The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026357	Escherichia coli strain 2F_0 chromosome, complete genome	4651848	247636	297096	4651848	integrase,transposase	Streptococcus_phage(20.0%)	48	262898:262957	297206:297265
WP_000006255.1|247636_248134_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|248357_250097_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|250056_250827_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|250897_251953_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|252004_252298_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|252300_252699_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|252708_253161_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|253466_253733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|253665_254202_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|254258_255716_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|255976_256435_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|256526_257771_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000749863.1|259044_260100_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|260387_261491_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|261502_262756_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262898:262957	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|263327_263669_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|263689_264007_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|264025_264247_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|264255_264732_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|264747_265206_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|265303_265543_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|265619_266087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|266109_266553_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|266552_266780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|267183_268005_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|268096_268960_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|269288_270182_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|270602_271754_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|274100_275117_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|275324_276728_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|276714_277647_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|277755_278802_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|280023_280362_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|280384_280735_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|280828_281983_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|282277_283186_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|283200_285168_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|285394_286777_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286788_288399_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|288403_289162_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|289300_290305_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|291499_292231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|292321_292948_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|293219_293918_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293944_294799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294917_295142_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|295138_295579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|295695_297096_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
297206:297265	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP026357	Escherichia coli strain 2F_0 chromosome, complete genome	4651848	519138	582097	4651848	protease,tRNA,transposase,lysis,terminase,integrase	Enterobacteria_phage(50.0%)	65	564755:564801	586057:586103
WP_001295836.1|519138_519762_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|519732_520419_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|520415_522830_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|523260_527541_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|527580_527949_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|528639_528900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|530131_531226_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|531294_532221_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|532450_532933_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|533010_533826_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|533915_535697_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|535709_536486_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|536585_537464_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|537632_539087_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|539146_540508_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|540564_541866_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|541887_543033_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|543260_544046_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|544056_545292_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|545313_546363_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|546679_548347_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|548356_549616_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|549626_550442_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|550438_551332_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|551526_552594_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|552590_553100_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|553217_553940_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|553942_554437_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|554610_555996_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|556031_556553_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|556660_556873_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|556874_557741_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|558211_558754_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|558973_559666_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|559696_562300_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|562278_563319_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|563329_563845_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|563847_564480_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
564755:564801	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|564814_565978_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|566097_566361_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|566683_566779_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|566841_568003_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|568314_568647_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|568694_568844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|568901_570428_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|570892_571444_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|571453_572251_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|572367_572469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|572465_572921_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|572920_573091_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|573083_573374_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|573370_573733_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|573729_573870_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|573955_574339_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|574736_575753_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|575757_576825_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|577397_577613_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|577612_578110_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|578326_578509_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|578599_578893_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|579183_579594_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|579879_580086_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|580250_580445_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|580833_581379_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|581353_582097_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
586057:586103	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP026357	Escherichia coli strain 2F_0 chromosome, complete genome	4651848	1192666	1214059	4651848	tRNA,plate,integrase,portal,tail	Shigella_phage(25.0%)	32	1184661:1184675	1220762:1220776
1184661:1184675	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1192666_1193773_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1193826_1194288_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1194297_1194951_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1195122_1196373_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1196866_1197532_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1197532_1198237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1198694_1199588_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1199678_1200806_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1200786_1201032_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1201068_1201380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1201496_1201838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1201775_1202084_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1202258_1202933_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1203023_1203224_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1203267_1203825_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1204000_1204180_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1204169_1205537_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1205548_1205731_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1205730_1206204_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1206130_1206922_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1206912_1207497_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1207500_1208130_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1208131_1208545_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1208516_1209119_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1209118_1209613_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1209684_1210239_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1210345_1211179_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943927.1|1211412_1211577_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1211679_1212003_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1212539_1212650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1212702_1213107_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1213327_1214059_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1220762:1220776	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP026357	Escherichia coli strain 2F_0 chromosome, complete genome	4651848	1396075	1436893	4651848	tRNA,transposase,lysis,integrase,tail	Escherichia_phage(45.16%)	43	1397222:1397240	1427597:1427615
WP_010723085.1|1396075_1397092_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1397222:1397240	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1397364_1397622_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1397671_1398622_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1398773_1399526_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_000945011.1|1399720_1400236_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1400246_1401773_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1401809_1403255_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000444929.1|1403254_1404565_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_000885458.1|1404740_1405649_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1405978_1406542_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1406562_1407795_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1408049_1409033_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1409510_1410884_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1411012_1411948_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1411999_1413235_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1413236_1413452_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1413530_1413740_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1413732_1413927_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1413983_1414793_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1414785_1417386_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1417487_1417763_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1417837_1418008_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1418007_1418229_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1418670_1419159_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1419155_1419311_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1419764_1420241_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1420364_1420661_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1420683_1421106_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1421118_1421976_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1421982_1422729_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1422751_1423312_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1423399_1423585_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1423781_1425239_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1425376_1425640_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1425620_1425980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1427745_1428726_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1427597:1427615	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1429048_1432411_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1432410_1432986_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1433083_1433674_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1433990_1434224_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1434292_1434406_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1435184_1435619_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1435759_1436893_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 5
NZ_CP026357	Escherichia coli strain 2F_0 chromosome, complete genome	4651848	1629452	1648663	4651848	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1629452_1630913_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1631001_1632285_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1632889_1633003_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1633071_1633305_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1633621_1634212_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1634309_1634885_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1634884_1635847_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1635797_1636367_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1636755_1636989_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1637046_1637457_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1637608_1637782_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1637953_1638109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1638187_1638253_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1638255_1638444_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1638454_1638667_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1639029_1639527_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1639523_1640057_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1640053_1640365_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1640369_1640585_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1641338_1641554_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1641854_1642067_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1642121_1642211_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1642488_1643241_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|1643254_1644304_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|1644305_1644584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1644650_1644902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1645118_1645274_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1645345_1645633_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1645632_1645872_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1645896_1646202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1646404_1646737_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1647173_1647323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1647619_1647850_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1647933_1648341_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1648507_1648663_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP026357	Escherichia coli strain 2F_0 chromosome, complete genome	4651848	2107225	2115896	4651848		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2107225_2108329_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2108336_2109584_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2109580_2110138_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2110137_2111019_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2111076_2111976_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2111975_2113061_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2113433_2114327_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2114501_2115896_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 7
NZ_CP026357	Escherichia coli strain 2F_0 chromosome, complete genome	4651848	2465300	2476510	4651848	integrase,tail	Enterobacteria_phage(50.0%)	17	2463275:2463291	2480185:2480201
2463275:2463291	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2465300_2466233_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2466544_2467702_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2467854_2468217_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2468213_2469134_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2469130_2470462_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2470496_2470778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2471076_2471517_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2471543_2472062_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2472111_2472387_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2472386_2472881_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2472877_2473246_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2473603_2473966_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2474031_2474856_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2474983_2475520_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2475510_2475873_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2475872_2476178_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2476309_2476510_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2480185:2480201	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP026357	Escherichia coli strain 2F_0 chromosome, complete genome	4651848	2857092	2864231	4651848		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2857092_2859654_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2859759_2860416_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2860466_2861234_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2861429_2862338_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2862334_2863501_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2863592_2864231_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
