The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	1081513	1094696	4840855		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|1081513_1082275_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|1082268_1082895_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1083034_1084174_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1084236_1085229_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1085322_1086687_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1086775_1087552_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1087556_1088195_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1088191_1089454_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1089450_1090359_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1090554_1091322_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|1091372_1092029_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1092134_1094696_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	1707570	1717012	4840855		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1707570_1708497_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1708501_1709233_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1709213_1709321_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1709380_1710112_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1710333_1712019_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1712015_1712735_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1712781_1713252_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1713292_1713754_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001374182.1|1713878_1715879_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292773.1|1715875_1717012_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 3
NZ_CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	1843173	1863047	4840855	transposase,holin,lysis,integrase	Enterobacteria_phage(44.44%)	20	1841635:1841648	1851256:1851269
1841635:1841648	attL	TACTGCTGCGCCAG	NA	NA	NA	NA
WP_104989426.1|1843173_1843377_+	DUF4102 domain-containing protein	NA	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.9e-33
WP_072163397.1|1843455_1844352_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.7	1.9e-173
WP_000132739.1|1844332_1844524_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_053908461.1|1844628_1844808_-	Eag protein	NA	K7PL40	Enterobacteria_phage	98.3	7.3e-29
WP_053908465.1|1845398_1846022_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.0	2.0e-113
WP_000783734.1|1846455_1846779_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|1846762_1847239_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_053908467.1|1847235_1847673_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	1.4e-68
WP_053908469.1|1848268_1848637_+	hypothetical protein	NA	K7PH35	Enterobacteria_phage	97.6	1.5e-60
WP_000807788.1|1848740_1848983_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113732.1|1848985_1849426_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_072163396.1|1851604_1851733_+	chemotaxis protein	NA	NA	NA	NA	NA
1851256:1851269	attR	CTGGCGCAGCAGTA	NA	NA	NA	NA
WP_000255956.1|1851746_1852769_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001297096.1|1852768_1853548_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001171554.1|1857410_1857791_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1857787_1858135_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_104989427.1|1858184_1859723_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	2.0e-292
WP_053908437.1|1859756_1860530_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.0	7.1e-12
WP_053908436.1|1860812_1861517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|1861885_1863047_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 4
NZ_CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	2352051	2372269	4840855	lysis,integrase	Escherichia_phage(30.77%)	23	2349263:2349276	2375878:2375891
2349263:2349276	attL	AAACATCTTCATCA	NA	NA	NA	NA
WP_000041556.1|2352051_2354478_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|2354676_2354982_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2355089_2355800_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2355802_2356363_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2356397_2356739_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2356873_2357200_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2357405_2358620_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2358631_2359651_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2359708_2359819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2359838_2361119_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_000005552.1|2361153_2361405_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001372999.1|2361477_2363949_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|2364042_2364234_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2364230_2364419_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|2364502_2364745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2364725_2365691_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|2365731_2366154_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|2366283_2367228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|2367775_2369125_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|2369442_2370045_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|2370404_2371385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2371904_2372012_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_012578894.1|2372113_2372269_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	2.5e-17
2375878:2375891	attR	TGATGAAGATGTTT	NA	NA	NA	NA
>prophage 5
NZ_CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	2777237	2788015	4840855	integrase	Enterobacteria_phage(40.0%)	11	2775210:2775233	2786718:2786741
2775210:2775233	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|2777237_2779193_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|2781557_2782097_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|2782279_2782591_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|2782587_2783268_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|2783264_2783423_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2783419_2784484_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2784637_2784856_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2784903_2785143_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2785282_2785519_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|2785508_2786651_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|2786764_2788015_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2786718:2786741	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
NZ_CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	2916822	2958370	4840855	transposase,integrase	Stx2-converting_phage(37.5%)	31	2955795:2955809	2961986:2962000
WP_021513032.1|2916822_2917281_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000976514.1|2918009_2919155_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|2919478_2920741_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000483766.1|2921006_2922353_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001505166.1|2922708_2922921_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_032262852.1|2923128_2923908_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_032180022.1|2925640_2927179_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
WP_000612601.1|2927228_2927576_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_021566758.1|2927572_2927953_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000107485.1|2928407_2929421_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998346.1|2929432_2930749_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|2930776_2931697_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|2932002_2932785_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104976704.1|2933497_2934726_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
WP_154761740.1|2935028_2935166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180018.1|2935328_2935964_+	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_001335688.1|2936045_2936483_+	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_000072197.1|2936545_2937370_-	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_001544449.1|2937618_2937957_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000192271.1|2938070_2939642_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_032180015.1|2939653_2940829_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_000757210.1|2940842_2942732_+	enterotoxin	NA	NA	NA	NA	NA
WP_024167628.1|2942900_2943107_-	methyltransferase	NA	NA	NA	NA	NA
WP_000622487.1|2943211_2944648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333439.1|2944644_2949603_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_032180014.1|2950277_2950841_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|2951661_2953095_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032141622.1|2953313_2953511_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|2953755_2954052_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_042002566.1|2955163_2956981_+	hypothetical protein	NA	NA	NA	NA	NA
2955795:2955809	attL	AAAAAATAATTTCTG	NA	NA	NA	NA
WP_000279872.1|2957167_2958370_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000279872.1|2957167_2958370_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
2961986:2962000	attR	AAAAAATAATTTCTG	NA	NA	NA	NA
>prophage 7
NZ_CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	3175154	3183924	4840855	integrase	Salmonella_phage(90.0%)	12	3174824:3174837	3183966:3183979
3174824:3174837	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|3175154_3175343_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_001376443.1|3175501_3177895_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001544405.1|3177891_3178749_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|3178745_3178973_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|3178972_3179206_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|3179273_3179615_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|3179732_3180029_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|3180036_3180546_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3180578_3180800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|3180945_3181824_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|3181835_3182780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|3182871_3183924_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3183966:3183979	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	3266076	3290710	4840855	lysis,integrase	Enterobacteria_phage(46.88%)	40	3265422:3265436	3290784:3290798
3265422:3265436	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|3266076_3267408_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000239881.1|3267807_3268476_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|3269366_3269927_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|3270315_3270549_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3270605_3271016_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3271367_3271520_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|3271507_3271975_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001372488.1|3271971_3272469_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3272468_3272684_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|3273953_3274913_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3275105_3275630_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3275785_3276163_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3276248_3276389_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3276385_3276748_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3276744_3277035_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3277027_3277198_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3277197_3277653_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3277649_3277751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3277843_3278296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3278292_3278853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3279337_3279631_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|3279627_3280329_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_077249941.1|3280325_3281345_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
WP_001182899.1|3281341_3281881_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|3281950_3282181_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3282285_3282975_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|3283097_3283847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3283843_3284671_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3285179_3285386_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3285461_3285758_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3285763_3286549_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|3286545_3287226_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3287222_3287405_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3287377_3287569_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3287579_3287861_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3287959_3288181_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|3288391_3288994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3289236_3289404_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3289443_3289662_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3289639_3290710_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3290784:3290798	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 9
NZ_CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	4164950	4171509	4840855	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|4164950_4165907_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4165907_4166675_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4167232_4167490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4168541_4169693_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4169612_4169963_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4170063_4170636_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4170684_4171509_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 10
NZ_CP026473	Escherichia coli strain KBN10P04869 chromosome, complete genome	4840855	4600113	4618632	4840855	tail,lysis,integrase	Escherichia_virus(25.0%)	22	4599956:4600002	4615844:4615890
4599956:4600002	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4600113_4600332_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000014361.1|4601579_4602479_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	4.0e-168
WP_000972099.1|4602694_4603222_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
WP_060621264.1|4603223_4604225_-	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	91.7	1.2e-176
WP_060621266.1|4604748_4605534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001695629.1|4605605_4606058_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_000917174.1|4606050_4606518_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_000040662.1|4606625_4607051_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
WP_060621267.1|4607038_4607464_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.4e-56
WP_000368931.1|4608753_4609827_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_001350076.1|4609831_4610857_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	3.3e-198
WP_001143634.1|4610853_4611792_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000554771.1|4612034_4612241_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001600138.1|4612240_4612693_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.4e-79
WP_000217670.1|4613289_4613790_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_024210514.1|4613786_4613984_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	96.9	1.8e-28
WP_000453534.1|4613959_4614232_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|4614384_4614678_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023386.1|4614747_4615728_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001223800.1|4615913_4616414_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4615844:4615890	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|4616563_4617262_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4617258_4618632_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP026474	Escherichia coli strain KBN10P04869 plasmid pKBN10P04869A, complete sequence	107229	2056	75184	107229	integrase,protease,transposase	Escherichia_phage(48.39%)	65	11520:11535	84105:84120
WP_000616807.1|2056_2710_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2802_3060_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2992_3394_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|5938_6643_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|6786_7341_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|7471_8302_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|8933_9638_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
11520:11535	attL	ATTCCAGTAAAGACAG	NA	NA	NA	NA
WP_001393253.1|11959_12292_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|12338_13214_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001067855.1|13595_14300_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|14884_15745_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000147567.1|18365_18926_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000134999.1|19498_20140_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001067858.1|21099_21804_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000240536.1|22559_23411_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|23718_24534_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|24594_25398_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|25397_26234_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|26294_26999_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|27138_27903_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|28395_28980_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|28979_30218_-	MFS transporter	NA	NA	NA	NA	NA
WP_023063803.1|30214_31129_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|31250_31955_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|31991_33119_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|33169_33397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|33420_33612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|34093_34636_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|34648_35509_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|37623_38328_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|38765_39626_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|40212_40917_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|41318_42332_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|42489_42963_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|43093_43882_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|44087_44435_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|44428_45268_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|45672_47214_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201169.1|47526_48558_+	protein-disulfide reductase DsbD N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004201168.1|48568_49207_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|49211_49577_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_023408309.1|49580_50393_-	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_001067855.1|50951_51656_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083725.1|52721_53219_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|53330_53621_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|53626_54418_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|54581_54929_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|54922_55762_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|55889_56093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|56667_57372_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000428546.1|57505_58099_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|58211_59417_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000088605.1|59498_60122_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_104989445.1|60965_61838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|62148_63376_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_042065278.1|64316_64499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066942.1|64619_65360_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361610.1|65644_66622_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001513660.1|67754_68114_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|68141_68321_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|68325_68706_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|68705_68927_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001553856.1|69109_70666_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001617890.1|70662_71946_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_031311986.1|72067_75184_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
84105:84120	attR	ATTCCAGTAAAGACAG	NA	NA	NA	NA
>prophage 1
NZ_CP026475	Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence	104701	523	103982	104701	portal,terminase,plate,holin,integrase,head,transposase	Escherichia_phage(62.77%)	101	4111:4126	74362:74377
WP_173678034.1|523_781_+	hypothetical protein	NA	A0A1B0V7P4	Salmonella_phage	84.8	7.8e-16
WP_032167109.1|839_2858_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	Q1MVI4	Enterobacteria_phage	95.2	0.0e+00
WP_000472529.1|2854_3760_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_001177860.1|3752_4037_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
4111:4126	attL	ATTTATTAGAGCAATT	NA	NA	NA	NA
WP_000890198.1|4499_5288_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	99.6	7.3e-121
WP_000007769.1|5327_5750_+	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000336812.1|5775_5916_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_001281116.1|5927_6320_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_001076427.1|6637_7498_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_104989446.1|8055_9252_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	99.7	1.1e-224
WP_000038866.1|9268_10270_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_059338140.1|10495_12202_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	6.3e-311
WP_104989447.1|12262_13852_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	99.2	2.4e-304
WP_104858482.1|13861_14677_+	hypothetical protein	NA	Q1MVJ7	Enterobacteria_phage	98.5	1.1e-111
WP_000035251.1|14712_15294_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
WP_000509939.1|15305_15815_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_053896077.1|15986_16583_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	100.0	6.3e-109
WP_096282570.1|16918_18088_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.5	2.4e-205
WP_024187338.1|18245_19091_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.9	1.5e-151
WP_074526535.1|19120_19921_-	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.2	3.5e-147
WP_104989448.1|20085_21129_-	phage antirepressor KilAC domain-containing protein	NA	Q71TN2	Escherichia_phage	97.7	1.9e-185
WP_016231365.1|21125_21347_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.3	8.1e-38
WP_000908460.1|21926_22244_+	hypothetical protein	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
WP_104989449.1|22251_23031_+	hypothetical protein	NA	Q71TC6	Escherichia_phage	96.1	2.7e-144
WP_024230880.1|23240_23807_+	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.4	9.5e-99
WP_000523980.1|23817_24429_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_001615638.1|24443_25325_+	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.3	1.8e-173
WP_104989450.1|25406_29126_+	transglycosylase SLT domain-containing protein	NA	Q71TP0	Escherichia_phage	87.9	0.0e+00
WP_000002800.1|29125_29482_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_029487598.1|29478_30912_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
WP_001561131.1|30911_31748_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
WP_029487597.1|31826_32261_+	hypothetical protein	NA	Q71TD4	Escherichia_phage	98.6	3.7e-74
WP_001619155.1|35976_36210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000332809.1|36661_36943_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	97.8	8.7e-45
WP_000887652.1|37010_37340_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|37336_37780_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000164724.1|37766_38369_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_097434456.1|38370_40290_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	98.6	0.0e+00
WP_096935682.1|40286_40652_+	ddrA	NA	Q1MVM8	Enterobacteria_phage	96.7	1.5e-44
WP_104989451.1|40664_43652_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.3	0.0e+00
WP_104989452.1|43641_43959_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	86.7	1.9e-43
WP_086722952.1|43989_44778_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	95.0	2.4e-140
WP_104989465.1|44784_45462_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	96.9	7.9e-124
WP_001272932.1|45968_46790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240574.1|47328_52092_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001552205.1|52167_52428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807722.1|52579_54613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333349.1|54629_56168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000414651.1|56154_57402_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032272090.1|57560_58049_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	98.8	5.5e-87
WP_104989466.1|58218_58776_+	lysozyme	NA	Q71TF3	Escherichia_phage	99.5	2.7e-106
WP_096038037.1|59067_60087_-|head	head processing protein	head	Q71TR6	Escherichia_phage	99.7	1.2e-184
WP_104989454.1|60079_61789_-|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.5	0.0e+00
WP_104989455.1|61865_68633_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.4	0.0e+00
WP_000224043.1|68666_69107_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|69103_69352_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_104989456.1|69393_70698_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	30.4	1.2e-06
WP_104989457.1|70754_71396_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	99.1	8.2e-115
WP_032333514.1|71583_72144_-	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	97.8	4.2e-99
WP_104989458.1|72391_72703_-	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	98.1	6.7e-46
WP_096038043.1|72753_73785_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.1	1.9e-193
WP_000542332.1|73792_74014_-	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_000874154.1|74617_74827_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
74362:74377	attR	AATTGCTCTAATAAAT	NA	NA	NA	NA
WP_000611656.1|74937_75789_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000124150.1|75813_77298_-|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000219625.1|77297_78491_-	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	88.7	7.2e-181
WP_001326849.1|78576_79029_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_023356283.1|79117_80161_-	DUF968 domain-containing protein	NA	Q1MVE3	Enterobacteria_phage	99.7	1.8e-207
WP_001339207.1|80188_80368_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
WP_001216045.1|80372_80753_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_001190712.1|80752_80974_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506730.1|81046_81436_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
WP_104989459.1|81610_82195_+	DNA-binding protein	NA	Q1MVE8	Enterobacteria_phage	97.9	2.8e-109
WP_001261543.1|83616_83979_-	hypothetical protein	NA	A0A1B0VBR1	Salmonella_phage	100.0	9.8e-57
WP_104989460.1|83975_84908_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	97.7	4.5e-178
WP_023356289.1|84889_85264_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.8	4.9e-67
WP_000269004.1|85270_85564_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
WP_104989461.1|86058_86943_-	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	97.7	6.9e-120
WP_000797279.1|87456_87645_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_053893085.1|87990_88488_-	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	61.1	2.4e-45
WP_000476202.1|88484_88724_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	92.4	2.0e-34
WP_000158003.1|88716_88920_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_104989462.1|89003_89732_-	hypothetical protein	NA	Q71T76	Escherichia_phage	98.7	2.4e-139
WP_000021766.1|89926_90433_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	100.0	4.8e-94
WP_000107689.1|90505_91768_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	100.0	5.4e-235
WP_000684845.1|92069_92771_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_001354545.1|92767_93445_-	metallophosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000484110.1|93441_94068_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_000096174.1|94569_94725_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_024946687.1|94791_95370_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.0	7.4e-107
WP_032205128.1|95372_95618_-	hypothetical protein	NA	Q71T86	Escherichia_phage	98.8	6.2e-39
WP_000235786.1|95764_96142_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141908.1|96151_97369_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000896801.1|97372_98101_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_000602717.1|98087_98873_+	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000212018.1|98874_99891_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000535202.1|99883_100516_+|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
WP_104989463.1|100562_101561_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	97.0	3.8e-191
WP_104989464.1|101560_102925_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	99.8	1.1e-252
WP_000234829.1|103392_103557_-	DUF3927 family protein	NA	A0A1B0VDU8	Salmonella_phage	100.0	1.2e-17
WP_000900640.1|103556_103982_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
