_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|41508_42144_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|42140_43253_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|43245_44634_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000333416.1|44633_44906_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_001166628.1|46582_47038_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|47109_47475_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|47490_47766_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|47793_48219_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|48257_49943_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|49960_50326_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|50322_50559_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000993245.1|50624_50837_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
50693:50708	attL	CGATGCCGCCTTCACC	NA	NA	NA	NA
WP_010791757.1|50995_52678_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_000393453.1|52680_53589_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000801210.1|53585_54803_+	TniQ family protein	NA	NA	NA	NA	NA
WP_000412211.1|56486_57146_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|57346_57724_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138073.1|59115_62088_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|62090_62648_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|62954_63968_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_032488579.1|64198_64753_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000679427.1|64921_65269_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|65262_66102_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376617.1|66229_66472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183923.1|66555_66855_-	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_016479969.1|66968_67139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201046.1|68364_69018_+	endonuclease III	NA	NA	NA	NA	NA
WP_000855769.1|69115_69961_-	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_014386410.1|71090_71870_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
WP_000019445.1|72952_73933_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
76981:76996	attR	GGTGAAGGCGGCATCG	NA	NA	NA	NA
>prophage 2
NZ_CP053365	Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence	329160	160358	226659	329160	transposase	Escherichia_phage(20.0%)	45	NA	NA
WP_000608644.1|160358_161621_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015058212.1|161944_163090_+	class C beta-lactamase CMY-6	NA	NA	NA	NA	NA
WP_001221666.1|163183_163717_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000118520.1|163713_164031_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000606835.1|164758_170245_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_001259346.1|170393_171101_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000637384.1|171097_173545_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000351984.1|173559_173877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010740.1|173873_174404_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_001447719.1|174366_175632_+	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_000575345.1|175628_176300_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000983282.1|176296_177304_+	TraU family protein	NA	NA	NA	NA	NA
WP_001447718.1|177407_180215_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_171910943.1|181010_182201_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.1	1.9e-48
WP_134921023.1|182205_182418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796664.1|182540_183182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547566.1|183475_183796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186917.1|184099_184285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085160.1|184504_185473_+	CbbQ/NirQ/NorQ C-terminal domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	1.2e-29
WP_000739139.1|185483_186392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000987165.1|186452_186983_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_001282585.1|187077_188067_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000706865.1|188129_189140_+	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_000170087.1|189339_190617_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_000122922.1|191458_193186_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|193172_193451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714163.1|193523_193745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427620.1|193926_194931_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|195158_196364_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|196374_196680_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|196906_197671_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|198163_198748_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|198747_199986_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|199982_200888_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_014386481.1|209160_209805_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_134890811.1|213093_213567_+	trimethoprim-resistant dihydrofolate reductase DfrA	NA	G3MBI7	Bacillus_virus	28.3	3.5e-14
WP_001144737.1|213787_214054_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004098817.1|215220_216435_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|216468_217872_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|218283_218490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749966.1|218494_219136_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_032433963.1|219191_219515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|221657_222362_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_060617735.1|224689_225040_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	8.9e-39
WP_015632444.1|225069_226659_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.1	1.9e-189
>prophage 1
NZ_CP053366	Klebsiella pneumoniae strain BA2275 plasmid p2, complete sequence	40446	0	4031	40446	integrase	Klebsiella_phage(57.14%)	8	467:480	6339:6352
WP_004152153.1|314_833_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
467:480	attL	CTGGTTACTGGCTG	NA	NA	NA	NA
WP_004154298.1|838_1549_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|1538_1763_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|1759_1972_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_014343018.1|2214_2448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|2520_2667_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|2626_2869_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|2849_4031_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
6339:6352	attR	CAGCCAGTAACCAG	NA	NA	NA	NA
>prophage 2
NZ_CP053366	Klebsiella pneumoniae strain BA2275 plasmid p2, complete sequence	40446	12306	39641	40446	terminase,holin	uncultured_Caudovirales_phage(36.36%)	37	NA	NA
WP_004152573.1|12306_12660_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|12661_13315_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|13368_13935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|13977_14160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|14209_14551_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|14550_15573_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|15575_15803_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152567.1|15878_16478_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152565.1|18469_18622_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|18657_19083_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_171910950.1|19086_19233_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.1	1.3e-15
WP_004152177.1|19533_20679_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|20682_21123_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|21217_21604_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000113538.1|22105_22525_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|22493_22775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528476.1|23766_24261_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|24264_25467_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_171910951.1|25518_26040_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.5	5.4e-48
WP_004152172.1|27809_29210_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|29160_29649_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	38.6	1.9e-10
WP_004152170.1|30014_30335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|30569_30959_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|30955_31486_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|31488_31737_-|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	41.8	2.7e-05
WP_004152167.1|32142_32925_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|32921_33398_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|33394_34357_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_072200049.1|34358_36017_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	95.8	0.0e+00
WP_004152162.1|36593_36815_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|36912_37581_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|37751_38066_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|38058_38247_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|38416_38782_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|38774_39029_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|39000_39219_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|39215_39641_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
