The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	172127	243216	3157380	integrase,holin,transposase	Escherichia_phage(53.33%)	61	189435:189494	203025:204334
WP_104988031.1|172127_174095_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	29.0	2.4e-24
WP_104988032.1|174159_175056_-	carbapenem susceptibility porin CarO	NA	NA	NA	NA	NA
WP_051061469.1|177435_178368_+|transposase	IS5-like element ISAba12 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.7	3.5e-58
WP_104988033.1|179169_182001_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
WP_104988034.1|182250_182928_-	thiaminase II	NA	NA	NA	NA	NA
WP_005176703.1|184120_185272_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_104988035.1|185709_187074_+	MFS transporter	NA	NA	NA	NA	NA
WP_045795510.1|187125_187692_+	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	65.0	1.8e-36
WP_104988036.1|187848_189072_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
189435:189494	attL	TGAACCGTACCGGGTTTGTCGGAGAGTCAATATTCTGAGAGACTATTCCGATGAAAAAAC	NA	NA	NA	NA
WP_104988037.1|189484_190703_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	2.6e-77
WP_104988038.1|191928_194052_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_104988039.1|194053_194473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016658839.1|194675_195716_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	83.5	2.3e-175
WP_104988040.1|195747_196290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019385588.1|196338_196554_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016658839.1|197887_198928_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	83.5	2.3e-175
WP_104988041.1|199021_199222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988042.1|199245_200166_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_104988037.1|201814_203034_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	2.6e-77
WP_005021637.1|203409_203706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004679347.1|203854_204535_+	DNA-binding response regulator	NA	NA	NA	NA	NA
203025:204334	attR	GTTTTTTCATCGGAATAGTCTCTCAGAATATTGACTCTCCGACAAACCCGGTACGGTTCAGAGTCCTGATTTTTTAACTTATTGTGAACACGGATAACGGCCTCATCACCTTCTTCAAATTCAAGAAGTGGTGCAACGAATTTACCATTTACAGTAATTCTCTCAACTGGTTTTCCTGTGATATTTACAGTTTGTTCAGCGATTGTTAAATCATATTCTTTAACTGCCGCCATTACCCAAGTTGATGAAAATAAACCAACTCCAATTAAGAGTACATGACTTAACTTATTTGACATTCTATCTCACCTTTAGAAAGGTCAAGATTGAAGTAATAAAGCAAATATTTAGTATAAACTTTAATACTTCTTTCTCGCTATTTATAAAATTATTTATTGCTACTAGGCATATTCATCTTTGAATGATCCATTTTAGAATGGTCCATATTCATCATAGCATGATCCATTTTTGACATGTCAGATGAGTTAGGAGACTGATGTTGACTATGATCTTGCTGAGTCTTGTCATCTTTTTCCATTTTACAAGGTTTTGTACAAGGTTCCTGTGCTTTTACCGTTTTAGTGGCACTTGAGGTTGATACATCTTTTGCCCAAGATTGAGTACCAGCAATTAAAGTTCCAGCACACATTAAAATTGTTAGACTACGACGCACTACAGTTTTCATAAGTTTCTCTAAAAGTTAATTTCTTGCTACTACAATAAAGTGAAGCACTGAACATCTAAGTGACTTGAAAATGACATTTTTGTAATCTATCTCGATCAGATGTTTTATAACGTTATTATAGTTTTAATGAATGACTTAGGATTCGGAAATGAGAATACTATTAGTTGAAGATGAACAAAAAACTGGTGATTATCTCAAGCAAGGTTTATCCGAAGCTGGCTATATTACGGACTGGGTTACAGATGGGTTAACGGGTAAACATCAAGCTCTTTCTGAAGAGTATGACTTAATTATTTTAGACGTGATGTTACCTGGACTAAATGGTTGGAATATTATCAATGATATTCGTAGCAGCGGTAAAACAATGCCCATTCTTTTTCTTACCGCCCGAGATCAAATCGAAGATCGAGTAAAAGGATTAGAGCTAGGCGCTGATGATTATTTAGTTAAGCCTTTTGCTTTTGCAGAGCTTCTAGCTCGAATAAAAACGCTCCTTAGACGAGGGCAACAAAGAGAAGATAATAATATTATTAAGATTGCTGATTTAGAACTTGATTTGAGAAAACGTCGGGTAACACGAGCAGGTCAACGCATTGATCTGACGGCTAAAGAATTTGCGCTTATGGAG	NA	NA	NA	NA
WP_005180715.1|204527_205928_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004663995.1|205966_207250_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_005105854.1|207246_209622_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.5	4.6e-94
WP_104988043.1|209633_209846_-	isoprenylcysteine carboxyl methyltransferase	NA	NA	NA	NA	NA
WP_005105849.1|209849_210284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004695740.1|210304_210553_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_005105848.1|210579_211011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004681441.1|211375_211756_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_104988044.1|211820_212702_+	copper resistance protein CopD	NA	NA	NA	NA	NA
WP_004281879.1|213171_213366_+	copper chaperone	NA	NA	NA	NA	NA
WP_104988045.1|213537_214242_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.3	2.1e-119
WP_104989331.1|214305_215586_-	cation transporter	NA	NA	NA	NA	NA
WP_000550240.1|215675_216068_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001140620.1|216364_216667_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_104988037.1|217927_219146_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	2.6e-77
WP_104988046.1|219614_219983_+	cation transporter	NA	NA	NA	NA	NA
WP_104988047.1|220031_221357_+	TolC family protein	NA	NA	NA	NA	NA
WP_104988048.1|221358_222588_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_104988049.1|222577_225718_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_104988050.1|225804_226704_+	cation transporter	NA	NA	NA	NA	NA
WP_104988051.1|226887_227481_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.5	2.7e-27
WP_104988052.1|227543_228650_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_104988053.1|228662_229373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104989332.1|229501_229729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988054.1|229906_230977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988045.1|231004_231709_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.3	2.1e-119
WP_019838459.1|231775_232750_-	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_001067784.1|232977_233682_+|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_104988055.1|233881_234160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988056.1|234255_235128_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_114148866.1|235299_235569_+	DUF4041 domain-containing protein	NA	NA	NA	NA	NA
WP_104989333.1|236058_236406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988058.1|236453_238319_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_104988059.1|238305_238644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004668309.1|238630_239575_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_104988060.1|239754_240000_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_000221358.1|239989_240283_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005176703.1|240321_241473_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004641881.1|241690_242020_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_104988061.1|242283_243216_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	3.8e-60
>prophage 2
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	435215	503182	3157380	tail,transposase,protease	Orpheovirus(15.79%)	60	NA	NA
WP_004811110.1|435215_436148_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	7.1e-59
WP_104988146.1|436515_437367_-	thymidylate synthase	NA	H9EB68	Vibrio_phage	74.2	1.3e-128
WP_104988147.1|438135_438627_-	hypothetical protein	NA	A0A2I2L3Y4	Orpheovirus	32.7	4.8e-14
WP_104988148.1|438812_439187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988149.1|439187_439565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016658551.1|439648_440458_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_104989342.1|440552_441335_+	serine/threonine protein phosphatase	NA	A0A0M3ZEJ9	Turkeypox_virus	28.2	1.5e-17
WP_104988150.1|441393_443640_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_005180188.1|443820_444603_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_104489799.1|444599_445046_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_005180185.1|445065_445290_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_104988151.1|445450_446332_+	permease	NA	NA	NA	NA	NA
WP_016658557.1|446527_447154_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	33.2	6.1e-14
WP_005180179.1|447255_447846_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016658558.1|447842_448436_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_005180176.1|448435_449596_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_104988152.1|449680_451378_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_104989343.1|451633_452746_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_104988153.1|452742_453426_-	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	32.4	2.5e-21
WP_104988154.1|453533_455768_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_104988155.1|456089_458288_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_075167430.1|458533_459865_+	trigger factor	NA	NA	NA	NA	NA
WP_005180162.1|460056_460662_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.0	1.2e-62
WP_104988156.1|460689_462000_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.9	2.9e-130
WP_104989344.1|462169_462883_+	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_005180157.1|462954_464481_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_104988157.1|465019_465601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988158.1|465719_467858_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_104988159.1|467908_469129_-	acetate kinase	NA	NA	NA	NA	NA
WP_005180148.1|469443_469848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988160.1|469963_471229_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.9	5.6e-99
WP_045795851.1|471536_472859_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_087662421.1|472927_473782_-	leucine carboxyl methyltransferase	NA	NA	NA	NA	NA
WP_104988161.1|473879_474902_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	38.5	4.4e-09
WP_104988162.1|475097_477290_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	49.9	1.8e-185
WP_045795855.1|477568_479629_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	8.8e-17
WP_104989345.1|481211_482446_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	50.7	4.0e-73
WP_104989346.1|482622_482877_+	TIGR03643 family protein	NA	NA	NA	NA	NA
WP_104988163.1|482873_483026_-	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_104988164.1|483029_484553_-	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	29.9	3.2e-48
WP_104988165.1|484940_485708_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_104988166.1|485808_486354_+	hypothetical protein	NA	A0A2I2L3Y4	Orpheovirus	34.2	4.1e-14
WP_104988167.1|486491_487478_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_104988168.1|487474_488767_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_104988169.1|488766_489561_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_104988170.1|489557_490754_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.2	4.1e-43
WP_104988171.1|490779_491559_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_104988172.1|491567_492617_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_104988173.1|492652_493975_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_045795869.1|493992_494679_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.3	2.5e-29
WP_104988174.1|494690_495188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988175.1|495163_495736_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_104988176.1|495849_496743_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104988177.1|496843_498055_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_104988178.1|498051_498840_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_104989347.1|498973_499597_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.6	7.7e-41
WP_051061469.1|499608_500541_+|transposase	IS5-like element ISAba12 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.7	3.5e-58
WP_104988179.1|500570_500864_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_048881948.1|500884_501883_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005176703.1|502030_503182_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	521177	560941	3157380	coat,tRNA,transposase	Enterobacteria_phage(27.27%)	30	NA	NA
WP_104988188.1|521177_522197_-|transposase	IS21-like element ISAba8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.8	6.2e-80
WP_104988189.1|522750_523641_+	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_104988190.1|523656_523887_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_104988191.1|524292_526185_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A2I4R668	Erysipelothrix_phage	58.9	9.7e-204
WP_104988192.1|526214_527147_-|transposase	IS5-like element IS17 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.1e-58
WP_001280601.1|527661_528987_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_104988193.1|529259_529784_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	29.4	4.2e-16
WP_104988194.1|530050_531025_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_104988195.1|531427_532003_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	46.2	3.6e-29
WP_045795891.1|532494_534084_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.9	1.6e-10
WP_104988196.1|534163_534988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988197.1|535044_536019_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_104988198.1|536018_536837_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
WP_104988199.1|536944_537718_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	34.4	1.2e-22
WP_045795895.1|537775_538798_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_051061469.1|539881_540814_-|transposase	IS5-like element ISAba12 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.7	3.5e-58
WP_104988037.1|542201_543421_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	2.6e-77
WP_052690203.1|544101_544575_+	SCPU domain-containing protein	NA	NA	NA	NA	NA
WP_052690204.1|544604_545366_+	molecular chaperone	NA	NA	NA	NA	NA
WP_104988200.1|545375_547742_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_104988201.1|547732_548695_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_005248088.1|548691_549171_-	SCPU domain-containing protein	NA	NA	NA	NA	NA
WP_034438504.1|549627_549861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988202.1|550101_551832_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
WP_087662615.1|551821_553240_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104988203.1|553236_554505_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_087662446.1|555363_555795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087662445.1|555913_558040_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	46.1	4.6e-138
WP_104988204.1|558058_559474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051061469.1|560008_560941_-|transposase	IS5-like element ISAba12 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.7	3.5e-58
>prophage 4
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	840123	910925	3157380	tRNA,transposase,protease	Bacillus_phage(12.5%)	57	NA	NA
WP_000644963.1|840123_840801_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_045796249.1|842301_842514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045796250.1|842969_843977_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_045796251.1|844040_844571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045796252.1|844696_845038_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_104988318.1|845155_847033_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_045796254.1|847049_847496_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045796255.1|847805_848273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045796256.1|848273_849194_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_045796257.1|849335_849632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005179441.1|849738_850236_+	DUF2505 family protein	NA	NA	NA	NA	NA
WP_045796259.1|850297_851584_-	MFS transporter	NA	NA	NA	NA	NA
WP_104988319.1|851711_852857_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.8	3.6e-20
WP_104988320.1|853080_854355_+	glutaminase	NA	NA	NA	NA	NA
WP_104988321.1|854445_856176_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_104988072.1|856560_857790_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104988322.1|857899_861682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988323.1|861735_865425_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	58.3	2.1e-13
WP_005179429.1|865906_867526_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_087662529.1|867850_869389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005176703.1|869591_870743_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_045796052.1|871123_871741_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005179419.1|871900_872539_+	Fe/S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_104988324.1|872710_874771_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.9	2.9e-12
WP_104988325.1|874843_875851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045796054.1|875865_876888_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_087662532.1|877197_877812_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016659292.1|877906_878518_-	arylesterase	NA	NA	NA	NA	NA
WP_045796055.1|878550_879276_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	1.2e-32
WP_087662525.1|879277_881761_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_045796057.1|881795_882614_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_045796058.1|882692_883367_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_104988326.1|883478_885560_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_104988327.1|885653_886553_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_104988328.1|886566_887502_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_104988329.1|887553_888732_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005179369.1|888809_888974_-	rubredoxin	NA	NA	NA	NA	NA
WP_104988330.1|889478_890021_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	38.4	1.0e-20
WP_005179357.1|890074_890590_-	hypothetical protein	NA	A0A2I7QX93	Vibrio_phage	24.7	6.6e-06
WP_005179355.1|890837_892364_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.5	4.6e-87
WP_104988331.1|892458_892986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005179347.1|893310_894225_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_045796067.1|894328_895942_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.9	4.7e-42
WP_104988332.1|896411_896774_-	thioredoxin	NA	NA	NA	NA	NA
WP_045796069.1|896903_897896_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_104988333.1|898458_899355_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_104988334.1|899495_900002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005179329.1|900075_901392_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005179328.1|901516_902506_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087662522.1|903143_904745_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_087662521.1|904884_905649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087662520.1|905827_906292_-	copper homeostasis protein CutF	NA	NA	NA	NA	NA
WP_087662531.1|906556_907147_+	acyltransferase	NA	NA	NA	NA	NA
WP_045796073.1|907311_907644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087662519.1|907768_908530_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_087662518.1|908673_909549_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_104988072.1|909695_910925_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	1042649	1116323	3157380	tRNA,transposase,protease	uncultured_Caudovirales_phage(25.0%)	68	NA	NA
WP_045794839.1|1042649_1043783_+	toxic anion resistance protein	NA	K4F9M7	Cronobacter_phage	22.8	2.8e-17
WP_104988401.1|1043826_1044741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075166909.1|1044941_1046507_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.5	6.7e-25
WP_005179080.1|1046643_1046898_-	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	46.6	2.0e-16
WP_104988402.1|1046901_1048293_-	U32 family peptidase	NA	Q6DW11	Phage_TP	64.9	4.7e-131
WP_104988403.1|1048437_1048866_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	60.6	6.9e-41
WP_005179068.1|1048950_1049268_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	64.4	7.9e-26
WP_104989358.1|1049272_1049746_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	53.2	5.6e-36
WP_104988404.1|1049749_1050799_+	arsenical-resistance protein	NA	NA	NA	NA	NA
WP_104989359.1|1050798_1051503_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.1	1.2e-90
WP_104988405.1|1051483_1051909_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104988406.1|1051983_1052610_+	cation transporter	NA	NA	NA	NA	NA
WP_104988407.1|1052715_1053495_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_104988408.1|1053600_1054320_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_104989360.1|1054306_1055515_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_104988409.1|1055763_1057521_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_104988410.1|1057632_1057989_+	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	43.4	2.0e-14
WP_104988411.1|1058107_1058773_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.5	2.3e-27
WP_104988412.1|1058773_1060129_+	GHKL domain-containing protein	NA	A0A1B0VMK3	Pseudomonas_phage	24.5	5.4e-07
WP_016659175.1|1060231_1060402_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_104988413.1|1060540_1061464_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_104470304.1|1061460_1062015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988414.1|1062027_1064430_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_005179018.1|1064618_1065527_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_005179016.1|1065526_1065796_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_005179013.1|1065868_1066870_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	48.0	6.7e-79
WP_045794853.1|1067298_1068648_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_104988415.1|1068798_1069941_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_104988416.1|1070027_1070549_-|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_104988417.1|1071034_1072144_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_104988418.1|1072208_1073300_+	histidinol-phosphate transaminase	NA	A0A141ZPJ2	Faustovirus	25.7	2.3e-16
WP_104988419.1|1073303_1075550_+	bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016659168.1|1075644_1076010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045794858.1|1076124_1076757_-	hydrolase	NA	NA	NA	NA	NA
WP_104988420.1|1076892_1077672_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_104988421.1|1077751_1079194_-	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	30.8	1.2e-52
WP_104988422.1|1079449_1079932_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_104988423.1|1080066_1081353_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_104989361.1|1081481_1082792_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.1	1.4e-36
WP_104988424.1|1082971_1084675_+	M61 family peptidase	NA	NA	NA	NA	NA
WP_104988425.1|1084770_1085163_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_104988426.1|1085340_1086126_-	rRNA large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
WP_104988427.1|1086535_1087792_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	75.9	5.0e-15
WP_104988428.1|1088478_1089048_+	M23 family peptidase	NA	A0A1D8ERN4	Mycobacterium_phage	34.2	5.4e-09
WP_104988429.1|1090019_1091198_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_104988430.1|1091304_1091883_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_104988431.1|1092018_1092846_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_104988432.1|1092916_1095730_+	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.9	1.5e-14
WP_104988433.1|1095872_1096940_-	amidohydrolase	NA	NA	NA	NA	NA
WP_104988434.1|1097061_1098366_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005178954.1|1098467_1098863_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_016659155.1|1098971_1099604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988435.1|1099626_1101102_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_104988436.1|1101215_1102673_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_016659152.1|1102911_1103295_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_104988437.1|1103836_1104457_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_104988438.1|1104499_1105801_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
WP_104988072.1|1105953_1107183_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104987963.1|1107239_1108448_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	51.3	3.2e-51
WP_104988439.1|1108604_1108919_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_002042420.1|1108881_1109193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988440.1|1109516_1109966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988441.1|1109958_1110813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988442.1|1110809_1111442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988443.1|1111656_1112673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988072.1|1112817_1114047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104988444.1|1114107_1114524_+	heme-binding protein	NA	NA	NA	NA	NA
WP_004811110.1|1115390_1116323_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	7.1e-59
>prophage 6
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	1496118	1528011	3157380	holin,transposase	Vibrio_phage(25.0%)	25	NA	NA
WP_000644963.1|1496118_1496796_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_045795652.1|1500369_1500978_-	MarC family protein	NA	NA	NA	NA	NA
WP_104988601.1|1500990_1503027_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.8	1.6e-18
WP_104989365.1|1503256_1503841_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_045795654.1|1503861_1505334_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_104988602.1|1505350_1507018_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.4	4.0e-52
WP_104988603.1|1507174_1507948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988604.1|1507978_1508875_-	response regulator	NA	NA	NA	NA	NA
WP_104988605.1|1508984_1510967_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_104988606.1|1510963_1511806_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_104988607.1|1511818_1512559_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_104988608.1|1512599_1514462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067766621.1|1514648_1514924_+	antitoxin	NA	NA	NA	NA	NA
WP_104988609.1|1514886_1515153_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.0	4.0e-15
WP_016658148.1|1516859_1517846_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_005177880.1|1517874_1518903_+	methionine synthase	NA	NA	NA	NA	NA
WP_005177877.1|1519012_1519504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988610.1|1519545_1520346_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_104988037.1|1522245_1523464_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	2.6e-77
WP_104988611.1|1524241_1524511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000644963.1|1524543_1525221_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_104988612.1|1525275_1525470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988613.1|1525582_1525834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988614.1|1525833_1526040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988615.1|1526673_1528011_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	1535148	1580102	3157380	plate,transposase,protease	uncultured_virus(28.57%)	45	NA	NA
WP_045795667.1|1535148_1536144_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_104988619.1|1536107_1537913_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_045795669.1|1537924_1538401_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_005177807.1|1538468_1538972_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_005177804.1|1539016_1540498_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_104988620.1|1540490_1540994_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_104988621.1|1541014_1541683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988622.1|1542043_1544722_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	29.5	1.8e-78
WP_045795673.1|1544741_1545857_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_005177795.1|1545862_1547227_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_104988623.1|1547239_1548046_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_104988624.1|1548060_1548705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988625.1|1548701_1549664_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A0H3V0Q8	Geobacillus_virus	32.1	2.4e-09
WP_104989367.1|1549677_1550442_-	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	35.1	1.8e-07
WP_104988626.1|1550583_1551459_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_104988627.1|1551455_1551878_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_104989368.1|1551879_1552296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988628.1|1552789_1553536_-	zeta toxin	NA	NA	NA	NA	NA
WP_104988629.1|1553539_1553797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005177772.1|1554855_1555311_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_104988630.1|1555327_1555750_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005177767.1|1555767_1557132_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005177765.1|1557196_1557661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988631.1|1557885_1559373_+	amidase	NA	NA	NA	NA	NA
WP_104988632.1|1559420_1560581_-	MFS transporter	NA	NA	NA	NA	NA
WP_104988633.1|1561774_1562329_+	cytochrome b	NA	NA	NA	NA	NA
WP_005177756.1|1562584_1562824_+	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_005177753.1|1562862_1563210_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_005177751.1|1563586_1563823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988634.1|1564225_1564558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005177745.1|1564996_1565230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075167744.1|1565439_1565922_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	38.1	3.6e-22
WP_104988635.1|1565996_1566617_+	aminotransferase	NA	NA	NA	NA	NA
WP_104988636.1|1566694_1567834_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_104988637.1|1567838_1568723_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_081410744.1|1568880_1569600_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045795694.1|1569714_1570629_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_016658171.1|1572319_1572793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988638.1|1572876_1573230_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	59.4	1.1e-28
WP_104988639.1|1573341_1575618_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.8	2.8e-165
WP_104988640.1|1575627_1576044_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.0	4.5e-13
WP_104989369.1|1576062_1576809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104989370.1|1576888_1577938_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_104988641.1|1578127_1578808_-	M48 family peptidase	NA	NA	NA	NA	NA
WP_104988072.1|1578872_1580102_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	1729549	1800495	3157380	transposase	Escherichia_phage(35.29%)	45	NA	NA
WP_104988188.1|1729549_1730569_-|transposase	IS21-like element ISAba8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.8	6.2e-80
WP_104988717.1|1732010_1732505_+	DNA starvation/stationary phase protection protein	NA	W5S6G8	Pithovirus	39.3	6.8e-16
WP_104988718.1|1739975_1740578_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_104988719.1|1740587_1741601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988720.1|1741612_1742602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988721.1|1742603_1745552_-	CRISPR-associated endonuclease Cas3''	NA	NA	NA	NA	NA
WP_104989376.1|1745548_1746511_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	36.9	5.3e-49
WP_104989377.1|1746653_1747343_-	DUF3322 and DUF2220 domain-containing protein	NA	NA	NA	NA	NA
WP_104988037.1|1747861_1749080_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	2.6e-77
WP_104988722.1|1750123_1753012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988037.1|1753051_1754271_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	2.6e-77
WP_104988723.1|1754811_1755627_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_104988724.1|1755640_1757101_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_016658275.1|1757441_1758431_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_104988725.1|1758427_1759351_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_104988726.1|1759668_1762128_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_104988727.1|1762186_1764154_+	3-phytase	NA	NA	NA	NA	NA
WP_104988728.1|1764225_1764912_+	protein TolQ	NA	NA	NA	NA	NA
WP_075166740.1|1764918_1765365_+	protein TolR	NA	NA	NA	NA	NA
WP_104988729.1|1765361_1766156_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_104988730.1|1766727_1768881_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_104988731.1|1768945_1769557_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_104988732.1|1769598_1769883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988733.1|1769886_1771446_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_104988734.1|1771442_1771724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988735.1|1772223_1772910_-	serine/threonine-protein phosphatase 2	NA	A0A172Q076	Acinetobacter_phage	39.9	1.2e-39
WP_104988736.1|1772943_1773927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988737.1|1774030_1774855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104987963.1|1774905_1776114_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	51.3	3.2e-51
WP_042893492.1|1776348_1777632_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_104988738.1|1777644_1780536_-	hypothetical protein	NA	K4I1H4	Acidithiobacillus_phage	45.1	2.3e-31
WP_042893489.1|1780679_1781081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104513585.1|1781077_1781863_-	HD domain-containing protein	NA	A0A0N6WG77	Salmonella_phage	40.4	1.7e-21
WP_104989378.1|1781956_1782145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988739.1|1782925_1783591_+	hypothetical protein	NA	W6AQS3	Erwinia_phage	39.1	2.0e-15
WP_104988740.1|1784311_1785670_-	hypothetical protein	NA	A0A1V0SLK8	Klosneuvirus	23.4	1.8e-10
WP_104988741.1|1785666_1787238_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_104988742.1|1787300_1790792_-	type I restriction-modification system endonuclease	NA	A0A0S2MU11	Streptomyces_phage	25.3	3.1e-06
WP_104988743.1|1790926_1791934_-	HNH endonuclease	NA	A0A2I2MUI7	uncultured_Caudovirales_phage	86.2	3.2e-105
WP_104989379.1|1791926_1792511_-	class I SAM-dependent methyltransferase	NA	A0A2H4J5G6	uncultured_Caudovirales_phage	62.5	2.1e-24
WP_104988744.1|1792823_1793465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988745.1|1793454_1795638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988188.1|1797053_1798073_+|transposase	IS21-like element ISAba8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.8	6.2e-80
WP_001053379.1|1798072_1798846_+	ATPase AAA	NA	A0A2L1IVB6	Escherichia_phage	57.0	1.1e-76
WP_016658839.1|1799454_1800495_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	83.5	2.3e-175
>prophage 9
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	1822757	1847067	3157380	transposase	Acinetobacter_phage(32.0%)	37	NA	NA
WP_104988766.1|1822757_1823318_-	phage antirepressor Ant	NA	A0A0P0ZCA2	Stx2-converting_phage	37.0	2.5e-14
WP_104988767.1|1823583_1824345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988768.1|1824524_1824956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988769.1|1824958_1825369_-	DUF1320 domain-containing protein	NA	A0A2D1GNP0	Pseudomonas_phage	40.0	5.4e-11
WP_104988770.1|1825370_1825856_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	37.6	3.4e-20
WP_075174465.1|1825868_1826096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988771.1|1826108_1827065_-	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	38.2	9.6e-51
WP_104989380.1|1827068_1827539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988772.1|1827554_1828727_-	DUF2213 domain-containing protein	NA	M4SN93	Psychrobacter_phage	42.2	2.0e-66
WP_075174462.1|1828969_1829206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988773.1|1829252_1830116_-	hypothetical protein	NA	M4T3R2	Psychrobacter_phage	43.0	1.4e-48
WP_104988774.1|1830096_1831395_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	37.3	4.5e-75
WP_104988775.1|1831405_1832932_-	helicase	NA	A0A2P0WA10	Enterobacter_phage	41.9	1.6e-92
WP_104988776.1|1832909_1833386_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	73.6	2.7e-54
WP_104988777.1|1833432_1834080_-|transposase	transposase	transposase	A0A1B1P9K3	Acinetobacter_phage	52.5	1.0e-59
WP_075167011.1|1834119_1834425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016658839.1|1834926_1835967_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	83.5	2.3e-175
WP_104988778.1|1836003_1836537_-	hypothetical protein	NA	A0A0D4DCD6	Acinetobacter_phage	47.1	6.3e-44
WP_104988779.1|1836548_1836980_-	VRR-NUC domain-containing protein	NA	A0A0D4DBJ8	Acinetobacter_phage	81.6	9.3e-62
WP_104988780.1|1836976_1837384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988781.1|1837384_1837672_-	hypothetical protein	NA	A0A2H4J558	uncultured_Caudovirales_phage	39.6	1.5e-07
WP_104988782.1|1837668_1837872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988783.1|1837868_1838132_-	hypothetical protein	NA	A0A1B1P9H6	Acinetobacter_phage	39.2	2.6e-06
WP_104988784.1|1838128_1838878_-	hypothetical protein	NA	A0A2H5BFW5	Vibrio_phage	53.7	5.4e-65
WP_104988785.1|1838874_1840200_-	DNA helicase	NA	A0A2H4J6D5	uncultured_Caudovirales_phage	89.6	8.3e-202
WP_114148867.1|1840199_1841006_-	replication protein	NA	NA	NA	NA	NA
WP_104988786.1|1841180_1841456_-	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	90.9	1.3e-37
WP_005103769.1|1841464_1841650_-	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	82.5	1.9e-19
WP_104988787.1|1841729_1842410_+	helix-turn-helix domain-containing protein	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	64.2	5.0e-54
WP_104988788.1|1842569_1842851_+	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	34.6	2.5e-07
WP_104989381.1|1842862_1843360_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_104988789.1|1843356_1843638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988790.1|1843641_1843920_+	SinR family protein	NA	A0A1J0MFQ1	Staphylococcus_phage	40.0	1.9e-07
WP_104988791.1|1844433_1845414_+	recombinase	NA	Q9T173	Listeria_phage	37.9	2.6e-51
WP_104988792.1|1845421_1845733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104988793.1|1845729_1846722_+	transcriptional regulator	NA	A0A2H4J1F0	uncultured_Caudovirales_phage	61.6	1.5e-54
WP_104989382.1|1846794_1847067_+	hypothetical protein	NA	A0A0P0J0F2	Acinetobacter_phage	59.8	6.3e-24
>prophage 10
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	2121464	2184645	3157380	integrase,tRNA,transposase,protease	Acinetobacter_phage(27.78%)	55	2139836:2139852	2153076:2153092
WP_005176479.1|2121464_2122049_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	93.8	4.1e-105
WP_016659977.1|2122068_2123115_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	87.1	5.2e-167
WP_104988906.1|2123132_2123939_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	84.7	5.3e-127
WP_104988907.1|2124145_2124829_+	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	75.1	9.2e-88
WP_016659974.1|2124916_2125471_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	95.1	5.3e-94
WP_104988908.1|2125567_2125924_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_104988188.1|2127188_2128208_+|transposase	IS21-like element ISAba8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.8	6.2e-80
WP_104988187.1|2128207_2128981_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	1.4e-76
WP_104988909.1|2128977_2129376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988910.1|2129509_2131408_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_104988911.1|2131484_2131955_-	DUF3015 domain-containing protein	NA	NA	NA	NA	NA
WP_104988912.1|2132078_2132903_-	DUF817 family protein	NA	NA	NA	NA	NA
WP_045795185.1|2132931_2134002_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_104988913.1|2134205_2135444_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_104988434.1|2135492_2136797_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_104988914.1|2137017_2137710_+	pirin family protein	NA	NA	NA	NA	NA
WP_104988915.1|2138022_2139141_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	1.4e-29
WP_104989393.1|2139165_2140179_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
2139836:2139852	attL	GCAATGGCAATGCTGAA	NA	NA	NA	NA
WP_104988916.1|2140259_2141888_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_104988917.1|2143233_2143911_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_114148869.1|2144002_2144179_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104988918.1|2144179_2144404_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_104988919.1|2144863_2146135_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	39.1	3.0e-76
WP_104988920.1|2146297_2147224_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_104988921.1|2147220_2148567_+	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	73.3	6.3e-32
WP_104988922.1|2149003_2150230_-	MFS transporter	NA	NA	NA	NA	NA
WP_104988923.1|2150284_2152555_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_104988924.1|2152564_2153800_-	MFS transporter	NA	NA	NA	NA	NA
2153076:2153092	attR	TTCAGCATTGCCATTGC	NA	NA	NA	NA
WP_104988925.1|2153796_2154168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988926.1|2154164_2154803_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_086044537.1|2154830_2156648_-	IucA/IucC family protein	NA	NA	NA	NA	NA
WP_004781126.1|2156644_2158126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004781124.1|2158118_2159903_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_087662303.1|2160287_2161220_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	3.5e-58
WP_004644578.1|2161899_2162943_-	arsenical-resistance protein	NA	NA	NA	NA	NA
WP_004644579.1|2162950_2163424_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	52.6	8.7e-37
WP_004644580.1|2163430_2163751_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.5	3.0e-25
WP_070153885.1|2163808_2164243_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.7	1.1e-38
WP_104988927.1|2164550_2167802_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_104988928.1|2167798_2169181_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_104988929.1|2169180_2171466_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.1	5.9e-30
WP_000935322.1|2171766_2171937_+	DUF2559 family protein	NA	NA	NA	NA	NA
WP_104988930.1|2171949_2172546_+	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_104988931.1|2172649_2173546_-	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_104988932.1|2174900_2175938_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	38.6	1.1e-60
WP_104988933.1|2176049_2176349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004960803.1|2176460_2176841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104988934.1|2176852_2177434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104989395.1|2177451_2177712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005176376.1|2178701_2179196_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_104988935.1|2179562_2180678_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016659963.1|2180750_2181134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005176370.1|2181350_2182274_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	63.3	2.3e-89
WP_034597413.1|2182781_2183624_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	59.7	1.5e-36
WP_005176364.1|2183739_2184645_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 11
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	2369251	2397057	3157380	tRNA,transposase	uncultured_virus(40.0%)	26	NA	NA
WP_104987963.1|2369251_2370460_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	51.3	3.2e-51
WP_104989020.1|2370778_2371177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104989021.1|2371419_2372343_+|tRNA	tRNA-dihydrouridine synthase C	tRNA	NA	NA	NA	NA
WP_104989402.1|2372425_2372830_-	NUDIX domain-containing protein	NA	E5DQR1	Aeromonas_phage	41.3	5.2e-06
WP_104989022.1|2372905_2375371_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_087662587.1|2375550_2375916_-	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_016659847.1|2376009_2376354_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_016659844.1|2377270_2377651_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_087662588.1|2377815_2378481_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_087662589.1|2379015_2379414_-	VOC family protein	NA	NA	NA	NA	NA
WP_087662590.1|2379990_2380251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075167930.1|2380350_2380572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075167893.1|2380857_2381001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104989023.1|2381198_2382336_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.5	2.4e-40
WP_005176703.1|2382315_2383467_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_045796669.1|2383896_2384118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104989024.1|2384131_2384632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104989025.1|2384767_2385733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104989026.1|2385963_2387160_-	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_104472677.1|2387536_2387734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005176703.1|2389449_2390601_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_045796663.1|2390858_2392844_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_104989027.1|2393361_2394228_+	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_104989403.1|2394368_2394512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104987963.1|2394504_2395713_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	51.3	3.2e-51
WP_104989028.1|2395870_2397057_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.7	1.6e-39
>prophage 12
NZ_CP024620	Acinetobacter indicus strain SGAir0564 chromosome, complete genome	3157380	2895426	2957018	3157380	tRNA,transposase	Staphylococcus_phage(15.38%)	55	NA	NA
WP_104989209.1|2895426_2896347_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_005181597.1|2896398_2896659_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_104489116.1|2896647_2897844_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_104989412.1|2897858_2899211_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_104989210.1|2899364_2899616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104487721.1|2899640_2901494_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_005181588.1|2901490_2901751_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_104989211.1|2901919_2902837_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.9	1.5e-32
WP_005181584.1|2902934_2903747_+	DsbC family protein	NA	NA	NA	NA	NA
WP_075167825.1|2903857_2905174_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_045796493.1|2905231_2906377_+	threonine synthase	NA	NA	NA	NA	NA
WP_104989212.1|2906470_2907529_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_005181577.1|2907770_2908406_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_087662535.1|2908420_2909989_+	histidine kinase	NA	NA	NA	NA	NA
WP_087662536.1|2910006_2911416_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_087662537.1|2911432_2912602_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	20.6	1.3e-12
WP_087662538.1|2912625_2914173_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_045795380.1|2914291_2915362_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_104989213.1|2915363_2916464_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_104989214.1|2916622_2918071_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	41.0	5.0e-51
WP_104989215.1|2918063_2918471_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016659708.1|2918494_2919115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104989216.1|2919324_2919543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104989217.1|2919625_2920171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104989218.1|2920283_2920943_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.3	3.3e-34
WP_045795376.1|2920970_2922260_-	restriction endonuclease subunit M	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.9	3.7e-37
WP_104989219.1|2922256_2923345_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.9	1.1e-42
WP_005181550.1|2923368_2923827_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_104989220.1|2923966_2925370_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.7	1.3e-27
WP_004650081.1|2925432_2925771_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_104989221.1|2926047_2926275_+	membrane fusogenic activity	NA	NA	NA	NA	NA
WP_104989222.1|2926344_2927202_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_104989223.1|2927307_2929062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104989224.1|2929155_2929491_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_104989225.1|2929602_2929902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104989226.1|2930507_2931173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104989227.1|2931341_2933345_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_104989228.1|2933347_2934649_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_104989229.1|2934758_2938043_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_104989230.1|2938055_2939405_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	36.2	1.2e-62
WP_104989231.1|2939332_2939518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087662167.1|2939504_2940251_+|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	7.3e-14
WP_045796738.1|2940569_2942288_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_045796737.1|2942402_2943848_-	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_045796736.1|2944001_2945021_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_052690212.1|2945122_2945368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004645384.1|2945387_2946134_-|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.6e-13
WP_104989232.1|2946230_2946488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104989233.1|2946528_2947779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|2947975_2949001_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_000693745.1|2949358_2951314_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	41.1	2.1e-129
WP_004994718.1|2951712_2952738_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
WP_104989234.1|2952874_2955079_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_104989235.1|2955157_2955529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104989236.1|2955593_2957018_-|transposase	transposase	transposase	NA	NA	NA	NA
