The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	19173	81800	5087117	portal,lysis,protease,integrase,head,capsid,tail,terminase,holin	Escherichia_phage(35.42%)	72	11793:11808	77062:77077
11793:11808	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_000113674.1|19173_20304_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|20281_20530_-	excisionase	NA	NA	NA	NA	NA
WP_000048434.1|20594_23066_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|23158_23350_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|23346_23535_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|23935_24100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|24100_24322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|24481_24637_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|24929_25268_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|25659_25902_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|25885_26311_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|26382_27453_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151217.1|27493_27916_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	4.1e-62
WP_014639476.1|28107_29070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|29085_30087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|30495_30603_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|30647_30860_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|31027_31306_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|31307_32354_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|32366_32741_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|32737_33559_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|33783_33981_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|34131_35181_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_001331709.1|36455_36683_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|36951_37167_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|37171_37516_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|37481_37754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082537.1|38692_39157_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|39464_39875_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|39932_40166_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|40552_41101_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622379.1|41072_43001_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000259002.1|42984_43191_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|43187_44780_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_001253963.1|44769_46275_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_000256813.1|46311_46659_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522602.1|46716_47745_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	2.1e-112
WP_000201495.1|47796_48180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|48172_48526_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|48541_49075_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|49071_49467_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|49474_50227_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|50240_50672_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|50698_51112_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|51092_53666_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847402.1|53662_53992_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|53991_54690_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|54694_55438_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|55374_55977_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|56050_56389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515772.1|56455_59935_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001233195.1|60002_60602_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_016230679.1|60753_63729_+|tail	phage tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	85.3	2.1e-48
WP_000885580.1|63728_64313_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|64367_65036_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|65092_65362_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001079492.1|66134_66641_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|66686_67187_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|67272_67452_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|67832_68639_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|68638_69832_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|69843_71202_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|71205_72801_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|72800_74363_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|74454_74499_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|74636_75518_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|75514_76135_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|76162_78058_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
77062:77077	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
WP_001291206.1|78270_79146_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|79185_79776_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|79772_80531_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|80750_81800_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 2
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	690348	730256	5087117	portal,protease,integrase,head,capsid,tail,terminase,holin	Escherichia_phage(46.15%)	52	721508:721524	751072:751088
WP_061091365.1|690348_690627_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_104976637.1|690623_692687_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	7.2e-152
WP_021519067.1|692751_693351_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	5.9e-107
WP_104976638.1|693418_697117_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	75.6	0.0e+00
WP_014639483.1|697177_697786_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.9e-101
WP_000140743.1|697722_698466_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
WP_061091360.1|698471_699170_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	4.0e-131
WP_001330090.1|699169_699526_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_061091359.1|699503_702731_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
WP_071590020.1|702777_703038_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001324129.1|703079_703466_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097526.1|703465_704170_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001206306.1|704230_704575_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_014639219.1|704571_705021_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001147814.1|705017_705356_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|705364_705682_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_061091386.1|705758_706976_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|706990_707590_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923132.1|707582_708809_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
WP_001140907.1|708956_710714_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001554177.1|710713_711196_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
WP_001111090.1|711343_711694_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_000351660.1|711832_712372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100260.1|712377_712644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137443514.1|712861_713047_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.7	3.2e-19
WP_000992100.1|713263_713797_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_042068861.1|713860_714211_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	98.8	1.8e-39
WP_000839572.1|714215_714431_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_021526742.1|715328_716210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021526743.1|716225_716489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024190350.1|716478_716877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024190351.1|716912_717278_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	6.4e-56
WP_061091385.1|717270_717642_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.7e-35
WP_061091384.1|717654_718704_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.8e-109
WP_024193993.1|718705_718984_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013627.1|719151_719364_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	3.4e-25
WP_000150294.1|719544_720210_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_021543289.1|720384_720810_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	2.2e-63
WP_000451007.1|720825_721596_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
721508:721524	attL	GCCTCTTCACGACTGAT	NA	NA	NA	NA
WP_000788950.1|721617_722364_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095671.1|722370_723333_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693845.1|723355_723781_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|723777_724032_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|724111_724531_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_042030300.1|724889_725189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|725260_725479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122998275.1|725482_725668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|726028_726217_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_016235603.1|726213_726405_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_104976639.1|726497_728969_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
WP_000096344.1|729027_729231_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_045171449.1|729230_730256_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.6	2.6e-102
751072:751088	attR	GCCTCTTCACGACTGAT	NA	NA	NA	NA
>prophage 3
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	835174	843890	5087117		Enterobacteria_phage(42.86%)	8	NA	NA
WP_000735124.1|835174_836302_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
WP_001362820.1|836311_837550_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_001100791.1|837581_838130_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_000857549.1|838134_839013_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023627.1|839070_839970_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000699418.1|839969_841055_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_000183060.1|841427_842321_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115981.1|842495_843890_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
>prophage 4
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	898562	960676	5087117	portal,lysis,integrase,plate,head,capsid,tail,terminase,holin,tRNA	Escherichia_phage(41.86%)	69	890505:890520	950374:950389
890505:890520	attL	GGCGTTTATCATCGCC	NA	NA	NA	NA
WP_000476019.1|898562_899924_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_000468308.1|900196_900415_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882921.1|900496_901660_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	3.1e-205
WP_000978873.1|901659_902139_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.1	2.1e-83
WP_000069909.1|902153_904601_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.8	0.0e+00
WP_000785970.1|904593_904713_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|904745_905021_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251412.1|905077_905596_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_001286695.1|905568_906801_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	1.1e-224
WP_000836023.1|907131_907509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447266.1|907531_908116_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.5	3.0e-07
WP_000711883.1|908222_909065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001164151.1|909486_910014_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	92.0	4.9e-89
WP_000104719.1|910017_912747_-|tail	tail protein	tail	Q858V4	Yersinia_virus	81.6	0.0e+00
WP_001285322.1|912757_913288_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.9	1.5e-101
WP_001121478.1|913280_914189_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_000127164.1|914193_914541_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001093701.1|914537_915173_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.1e-111
WP_001001811.1|915239_915692_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	9.1e-76
WP_000917155.1|915684_916152_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_001300730.1|916114_916288_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040663.1|916259_916685_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	6.1e-66
WP_000736608.1|916672_917098_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001144105.1|917112_917610_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	4.0e-93
WP_000123123.1|917609_917891_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846408.1|917894_918098_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	6.8e-31
WP_000988632.1|918097_918607_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	4.3e-90
WP_000203455.1|918706_919450_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
WP_001248549.1|919453_920527_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.4	1.9e-201
WP_001085959.1|920585_921440_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.3e-136
WP_000156837.1|921613_923386_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_000038157.1|923385_924420_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	1.6e-200
WP_000423308.1|924923_927140_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000268633.1|927363_929655_-	replication endonuclease	NA	M1SV59	Escherichia_phage	97.6	0.0e+00
WP_000027664.1|929644_929920_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|929916_930141_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277898.1|930143_930443_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557703.1|930442_930667_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217671.1|930730_931231_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000043869.1|931408_931684_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001350698.1|931798_932098_+	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	100.0	3.3e-50
WP_000985260.1|932213_933227_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001350699.1|933661_933979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807360.1|934394_935294_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_000178556.1|935375_936155_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844241.1|936254_937295_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490666.1|937342_938698_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823289.1|938701_938986_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182910.1|939016_939469_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853836.1|939478_940741_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289810.1|940769_941624_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|941852_942905_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858523.1|943161_944439_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846205.1|944435_945440_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	2.2e-13
WP_000011933.1|945436_946402_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434049.1|946375_947122_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297940.1|947173_947992_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822262.1|948056_948857_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195614.1|948853_949642_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|949864_950137_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134614.1|950257_951082_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
950374:950389	attR	GGCGTTTATCATCGCC	NA	NA	NA	NA
WP_000153067.1|951300_951639_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405724.1|951720_952755_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945347.1|952770_955251_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677332.1|955266_955941_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830454.1|956021_956564_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001046487.1|956857_957139_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|957401_958511_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001350700.1|958642_960676_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 5
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	972766	982211	5087117		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|972766_973903_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|973899_975903_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|976027_976489_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|976529_977000_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|977046_977766_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|977762_979448_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|979669_980401_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|980460_980568_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|980548_981280_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|981284_982211_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 6
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	1190802	1260950	5087117	portal,lysis,integrase,head,coat,terminase,holin,tRNA	Enterobacteria_phage(75.0%)	84	1207760:1207776	1253067:1253083
WP_001283598.1|1190802_1191615_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|1191614_1192628_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|1192693_1193830_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|1193928_1194924_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|1194920_1196099_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|1196363_1197584_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|1197742_1199749_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|1199869_1200148_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|1200181_1200730_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|1200729_1201539_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|1201538_1202363_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|1202366_1203452_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|1203486_1204419_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|1204584_1205136_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|1205455_1206298_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|1206299_1206827_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|1206823_1207303_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|1207299_1207803_-	fimbrial protein	NA	NA	NA	NA	NA
1207760:1207776	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_000120670.1|1207819_1208572_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|1208591_1211240_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195816.1|1212428_1212914_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|1213116_1215261_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|1215260_1216571_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|1216751_1217036_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|1217407_1218748_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|1218805_1219561_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|1219854_1220787_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958671.1|1221098_1222256_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_061091379.1|1223334_1226280_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.3	0.0e+00
WP_001350929.1|1226380_1227283_-	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.0	1.5e-167
WP_000410001.1|1227515_1227668_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001051911.1|1227782_1228031_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000903306.1|1228030_1228567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198454.1|1228615_1229065_-	hypothetical protein	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000064337.1|1229073_1229640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011703616.1|1229836_1230166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350932.1|1230183_1231965_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.2	2.5e-92
WP_001622250.1|1231990_1232200_-	hypothetical protein	NA	I1TEJ6	Salmonella_phage	82.2	2.8e-11
WP_000257015.1|1232196_1233648_-	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
WP_000964905.1|1233658_1234351_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
WP_000627629.1|1234353_1234809_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000785531.1|1234808_1235510_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_001122367.1|1235509_1236928_-	Packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_001140510.1|1236937_1237399_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001389518.1|1237379_1237568_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_000370106.1|1237609_1238863_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
WP_000372589.1|1238881_1239775_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818371.1|1239865_1242064_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000200779.1|1242065_1243481_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000113731.1|1243477_1243918_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|1243920_1244163_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|1244390_1244933_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|1245138_1245291_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001350934.1|1245278_1245716_-|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_000229389.1|1245712_1246189_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|1246172_1246496_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_104976642.1|1247092_1247611_-	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	99.4	2.6e-95
WP_000994516.1|1247607_1247796_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|1247792_1248155_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002245.1|1248151_1248442_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001004257.1|1248441_1249164_-	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950973.1|1249156_1249333_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000177653.1|1249325_1249751_-	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_001254264.1|1249747_1249924_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000814617.1|1249920_1250331_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_000229808.1|1250960_1251167_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_001248388.1|1251239_1252616_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001350936.1|1252612_1253560_-	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	4.4e-157
1253067:1253083	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
WP_001244621.1|1253562_1253835_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|1253857_1254151_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|1254259_1254445_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|1254525_1255176_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000219332.1|1255698_1255998_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
WP_000167596.1|1256006_1256477_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_014532157.1|1256566_1256842_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_000031365.1|1257098_1257704_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|1257703_1258087_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|1258110_1258407_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|1258501_1259020_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|1259016_1259316_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|1259317_1259890_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000002106.1|1260167_1260452_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|1260524_1260692_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|1260749_1260950_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 7
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	1476705	1568111	5087117	portal,lysis,protease,tail,terminase,holin,tRNA	Enterobacteria_phage(47.46%)	93	NA	NA
WP_000083664.1|1476705_1477443_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1477574_1478909_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|1478941_1479823_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|1479925_1480513_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1480568_1480952_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|1481256_1481946_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|1481993_1483031_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1483237_1483657_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|1483725_1484424_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|1484455_1487116_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1487229_1488585_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|1488630_1488954_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|1488950_1490249_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|1498731_1501305_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|1501434_1502166_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079096.1|1502162_1503143_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1503277_1504015_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1504284_1504626_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|1504729_1504777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|1504875_1506036_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|1506078_1507200_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|1507210_1508281_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|1508490_1508856_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|1509004_1509523_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|1509512_1510739_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|1510754_1511237_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1511313_1511661_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1511702_1512470_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1512500_1513049_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1513067_1513316_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1513452_1514814_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1514980_1515772_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|1515792_1517079_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|1517133_1517727_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|1517849_1518728_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|1518813_1520475_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1520623_1520965_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|1521026_1521317_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|1521306_1521783_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1521914_1522397_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_072097749.1|1523202_1524417_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	1.0e-33
WP_001288444.1|1524451_1525885_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_001011831.1|1526966_1527746_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000355360.1|1527947_1528241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104976644.1|1528253_1528532_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	4.5e-25
WP_021512857.1|1528528_1530592_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	55.1	1.5e-125
WP_001596836.1|1530656_1531256_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	1.1e-105
WP_104976645.1|1531323_1535022_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	74.9	0.0e+00
WP_001445893.1|1535082_1535730_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	2.7e-113
WP_032151176.1|1535627_1536371_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.0e-148
WP_104976646.1|1536375_1537074_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	96.1	4.4e-130
WP_000447253.1|1537083_1537413_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_104976647.1|1537412_1540478_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.6	0.0e+00
WP_001161009.1|1540449_1540779_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|1540787_1541174_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_053290591.1|1541234_1541978_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	1.7e-132
WP_001079400.1|1541988_1542390_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	1.1e-72
WP_000677106.1|1542386_1542965_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|1542976_1543252_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|1543244_1543568_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_077827153.1|1543654_1545682_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.1	0.0e+00
WP_000985939.1|1545626_1547135_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	1.0e-288
WP_001072975.1|1547134_1547347_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507030.1|1547343_1549443_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	0.0e+00
WP_000421825.1|1549451_1549991_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001139681.1|1550663_1550816_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_001300226.1|1550803_1551271_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	100.0	2.9e-77
WP_059336915.1|1551267_1551801_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	2.5e-101
WP_059336916.1|1551856_1552171_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	97.1	2.0e-50
WP_000839572.1|1552175_1552391_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000217632.1|1553212_1553638_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_001047112.1|1553918_1554671_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	6.9e-137
WP_001360050.1|1554684_1555674_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061380.1|1555681_1556491_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
WP_001402832.1|1556510_1556900_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	4.6e-68
WP_000210170.1|1556896_1557223_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_021551567.1|1557219_1557873_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
WP_001315196.1|1557872_1558367_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_024249647.1|1558363_1559182_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
WP_000620698.1|1559178_1559403_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_104976648.1|1559399_1560548_-	peptidase	NA	A5LH69	Enterobacteria_phage	80.6	2.9e-163
WP_000515860.1|1560544_1561096_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001557924.1|1561088_1561349_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	2.7e-40
WP_104976649.1|1561446_1562139_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	4.9e-121
WP_000135680.1|1562861_1563224_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|1563289_1564114_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008210.1|1564241_1564778_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242962.1|1564768_1565131_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.6e-65
WP_001331173.1|1565127_1565343_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|1565402_1565609_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531797.1|1565569_1566745_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	2.7e-148
WP_001293201.1|1567040_1567289_+	hypothetical protein	NA	I6PCV4	Cronobacter_phage	80.5	3.3e-27
WP_000457798.1|1567292_1568111_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	79.2	1.3e-117
>prophage 8
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	1641554	1648694	5087117		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|1641554_1644116_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|1644221_1644878_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|1644928_1645696_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|1645891_1646800_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|1646796_1648059_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|1648055_1648694_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 9
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	3948737	4001559	5087117	plate,integrase,transposase	Enterobacteria_phage(20.0%)	49	3989293:3989312	4001645:4001664
WP_000224516.1|3948737_3950084_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013423.1|3950086_3950611_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433564.1|3950607_3951900_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896714.1|3951904_3952954_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863402.1|3952917_3954759_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000946068.1|3954764_3955190_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|3955194_3956679_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|3956701_3957205_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|3957910_3958429_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_021524646.1|3958649_3960632_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.6	6.9e-27
WP_104976688.1|3960738_3961785_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528853.1|3961777_3963217_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|3963191_3963482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021555008.1|3964732_3965236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|3965329_3965818_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|3966088_3966859_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|3967012_3967486_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973137.1|3967528_3969973_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|3970212_3970791_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|3970995_3971763_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3971733_3972474_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|3972785_3973535_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_000006241.1|3973710_3974208_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_014639450.1|3974290_3974449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350633.1|3974527_3976267_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001350632.1|3976226_3976997_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|3977067_3978123_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|3978174_3978468_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|3978470_3978869_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|3978878_3979331_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001331869.1|3979508_3980660_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
WP_000602123.1|3980656_3981271_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|3981327_3982785_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291988.1|3983045_3983504_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189577.1|3983595_3984840_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|3984897_3985299_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749902.1|3985408_3986464_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|3986752_3987856_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|3987867_3989121_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
3989293:3989312	attL	ACTCCTATTATCGGCACCAT	NA	NA	NA	NA
WP_001273869.1|3990635_3991187_-	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
WP_000606594.1|3993116_3993686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580785.1|3993994_3994198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390657.1|3994197_3994506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976689.1|3995501_3995699_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000013185.1|3995703_3996087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999103.1|3996101_3997133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000890042.1|3997518_3999420_+	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.5	1.5e-42
WP_000974933.1|3999493_4000150_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	62.0	1.3e-59
WP_032143510.1|4000224_4001559_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4001645:4001664	attR	ACTCCTATTATCGGCACCAT	NA	NA	NA	NA
>prophage 10
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	4261586	4314092	5087117	portal,protease,integrase,tail,terminase,holin,tRNA	Enterobacteria_phage(33.33%)	67	4272397:4272411	4316467:4316481
WP_000912345.1|4261586_4262972_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_104976692.1|4263007_4263529_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4263636_4263849_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4263850_4264717_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001298992.1|4265079_4266243_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000433949.1|4266098_4266470_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_000206737.1|4266469_4266775_-	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_001242749.1|4266774_4267137_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008200.1|4267127_4267664_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|4267791_4268616_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|4268681_4269044_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|4269730_4270405_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4270495_4270696_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|4270739_4271291_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_021524652.1|4271287_4272124_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	98.9	1.4e-151
WP_024186770.1|4272128_4272353_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	89.2	1.0e-32
WP_000995577.1|4272349_4272649_+	hypothetical protein	NA	NA	NA	NA	NA
4272397:4272411	attL	TCAGCGCCTGATTAT	NA	NA	NA	NA
WP_021524650.1|4272645_4273641_+	hypothetical protein	NA	Q8SBF1	Shigella_phage	87.9	3.8e-50
WP_021524670.1|4273637_4274132_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_021531977.1|4274131_4274785_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_021524668.1|4274781_4275108_+	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	2.7e-53
WP_000767103.1|4275104_4275494_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_021531991.1|4275513_4276311_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_001223333.1|4276326_4276842_+	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_021524665.1|4276851_4277841_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	4.4e-192
WP_001204806.1|4277858_4278239_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_077462104.1|4278336_4278669_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.9	2.0e-48
WP_021524664.1|4279450_4281421_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	66.0	5.4e-250
WP_001304601.1|4281557_4281740_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_016236026.1|4281777_4282047_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	71.9	2.2e-08
WP_000284510.1|4282122_4282338_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_021524663.1|4282342_4282687_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_021524662.1|4282652_4282925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033551806.1|4283030_4283564_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	5.3e-99
WP_122986666.1|4284082_4284268_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	7.1e-19
WP_016236020.1|4284782_4285259_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_001077619.1|4285255_4287379_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_000102415.1|4287375_4287588_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_016236019.1|4287587_4289090_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.4	4.5e-289
WP_128958825.1|4289079_4291059_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	99.4	0.0e+00
WP_001097059.1|4291146_4291473_+	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
WP_001281346.1|4291465_4291747_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_016236016.1|4291749_4292373_+	hypothetical protein	NA	S5MBY4	Escherichia_phage	98.1	4.7e-99
WP_000682708.1|4292385_4292784_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_016234254.1|4292791_4293538_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	1.7e-124
WP_016236015.1|4293556_4293988_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	8.2e-42
WP_000533397.1|4294014_4294419_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	6.9e-43
WP_021524658.1|4294408_4297021_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847298.1|4297017_4297347_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_021524657.1|4297346_4298045_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_001528990.1|4298055_4298799_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	3.7e-143
WP_077792027.1|4298744_4299377_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	7.1e-103
WP_021527897.1|4299623_4303316_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
WP_021519067.1|4303383_4303983_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	5.9e-107
WP_104976693.1|4304047_4306111_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.2	4.6e-151
WP_001204581.1|4306107_4306386_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355700.1|4306395_4306689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|4306728_4306827_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_158672576.1|4306853_4307537_-	methyltransferase	NA	NA	NA	NA	NA
WP_000937499.1|4307605_4307911_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226381.1|4308094_4309579_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201822.1|4309765_4310719_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001331488.1|4311193_4311502_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	81.8	7.4e-37
WP_001304815.1|4311521_4311821_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	80.0	6.5e-30
WP_000259980.1|4311878_4312184_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
WP_000239877.1|4312238_4312907_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201816.1|4313138_4314092_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
4316467:4316481	attR	TCAGCGCCTGATTAT	NA	NA	NA	NA
>prophage 11
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	4623935	4634055	5087117	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_000188147.1|4623935_4625882_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4625954_4626179_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4626501_4626822_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4626852_4629129_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|4629841_4630825_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_104976699.1|4630821_4634055_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.9	5.0e-83
>prophage 12
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	4786455	4828003	5087117	transposase,integrase	Stx2-converting_phage(37.5%)	32	4785685:4785699	4789017:4789031
4785685:4785699	attL	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_000279872.1|4786455_4787658_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_042002566.1|4787844_4789662_-	hypothetical protein	NA	NA	NA	NA	NA
4789017:4789031	attR	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_001303889.1|4790773_4791070_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032141622.1|4791314_4791512_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335695.1|4791730_4793164_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032180014.1|4793984_4794548_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_104976711.1|4795222_4800181_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000622487.1|4800177_4801614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024167628.1|4801718_4801925_+	methyltransferase	NA	NA	NA	NA	NA
WP_000757210.1|4802093_4803983_-	enterotoxin	NA	NA	NA	NA	NA
WP_032180015.1|4803996_4805172_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000192271.1|4805183_4806755_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000195940.1|4806868_4807273_-	aldolase	NA	NA	NA	NA	NA
WP_000072197.1|4807455_4808280_+	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_001335688.1|4808342_4808780_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_032180018.1|4808861_4809497_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_154761740.1|4809659_4809797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976704.1|4810099_4811327_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
WP_001387298.1|4811940_4812039_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|4812040_4812823_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4813128_4814049_+	ribokinase	NA	NA	NA	NA	NA
WP_000998346.1|4814076_4815393_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_104976705.1|4815404_4816418_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_021566758.1|4816872_4817253_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000612601.1|4817249_4817597_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_032180022.1|4817646_4819185_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
WP_072129716.1|4820914_4821697_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_000179884.1|4821940_4822117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000547185.1|4822490_4823819_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000608644.1|4824084_4825347_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000976514.1|4825670_4826816_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_021513032.1|4827544_4828003_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
>prophage 13
NZ_CP026491	Escherichia coli strain HS13-1 chromosome, complete genome	5087117	4954340	4999574	5087117	portal,lysis,protease,integrase,head,capsid,tail,terminase,tRNA	Enterobacteria_phage(55.36%)	65	4944860:4944873	4974631:4974644
4944860:4944873	attL	CACCACCACAAATG	NA	NA	NA	NA
WP_001298466.1|4954340_4955447_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_063115992.1|4955500_4955962_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|4955971_4956625_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4956796_4958047_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|4958160_4959303_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|4959292_4959529_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|4959668_4959908_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|4959891_4960218_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|4960217_4960439_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|4960825_4961017_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|4960989_4961172_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|4961168_4961849_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|4961845_4962631_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|4962636_4962933_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|4963008_4963152_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|4963120_4963285_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|4963357_4963726_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|4963908_4964109_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|4964322_4964904_+	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|4964920_4965193_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|4965170_4965353_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|4965629_4966382_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|4966378_4966936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|4966975_4967671_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|4967746_4967962_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|4968103_4968400_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|4968432_4969332_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788873.1|4969328_4970030_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	6.4e-129
WP_000145927.1|4970026_4970317_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|4970390_4970831_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|4970827_4971355_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|4971351_4971528_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|4971530_4971872_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950951.1|4971864_4972059_+	protein ninF	NA	NA	NA	NA	NA
WP_001099712.1|4972078_4972441_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|4972437_4972578_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|4972663_4973047_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|4973235_4974318_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|4974906_4975122_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
4974631:4974644	attR	CATTTGTGGTGGTG	NA	NA	NA	NA
WP_001135277.1|4975121_4975619_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|4975835_4976018_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|4976108_4976402_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|4976882_4977209_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|4977415_4977598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867565.1|4978160_4978709_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.8e-57
WP_001304453.1|4978680_4980609_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000258997.1|4980592_4980799_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|4980795_4982388_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000256840.1|4983951_4984299_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522649.1|4984356_4985385_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	1.0e-114
WP_000201530.1|4985436_4985811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|4985803_4986157_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|4986168_4986747_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|4986743_4987139_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001350574.1|4987146_4987887_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|4987902_4988325_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459485.1|4988306_4988741_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	89.2	3.4e-56
WP_000840269.1|4988733_4991295_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000847405.1|4991291_4991621_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|4991620_4992319_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|4992324_4993068_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|4993004_4993637_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515327.1|4993697_4997180_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290543.1|4997238_4999299_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|4999295_4999574_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 1
NZ_CP026494	Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence	201203	7112	77539	201203	integrase,protease,transposase,bacteriocin	Enterobacteria_phage(21.05%)	48	4115:4129	46804:46818
4115:4129	attL	GCCAGGGGAATATCT	NA	NA	NA	NA
WP_001066954.1|7112_7853_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|7973_8162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|8536_9445_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_001696610.1|9507_10617_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|11048_12002_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001595315.1|13274_13691_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.6	3.3e-16
WP_001696612.1|15405_16593_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	6.0e-10
WP_001610286.1|16589_18530_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001696614.1|18533_19904_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_001610297.1|22299_23076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976717.1|23077_25342_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_001610302.1|27683_28055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610303.1|28097_28565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610304.1|28564_28834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610305.1|29065_30463_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000450493.1|31097_32291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948338.1|32745_34019_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.8e-175
WP_000738422.1|34680_34974_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|38118_39234_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_011402704.1|39247_43033_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_000933675.1|43136_44366_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271277.1|44450_45407_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|45451_47629_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
46804:46818	attR	AGATATTCCCCTGGC	NA	NA	NA	NA
WP_001190233.1|48473_49508_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
WP_000377483.1|50067_50376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969988.1|50474_50657_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001324224.1|50653_50851_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_001332356.1|51565_52807_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001183603.1|52781_54896_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	4.8e-34
WP_001259758.1|55065_55377_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|55354_55591_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|56530_56800_+	membrane protein	NA	NA	NA	NA	NA
WP_001017347.1|56796_57777_+	FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_001282162.1|57843_58233_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	98.4	6.6e-67
WP_000612591.1|58229_58577_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_104976718.1|60753_64887_-|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.5	4.7e-296
WP_029402714.1|65852_67004_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
WP_000124098.1|67125_67491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487120.1|67957_68968_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	1.1e-20
WP_000086538.1|69545_70136_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	6.2e-24
WP_000756335.1|70490_71489_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000110581.1|71488_72526_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000020503.1|72525_73287_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
WP_001128098.1|73298_74531_+	MFS transporter	NA	NA	NA	NA	NA
WP_000412701.1|74608_74866_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000451769.1|74866_75100_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001334660.1|75852_75972_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001442106.1|77197_77539_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	92.4	5.5e-41
>prophage 1
NZ_CP026492	Escherichia coli strain HS13-1 plasmid pHS13-1-IncHI2, complete sequence	264344	1718	57729	264344	transposase,integrase	Escherichia_phage(34.78%)	57	1518:1577	34629:36065
1518:1577	attL	TTCTCTGGTTCTGAAATCCATCCCTGTCGGTGTTGCTTATGCAGTCTGGTCGGGACTCGG	NA	NA	NA	NA
WP_000259031.1|1718_2558_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|2685_2889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|3113_3818_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4007_4823_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4973_5678_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032492336.1|6127_7357_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_000612791.1|7502_8366_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|8403_8649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|9117_9909_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000800531.1|11088_11421_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|11590_12382_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|12474_13734_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|13995_14787_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|14792_15083_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|15194_15692_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_104976712.1|15836_16850_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	3.0e-71
WP_000454193.1|17052_17403_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|17528_18089_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|18091_21043_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|21051_21453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|21537_22242_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|23166_24051_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058100717.1|24267_25482_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|25509_25815_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063609966.1|26176_27133_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	3.4e-72
WP_001067858.1|27169_27874_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012537714.1|28157_28814_+	quinolone resistance pentapeptide repeat protein QnrS2	NA	NA	NA	NA	NA
WP_077898834.1|29097_29757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|29702_30407_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|31443_31998_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|32128_32959_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|33096_33729_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|33813_34266_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|34488_34836_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|34829_35669_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|35796_36000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|36117_36822_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
34629:36065	attR	TTCTCTGGTTCTGAAATCCATCCCTGTCGGTGTTGCTTATGCAGTCTGGTCGGGACTCGGCGTCGTCATAATTACAGCCATTGCCTGGTTGCTTCATGGGCAAAAGCTTGATGCGTGGGGCTTTGTAGGTATGGGGCTCATAATTGCTGCCTTTTTGCTCGCCCGATCCCCATCGTGGAAGTCGCTGCGGAGGCCGACGCCATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAGCATTCACCTTCCGGCCGCCCGCTAGCGGACCCTGGTCAGGTTCCGCGAAGGTGGGCGCAGACATGCTGGGCTCGTCAGGATCAAACTGCACTATGAGGCGGCGGTTCATACCGCGCCAGGGGAGCGAATGGACAGCGAGGAGCCTCCGAACGTTCGGGTCGCCTGCTCGGGTGATATCGACGAGGTTGTGCGGCTGATGCACGACGCTGCGGCGTGGATGTCCGCCAAGGGAACGCCCGCCTGGGACGTCGCGCGGATCGACCGGACATTCGCGGAGACCTTCGTCCTGAGATCCGAGCTCCTAGGGATCGCCTCAGAAAACGGAAAATAAAGCACGCTAAGCCGTAAGTAAGCGTGCTCCTGTGAAAGCCACAGCTAAAACTGCGTAGTACACAT	NA	NA	NA	NA
WP_000844627.1|38459_38702_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|38733_39384_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|39489_40689_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|40720_41605_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|41742_42135_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_031613424.1|43999_44350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|44726_45044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|45094_45502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|45531_45993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|46329_46560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|47221_47455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975182.1|47676_48573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572389.1|48575_49091_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|49305_50733_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000078514.1|50983_52303_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_001572381.1|52582_53788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|53784_54603_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001426317.1|55245_55626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|55683_56349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976713.1|57123_57729_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	7.0e-116
>prophage 2
NZ_CP026492	Escherichia coli strain HS13-1 plasmid pHS13-1-IncHI2, complete sequence	264344	65377	109417	264344	transposase,protease,integrase	Escherichia_phage(35.71%)	45	93187:93200	113709:113722
WP_001067855.1|65377_66082_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|67492_68197_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|68318_69224_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|69220_70459_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|70458_71043_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|71535_72300_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067858.1|73071_73776_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001175593.1|74235_74559_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063120614.1|74664_75798_+	permease	NA	NA	NA	NA	NA
WP_077250418.1|76497_76923_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	7.6e-08
WP_000784387.1|77771_78629_-	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001224687.1|78644_78953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043843.1|79501_79927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053276223.1|80180_80996_-	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_000985911.1|81008_81419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|81520_81727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088046.1|81787_83113_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_024136327.1|83117_83411_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000341066.1|84014_84407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|84749_85121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|85212_85404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000077926.1|85453_85735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053338.1|86297_87539_-	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000301242.1|87967_88543_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_000116677.1|88610_89189_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_062914744.1|89237_90278_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007448.1|90300_90756_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054787.1|90778_91936_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_042634303.1|91935_92517_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001035162.1|92840_93899_+	hypothetical protein	NA	NA	NA	NA	NA
93187:93200	attL	AAAAAGTTACTTTT	NA	NA	NA	NA
WP_001285478.1|93908_95051_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001040059.1|95043_95817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042634304.1|95818_96898_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_000797366.1|96897_97854_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506887.1|97864_99073_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|99090_99558_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_001388628.1|100020_100659_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|100681_101323_+	TerD family protein	NA	NA	NA	NA	NA
WP_001253658.1|101322_101961_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|102046_103087_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000081622.1|103086_104724_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001284313.1|104749_106249_+	kinase	NA	NA	NA	NA	NA
WP_001232449.1|106415_107498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285422.1|107858_108071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|108241_109417_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0V7J3	Salmonella_phage	26.6	1.6e-15
113709:113722	attR	AAAAGTAACTTTTT	NA	NA	NA	NA
