The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020008	Haemophilus influenzae strain 5P28H1 chromosome, complete genome	1886450	373150	441107	1886450	portal,terminase,tail,holin,tRNA	Haemophilus_phage(13.16%)	79	NA	NA
WP_005666644.1|373150_373891_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005632159.1|373975_374320_+	YggL family protein	NA	NA	NA	NA	NA
WP_005666641.1|374525_375056_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_005656333.1|375048_375330_+	chaperone NapD	NA	NA	NA	NA	NA
WP_041174733.1|375366_377850_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_005666637.1|377903_378743_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_011271996.1|378742_379606_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_005691774.1|379602_380055_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_005649107.1|380069_380672_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_005649108.1|380831_381476_-	adenylate kinase	NA	NA	NA	NA	NA
WP_011271997.1|381560_382838_-	MFS transporter	NA	NA	NA	NA	NA
WP_042599468.1|382979_383996_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	2.1e-88
WP_105182546.1|384168_385101_-	CMP-Neu5Ac--lipooligosaccharide alpha 2-3 sialyltransferase	NA	NA	NA	NA	NA
WP_005688947.1|385513_386236_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.5	1.5e-27
WP_005649115.1|386232_386970_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	24.5	2.8e-10
WP_011961725.1|386991_387936_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005654829.1|387945_388593_+	thiaminase II	NA	NA	NA	NA	NA
WP_005654831.1|388692_389508_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005654833.1|389500_390349_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005654835.1|390352_391273_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.4	1.0e-17
WP_105182547.1|391272_392154_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005659920.1|392519_393398_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_080316047.1|393623_394796_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_042611895.1|394896_395436_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_042611894.1|395507_396419_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011272008.1|396427_397534_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_038440737.1|397543_398815_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SLE3	Klosneuvirus	26.2	2.0e-27
WP_011272010.1|398832_399447_+	YfgM family protein	NA	NA	NA	NA	NA
WP_005659903.1|399497_399692_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005656373.1|399691_400033_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_011272011.1|400072_401932_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.3	2.3e-109
WP_005669116.1|401949_402636_-	DUF2625 domain-containing protein	NA	NA	NA	NA	NA
WP_011272012.1|402686_403211_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005649164.1|403223_403547_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	4.4e-24
WP_005691745.1|403604_404021_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	80.6	2.0e-53
WP_005649169.1|404044_405259_-	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.5	1.5e-32
WP_005654871.1|405325_405778_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_105182548.1|405830_406556_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_013525579.1|407204_407663_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.8	4.9e-45
WP_042611893.1|407659_408262_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	94.0	3.0e-98
WP_084999867.1|408273_409896_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	67.4	6.3e-220
WP_084999855.1|410092_413743_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	37.4	2.0e-141
WP_080291956.1|413746_414466_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	40.2	6.1e-34
WP_042611836.1|414404_415112_-	C40 family peptidase	NA	A0A1B1IV85	uncultured_Mediterranean_phage	43.2	3.4e-53
WP_084999857.1|415113_415764_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	39.6	5.5e-34
WP_038440720.1|415807_416326_-	antirepressor	NA	Q0H8C7	Salmonella_phage	52.8	1.3e-33
WP_105182549.1|416742_417621_-	phage repressor protein/antirepressor Ant	NA	D0UIK6	Aggregatibacter_phage	78.4	4.7e-129
WP_042594865.1|418116_418656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038440713.1|419401_419734_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	38.5	2.7e-16
WP_042611832.1|419742_423135_-	tape measure protein	NA	A0A2P1CKJ3	Pantoea_phage	23.5	1.8e-35
WP_101494098.1|423186_423423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651224.1|423438_423741_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015701504.1|423724_424108_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_038440708.1|424176_424401_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_038440705.1|424445_424853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038440702.1|425127_425778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651206.1|425780_426191_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_042593432.1|426208_426730_-|tail	tail protein	tail	K7PKQ5	Enterobacteria_phage	50.0	2.6e-18
WP_042611831.1|426732_427044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593431.1|427024_427348_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_105182746.1|427426_429454_-	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	56.7	4.8e-201
WP_005668565.1|429404_430928_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	57.7	2.7e-156
WP_005633930.1|430931_431150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042611829.1|431146_433270_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	66.8	1.7e-273
WP_048950255.1|433272_433746_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	53.6	4.9e-40
WP_042593427.1|434019_434301_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	75.6	1.9e-31
WP_042593426.1|434212_434536_-	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	54.6	7.8e-21
WP_042593425.1|434528_435131_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	53.4	3.7e-56
WP_042593424.1|435099_435456_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_042593423.1|435695_436214_-	antitermination protein	NA	G8C7V7	Escherichia_phage	33.3	7.6e-18
WP_042593422.1|436214_436760_-	NinG recombination protein	NA	D0UIK8	Aggregatibacter_phage	69.1	1.7e-60
WP_042593421.1|436852_437269_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	85.4	9.6e-64
WP_005633909.1|437305_437530_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_042593364.1|437526_438162_-	replication P	NA	A0A1I9KFB0	Aeromonas_phage	25.5	9.0e-05
WP_042611846.1|438146_438905_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	67.3	1.6e-61
WP_042611845.1|438901_439576_-	antirepressor	NA	D0UIL6	Aggregatibacter_phage	55.1	4.2e-61
WP_005671478.1|439624_440065_-	hypothetical protein	NA	A0A0U4B0E3	Pseudomonas_phage	32.6	8.1e-13
WP_005662314.1|440113_440320_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	67.7	1.9e-17
WP_042611844.1|440450_441107_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	58.4	7.2e-66
>prophage 2
NZ_CP020008	Haemophilus influenzae strain 5P28H1 chromosome, complete genome	1886450	445123	453313	1886450	integrase	Mannheimia_phage(42.86%)	14	439620:439634	456307:456321
439620:439634	attL	TTTTTTTATTTCTTG	NA	NA	NA	NA
WP_105182550.1|445123_445975_+	hypothetical protein	NA	D0UIK6	Aggregatibacter_phage	42.1	3.1e-53
WP_105182551.1|446058_446406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105182552.1|446402_446696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053521080.1|446707_447628_+	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	70.9	4.1e-115
WP_042611920.1|447602_448253_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	72.5	4.8e-86
WP_013525617.1|448252_448687_+	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	7.5e-19
WP_005688799.1|448788_449358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005688797.1|449354_449591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005647194.1|449587_449947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042611919.1|449954_451118_+	DNA cytosine methyltransferase	NA	A0A2I7RFJ9	Vibrio_phage	46.1	1.5e-90
WP_105182553.1|451136_451658_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	42.0	1.6e-23
WP_005668273.1|451661_451949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005651299.1|452075_452390_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005641600.1|452287_453313_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	35.4	7.4e-57
456307:456321	attR	TTTTTTTATTTCTTG	NA	NA	NA	NA
>prophage 3
NZ_CP020008	Haemophilus influenzae strain 5P28H1 chromosome, complete genome	1886450	635165	642887	1886450	transposase	Macacine_betaherpesvirus(42.86%)	9	NA	NA
WP_005649541.1|635165_636158_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.9	2.0e-51
WP_105182582.1|636220_636574_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	58.3	1.5e-30
WP_105182583.1|637172_638036_+	FkbM family methyltransferase	NA	A0A218MM68	uncultured_virus	28.2	9.1e-16
WP_105182584.1|638040_638148_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	65.6	3.3e-05
WP_105197411.1|638151_638253_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	71.9	2.8e-06
WP_042593284.1|638476_638830_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	34.5	1.2e-06
WP_005657931.1|638920_639595_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_042593283.1|639640_640315_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_005690204.1|640466_642887_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	8.5e-120
>prophage 4
NZ_CP020008	Haemophilus influenzae strain 5P28H1 chromosome, complete genome	1886450	1286449	1294958	1886450		Planktothrix_phage(16.67%)	8	NA	NA
WP_038441344.1|1286449_1287433_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.4e-20
WP_005694258.1|1287435_1288428_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.0e-14
WP_005653671.1|1288437_1289325_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_105182749.1|1289339_1290311_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_080317064.1|1290430_1292614_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.7	3.9e-116
WP_005686506.1|1293220_1293856_-	7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	30.3	8.7e-16
WP_011272433.1|1293856_1294282_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.0	2.3e-20
WP_011272434.1|1294274_1294958_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.7	2.3e-54
>prophage 5
NZ_CP020008	Haemophilus influenzae strain 5P28H1 chromosome, complete genome	1886450	1459628	1522381	1886450	portal,head,terminase,protease,tail,plate,integrase,capsid,tRNA	Mannheimia_phage(53.12%)	70	1471358:1471381	1537911:1537934
WP_011961904.1|1459628_1461599_+|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_011272700.1|1461595_1461769_+	DUF5363 domain-containing protein	NA	NA	NA	NA	NA
WP_105182703.1|1461870_1465311_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011272698.1|1465363_1466755_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	7.2e-23
WP_005694317.1|1466948_1467839_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011272697.1|1467831_1469145_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_005689857.1|1469432_1470113_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_005689855.1|1470270_1471347_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
1471358:1471381	attL	AAAAGTGCGGTGAAATTTCACCGC	NA	NA	NA	NA
WP_005689853.1|1471401_1474044_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	32.3	2.1e-103
WP_005687300.1|1474209_1475973_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_048942349.1|1476109_1476502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687296.1|1476821_1477628_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005659609.1|1477679_1478381_+	hydroxyacylglutathione hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	29.1	3.3e-08
WP_005659606.1|1478424_1479285_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_042593951.1|1479397_1481446_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9V939	Bandra_megavirus	29.3	2.2e-60
WP_042593952.1|1481596_1482709_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_042593953.1|1482755_1483418_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_080316015.1|1483522_1484206_+	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_154231901.1|1484277_1484433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011272688.1|1484914_1485925_-|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	60.4	1.8e-116
WP_038441084.1|1485934_1487716_-|terminase	terminase	terminase	A0A0M3LRV4	Mannheimia_phage	65.4	5.0e-218
WP_011272686.1|1487880_1488696_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	60.5	6.9e-66
WP_042593955.1|1488716_1489766_+|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	51.3	1.7e-88
WP_011272685.1|1489777_1490428_+|terminase	terminase	terminase	Q19US0	Mannheimia_phage	46.0	4.1e-45
WP_005668469.1|1490721_1491228_+|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	51.0	2.8e-33
WP_005668467.1|1491227_1491437_+|tail	tail protein	tail	NA	NA	NA	NA
WP_005668464.1|1491438_1491660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668462.1|1491652_1492171_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	46.6	9.5e-37
WP_011272684.1|1492155_1492506_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_105182705.1|1492680_1492950_+	molecular chaperone DnaK	NA	A0A0M3LS11	Mannheimia_phage	37.4	7.7e-06
WP_038441087.1|1492946_1493210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038441089.1|1493175_1493646_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	45.3	7.3e-28
WP_011272680.1|1493645_1494107_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	48.2	5.7e-25
WP_005653079.1|1494107_1494455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011272679.1|1494558_1494741_+	hypothetical protein	NA	Q19UR2	Mannheimia_phage	47.8	8.8e-06
WP_011272678.1|1494751_1495090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075913143.1|1495165_1495339_+	hypothetical protein	NA	Q19UR2	Mannheimia_phage	53.3	3.2e-05
WP_042593957.1|1495316_1495577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995348.1|1498674_1499127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011272674.1|1499224_1499782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005653088.1|1499790_1500219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668437.1|1500322_1500922_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	66.0	7.1e-44
WP_005689801.1|1500923_1501262_+	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	56.6	4.5e-19
WP_105182706.1|1501258_1502173_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	58.6	1.3e-92
WP_005689797.1|1502162_1502699_+|tail	phage tail protein I	tail	M1T2R2	Escherichia_phage	53.1	7.0e-51
WP_105182707.1|1502707_1505233_+|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	65.5	8.0e-246
WP_105182708.1|1505244_1505847_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	86.0	3.6e-88
WP_042593888.1|1506105_1507290_+|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	48.2	2.3e-102
WP_005655097.1|1507293_1507800_+|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	59.5	5.4e-53
WP_005655095.1|1507865_1508165_+|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	42.9	1.2e-12
WP_005633772.1|1508164_1508311_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	65.0	2.2e-07
WP_042593889.1|1508639_1509077_+|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	57.3	9.1e-41
WP_075913145.1|1509076_1510297_+	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	57.7	7.0e-123
WP_005672606.1|1510314_1510704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593891.1|1510763_1512524_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_042593892.1|1512768_1513530_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_089503506.1|1513534_1514185_-	transcriptional regulator	NA	Q76H56	Enterobacteria_phage	36.1	5.8e-23
WP_042593894.1|1514353_1514773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005642278.1|1514835_1515078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593895.1|1515115_1515409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593896.1|1515861_1516218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593897.1|1516410_1516698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593898.1|1516789_1517053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593899.1|1517070_1517451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005663359.1|1517454_1517697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005663355.1|1517821_1518130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042599665.1|1518139_1520326_+	replication endonuclease	NA	Q94N00	Haemophilus_virus	42.7	5.4e-166
WP_042593902.1|1520380_1520902_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	42.4	4.3e-29
WP_005652916.1|1520901_1521069_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042593903.1|1521049_1522381_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	33.0	9.3e-44
1537911:1537934	attR	AAAAGTGCGGTGAAATTTCACCGC	NA	NA	NA	NA
>prophage 6
NZ_CP020008	Haemophilus influenzae strain 5P28H1 chromosome, complete genome	1886450	1607452	1619533	1886450	tRNA	Acinetobacter_phage(42.86%)	11	NA	NA
WP_080003751.1|1607452_1608457_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A222YW41	Synechococcus_phage	40.5	9.1e-52
WP_005650594.1|1608974_1609463_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_042599499.1|1609478_1609976_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_042599515.1|1610261_1611026_+	glycosyltransferase	NA	A7IW34	Paramecium_bursaria_Chlorella_virus	29.1	1.2e-14
WP_105182719.1|1611127_1612684_+	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	32.1	2.4e-22
WP_042599501.1|1612695_1613277_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	39.4	3.8e-34
WP_048941027.1|1613325_1613712_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_042599503.1|1613764_1614766_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.8	1.2e-48
WP_042599504.1|1614796_1616227_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	38.3	2.1e-33
WP_042599505.1|1616358_1616634_+	hydrogenase maturation factor HybG	NA	NA	NA	NA	NA
WP_105182720.1|1616668_1619533_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.7	4.2e-150
>prophage 7
NZ_CP020008	Haemophilus influenzae strain 5P28H1 chromosome, complete genome	1886450	1627813	1634224	1886450	head,terminase	Haemophilus_phage(55.56%)	9	NA	NA
WP_005650554.1|1627813_1627990_-	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	93.1	8.5e-22
WP_075913359.1|1628130_1629441_-|head	phage head morphogenesis protein	head	Q7Y5U5	Haemophilus_phage	78.3	5.3e-108
WP_105182721.1|1629340_1630675_-	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	84.0	4.7e-213
WP_011272619.1|1632006_1632519_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	39.2	1.0e-19
WP_005643377.1|1632596_1632848_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	52.9	9.9e-16
WP_042594017.1|1632831_1633179_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	1.2e-22
WP_042594016.1|1633180_1633462_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	70.0	8.8e-29
WP_042594015.1|1633373_1633709_-	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	52.1	9.8e-19
WP_042594014.1|1633681_1634224_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	52.0	3.1e-46
>prophage 8
NZ_CP020008	Haemophilus influenzae strain 5P28H1 chromosome, complete genome	1886450	1637783	1659434	1886450	integrase	Mannheimia_phage(23.81%)	31	1649852:1649868	1665638:1665654
WP_042594011.1|1637783_1638371_-	recombinase NinG	NA	A0A2I7RAC0	Vibrio_phage	48.0	8.3e-37
WP_042594054.1|1638463_1638880_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	86.1	1.9e-64
WP_005633909.1|1638916_1639141_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_042599516.1|1639137_1639761_-	replication P	NA	D0UIL4	Aggregatibacter_phage	42.2	6.9e-34
WP_042593361.1|1640515_1640758_-	hypothetical protein	NA	M4NJW2	Sulfitobacter_phage	41.4	4.0e-06
WP_005662003.1|1641358_1641586_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	50.8	1.5e-10
WP_042599512.1|1641720_1642626_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	40.8	3.0e-38
WP_042593358.1|1642641_1643736_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	36.2	2.0e-60
WP_042593357.1|1643735_1644395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005662013.1|1644351_1645383_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	66.4	2.8e-128
WP_158672356.1|1646058_1646229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593356.1|1646393_1647224_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.2	3.4e-76
WP_042599513.1|1647728_1648349_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	46.4	3.7e-19
WP_042599368.1|1648438_1648789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593270.1|1648785_1649079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593269.1|1649090_1650002_+	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	70.7	2.4e-115
1649852:1649868	attL	GGTTGTTGATGAAGCCA	NA	NA	NA	NA
WP_080317036.1|1650346_1650958_+	Bro-N domain-containing protein	NA	Q7Y5X0	Haemophilus_phage	60.6	5.8e-33
WP_042602780.1|1651168_1651813_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	71.4	6.8e-85
WP_042602779.1|1651812_1652247_+	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	1.3e-18
WP_105182722.1|1652309_1653602_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	61.9	8.8e-07
WP_038440649.1|1653726_1654623_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	43.7	8.4e-57
WP_005668254.1|1654619_1654865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593417.1|1654861_1655221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042599526.1|1655217_1656006_+	DNA methyltransferase	NA	U4KJA1	Streptococcus_phage	56.7	4.0e-79
WP_005668260.1|1656016_1656664_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	40.0	1.0e-08
WP_042593416.1|1656667_1657084_+	hypothetical protein	NA	W0B4E9	Acinetobacter_phage	39.2	3.5e-05
WP_042599527.1|1657163_1657652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593414.1|1657641_1657965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042593413.1|1657957_1658230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005650488.1|1658271_1658475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105182752.1|1658546_1659434_-|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	54.2	2.7e-84
1665638:1665654	attR	TGGCTTCATCAACAACC	NA	NA	NA	NA
