The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	1126089	1134006	5052887		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1126089_1126728_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1126724_1127987_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1127983_1128892_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1129087_1129855_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141314.1|1130682_1131339_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_104951056.1|1131444_1134006_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.0e-30
>prophage 2
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	1170796	1275647	5052887	transposase,tRNA,plate,tail,head,protease,capsid	Shigella_phage(36.96%)	101	NA	NA
WP_000047176.1|1170796_1173427_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1173661_1173847_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|1175439_1176006_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287454.1|1176002_1176431_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|1176503_1178060_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130207.1|1178209_1178725_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1178788_1180327_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|1180343_1181516_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1181642_1182173_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119763.1|1182263_1182599_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1182588_1183326_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000165699.1|1183449_1184634_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216527.1|1184925_1185918_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774996.1|1185974_1187039_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|1187031_1188234_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_104951060.1|1189557_1191702_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	47.8	1.0e-193
WP_000080944.1|1191674_1192085_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|1192081_1192327_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|1192574_1192904_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1193055_1193400_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1193435_1193885_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1194552_1194957_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229468.1|1195003_1195528_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|1195537_1195837_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1196019_1196178_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|1196261_1196711_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1196711_1197374_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_104951061.1|1197394_1198795_-	GABA permease	NA	NA	NA	NA	NA
WP_000097641.1|1199105_1200386_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_104951062.1|1200399_1201848_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271965.1|1201870_1203139_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001315804.1|1203157_1204135_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_089645654.1|1204469_1206722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340075.1|1209866_1210124_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	1.2e-05
WP_000927517.1|1210209_1210329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|1210833_1212047_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001193631.1|1213102_1213753_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257507.1|1213767_1214973_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001297480.1|1215022_1215223_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	8.4e-26
WP_000927711.1|1215225_1215549_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_024215340.1|1215545_1215956_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.1	1.7e-73
WP_024215338.1|1215930_1216437_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	89.9	8.9e-80
WP_024215336.1|1216433_1216994_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	1.5e-104
WP_000497751.1|1217002_1217173_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_104951063.1|1217156_1218653_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	99.0	1.2e-276
WP_000090998.1|1218652_1219009_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|1219008_1219278_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_104951064.1|1219419_1221252_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	97.2	1.2e-299
WP_024215333.1|1221936_1223265_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	1.6e-245
WP_104951065.1|1223261_1224341_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_001259079.1|1224340_1224889_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	100.0	2.3e-97
WP_032254860.1|1224888_1225314_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	98.6	5.7e-80
WP_000785311.1|1225300_1226359_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	8.1e-200
WP_024215329.1|1226349_1226934_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	4.1e-113
WP_104951344.1|1227204_1227600_+	hypothetical protein	NA	O22004	Shigella_phage	38.8	3.1e-11
WP_000782984.1|1227596_1228016_+|tail	tail assembly chaperone	tail	M1SNQ2	Escherichia_phage	64.7	3.8e-36
WP_001145385.1|1228390_1228795_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	42.3	4.7e-15
WP_000905033.1|1228825_1229392_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046133.1|1229534_1230707_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.3e-203
WP_001207660.1|1230716_1231232_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1231286_1231589_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1231603_1231723_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282809.1|1231715_1234793_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.6	0.0e+00
WP_000980400.1|1234789_1235275_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001011792.1|1235271_1236372_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	7.6e-177
WP_000980502.1|1236440_1236659_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	76.4	2.2e-27
WP_000391796.1|1236685_1237168_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	4.6e-17
WP_000162574.1|1237868_1238351_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|1238482_1238959_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1238948_1239239_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1239300_1239642_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_089645710.1|1239790_1241452_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1241537_1242416_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1242538_1243132_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077221315.1|1243186_1244473_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1244493_1245285_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1245451_1246813_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1246949_1247198_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1247216_1247765_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1247795_1248563_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1248604_1248952_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1249028_1249511_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1249526_1250753_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1250742_1251261_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1251410_1251776_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_089645709.1|1251985_1253056_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	1.2e-89
WP_000225221.1|1253066_1254188_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200100.1|1254230_1255391_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001700969.1|1255489_1255537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1255640_1255982_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1256252_1256990_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_104951066.1|1257124_1258105_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|1258101_1258833_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1258962_1261536_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000230376.1|1267391_1268690_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1268686_1269010_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1269055_1270411_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082964.1|1270524_1273185_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000138184.1|1273216_1273915_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1273983_1274403_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1274609_1275647_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	1659713	1729590	5052887	lysis,terminase,transposase,portal,tail,integrase,protease,capsid	Enterobacteria_phage(48.0%)	82	1676519:1676544	1684765:1684790
WP_000849209.1|1659713_1660202_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_089645496.1|1660609_1661104_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|1661093_1661357_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778057.1|1661353_1663840_+	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000091291.1|1663846_1664542_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013506.1|1664528_1665392_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835177.1|1665388_1665838_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|1665847_1666450_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_001296826.1|1666468_1667086_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
WP_000971730.1|1667082_1667745_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|1667786_1668524_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|1668520_1668730_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026422.1|1668726_1669206_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982426.1|1669202_1671146_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000824439.1|1671142_1671700_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211587.1|1671696_1672749_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001113637.1|1672783_1673431_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
1676519:1676544	attL	CCGTATAACTAAACGTATAACTAAAA	NA	NA	NA	NA
WP_001369202.1|1676811_1677735_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001229488.1|1677897_1678386_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001018604.1|1678513_1678675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|1678678_1678873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080641.1|1679003_1679249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833625.1|1679450_1680851_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_000770163.1|1680847_1681147_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_096954808.1|1681152_1681386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|1681387_1681609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342316.1|1681581_1681824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021543716.1|1681813_1682014_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000387479.1|1682757_1682964_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000101718.1|1683460_1684702_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_001136067.1|1685404_1686172_+	hypothetical protein	NA	NA	NA	NA	NA
1684765:1684790	attR	CCGTATAACTAAACGTATAACTAAAA	NA	NA	NA	NA
WP_001145023.1|1686161_1686545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183538.1|1687028_1687985_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000741304.1|1688122_1689301_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.6	2.7e-31
WP_001096409.1|1689303_1689513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021548839.1|1689574_1689790_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	92.1	3.7e-27
WP_001242718.1|1689786_1690149_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_000008200.1|1690139_1690676_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|1690803_1691628_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|1691693_1692056_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001020632.1|1692758_1693451_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_032198020.1|1693548_1693809_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_032198019.1|1693801_1694353_+	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
WP_001250272.1|1694528_1694708_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_023993851.1|1694697_1695654_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	91.5	6.1e-138
WP_104951090.1|1695650_1696103_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	95.3	3.4e-75
WP_101973092.1|1696142_1697356_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
WP_001442792.1|1697457_1698111_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_104951091.1|1698107_1698434_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	3.5e-53
WP_000767103.1|1698430_1698820_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_104951092.1|1698839_1699649_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.1	1.1e-151
WP_032198014.1|1699656_1700646_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	1.8e-193
WP_104021943.1|1700660_1701026_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	3.8e-56
WP_137548549.1|1701044_1701476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032198010.1|1701720_1702584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|1702859_1703063_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|1703213_1704266_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|1704333_1704549_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_021535405.1|1704548_1705046_+	lysozyme	NA	A5LH83	Enterobacteria_phage	97.6	7.1e-90
WP_000088939.1|1705042_1705504_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	66.4	7.6e-46
WP_032198009.1|1705543_1705783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349509.1|1706462_1706954_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_104951093.1|1706953_1709056_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_001072975.1|1709052_1709265_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072652320.1|1709192_1710740_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.2e-283
WP_096845279.1|1710717_1712745_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.8	0.0e+00
WP_001097050.1|1712831_1713155_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1713147_1713423_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|1713434_1714013_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|1714009_1714411_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_104951094.1|1714422_1715166_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
WP_001370402.1|1715226_1715613_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_001161009.1|1715621_1715951_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_104951095.1|1715922_1718997_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	94.8	0.0e+00
WP_000847325.1|1718993_1719323_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	7.6e-56
WP_104951096.1|1719322_1720021_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	2.0e-130
WP_104951097.1|1720026_1720770_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	1.1e-142
WP_104951098.1|1720667_1721315_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_104951099.1|1721375_1724873_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.4	0.0e+00
WP_104951100.1|1724943_1725543_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	4.1e-108
WP_104951345.1|1725607_1729006_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_104951101.1|1729005_1729590_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	6.0e-104
>prophage 4
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	1801452	1810894	5052887		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569313.1|1801452_1802379_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	3.1e-22
WP_000783120.1|1802383_1803115_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1803095_1803203_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1803262_1803994_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1804215_1805901_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1805897_1806617_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1806663_1807134_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1807174_1807636_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1807760_1809761_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1809757_1810894_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 5
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	2339398	2409312	5052887	terminase,portal,tail,head,integrase,protease,holin,capsid	Enterobacteria_phage(35.0%)	80	2348002:2348016	2380437:2380451
WP_001260840.1|2339398_2340220_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2340319_2340403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743960.1|2340495_2340831_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091819.1|2341227_2342481_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2342587_2343481_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2343615_2344836_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2344960_2345656_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071597725.1|2345608_2346901_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2347058_2347673_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2347715_2348570_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
2348002:2348016	attL	ATCAGCGCCAGAACG	NA	NA	NA	NA
WP_000213028.1|2348571_2349189_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001433342.1|2349199_2351623_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
WP_000041556.1|2351683_2354110_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|2354308_2354614_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_077825778.1|2354721_2355432_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_104951147.1|2355434_2355995_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2356029_2356371_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2356505_2356832_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2357037_2358252_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836054.1|2358263_2359283_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_072095801.1|2359340_2359451_+	transporter	NA	NA	NA	NA	NA
WP_001206147.1|2359470_2360766_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.2	1.3e-154
WP_001368608.1|2360785_2361022_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_104951148.1|2361109_2363554_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|2363646_2363835_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_104951149.1|2363831_2364020_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2364584_2364794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2364794_2365433_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379563.1|2365444_2365597_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000362153.1|2365862_2366282_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|2366382_2366664_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693888.1|2366647_2367073_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2367095_2368049_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2368055_2368796_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_052915473.1|2368825_2369596_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.8	1.1e-84
WP_001118161.1|2369611_2370007_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_104951348.1|2370063_2370420_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.1	1.4e-55
WP_104951150.1|2370468_2370651_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	86.4	2.9e-25
WP_001278450.1|2371418_2371523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902693.1|2371712_2371925_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
WP_072128871.1|2372092_2372371_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	3.7e-11
WP_001265167.1|2372372_2373422_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_000904171.1|2373434_2373809_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_000762902.1|2373805_2374627_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|2374853_2375051_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_104951151.1|2375201_2376260_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	89.9	9.2e-188
WP_044805529.1|2376702_2377134_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.6	6.0e-69
WP_104951152.1|2377705_2379307_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	1.7e-310
WP_000411809.1|2379795_2380002_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731236.1|2380006_2380351_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|2380401_2380935_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
2380437:2380451	attR	CGTTCTGGCGCTGAT	NA	NA	NA	NA
WP_012578895.1|2381453_2381639_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000453587.1|2382142_2382688_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_104951153.1|2382662_2384588_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000198153.1|2384584_2384791_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001415980.1|2384787_2386389_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_033805059.1|2386369_2387689_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_047088185.1|2387698_2388031_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	9.3e-54
WP_000063258.1|2388086_2389112_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|2389153_2389549_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|2389560_2389914_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975099.1|2389925_2390504_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683137.1|2390500_2390896_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|2390903_2391656_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_094312264.1|2391669_2392074_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	92.9	1.1e-64
WP_000533440.1|2392100_2392514_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_024017784.1|2392494_2395107_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.2	0.0e+00
WP_000847298.1|2395103_2395433_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_104951154.1|2395432_2396131_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	8.1e-132
WP_104951155.1|2396141_2396885_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	97.2	7.3e-147
WP_158672591.1|2396830_2397460_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	2.0e-105
WP_096939734.1|2401245_2401845_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	97.5	1.8e-108
WP_104951157.1|2401909_2403109_+|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	97.1	4.7e-79
WP_001023452.1|2403110_2403380_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491545.1|2403520_2404396_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001121225.1|2404620_2405271_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_096245710.1|2405866_2406181_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|2406240_2407524_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_047090288.1|2407612_2409073_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.6	3.6e-41
WP_000214712.1|2409108_2409312_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 6
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	2691455	2763479	5052887	terminase,transposase,holin,tail,integrase,protease,capsid	Enterobacteria_phage(26.67%)	76	2705232:2705259	2763616:2763643
WP_000422045.1|2691455_2692505_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|2692724_2693483_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|2693479_2694070_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2694109_2694982_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2695082_2695703_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2695699_2696581_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2696718_2696763_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001507309.1|2696852_2698415_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2698414_2700010_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2700013_2701372_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2701383_2702577_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|2702576_2703383_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2703763_2703943_+	general stress protein	NA	NA	NA	NA	NA
WP_104951185.1|2704028_2704529_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2704574_2705081_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2705232:2705259	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|2705582_2705801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|2708563_2709154_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2709337_2709985_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2710121_2710268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104951186.1|2710695_2710974_+	secretion protein EspO	NA	NA	NA	NA	NA
WP_000938103.1|2712141_2712711_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2712776_2713688_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2713794_2713917_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2715514_2716840_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023356.1|2717865_2718135_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_085947772.1|2718196_2719410_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_104951187.1|2719430_2720711_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.3	3.4e-67
WP_001228290.1|2720862_2721462_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_104951188.1|2721529_2725003_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
WP_158672592.1|2725345_2725978_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.9	3.5e-102
WP_104951190.1|2725923_2726667_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_104951191.1|2726677_2727376_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	6.8e-131
WP_000807940.1|2727375_2727717_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_104951351.1|2727709_2730013_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.7	0.0e+00
WP_158672585.1|2730134_2730389_-	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	67.1	8.2e-18
WP_001063099.1|2734840_2735062_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_024216102.1|2735106_2737044_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001299337.1|2737107_2738769_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_000958372.1|2738765_2739329_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_000279786.1|2739618_2739984_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302977.1|2740025_2740211_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|2740340_2740481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|2740837_2741062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|2741126_2741333_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|2741560_2741707_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2741706_2742276_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|2742546_2743080_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_100210028.1|2743130_2743475_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	96.5	2.7e-56
WP_000411813.1|2743479_2743686_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_104951193.1|2743850_2745704_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_077787779.1|2747223_2747808_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.2	3.9e-47
WP_104951194.1|2747850_2749064_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	96.3	2.2e-164
WP_104951195.1|2749115_2749226_-	antitermination protein	NA	NA	NA	NA	NA
WP_000140002.1|2749222_2749588_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_104951196.1|2749588_2750644_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	1.7e-88
WP_010917803.1|2750645_2750924_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_104951197.1|2750993_2751251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|2751471_2751684_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|2751962_2752721_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2753419_2753584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104951198.1|2753580_2754315_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.3e-108
WP_157825328.1|2754348_2754891_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2754802_2755843_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|2755814_2756366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2756349_2756577_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_024216105.1|2756653_2757061_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	5.7e-29
WP_001240336.1|2757325_2757625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2757697_2757916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2757938_2758346_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_024216104.1|2758323_2758557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|2758550_2758718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|2759117_2759306_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|2759302_2759491_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048478.1|2759586_2762058_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2762122_2762371_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2762348_2763479_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2763616:2763643	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 7
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	2866547	2941797	5052887	lysis,terminase,transposase,holin,portal,tRNA,tail,head,integrase,protease,capsid	Enterobacteria_phage(23.44%)	91	2889623:2889637	2942222:2942236
WP_001297484.1|2866547_2867654_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2867689_2868331_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2868334_2869705_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|2869872_2870544_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2870543_2872004_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133423.1|2872740_2873022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127889.1|2873035_2874697_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000113645.1|2874680_2875037_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|2875326_2875767_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000134113.1|2875766_2876063_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020668.1|2876059_2876398_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	5.6e-30
WP_001398592.1|2876394_2877570_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_072166574.1|2877607_2878180_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	1.8e-60
WP_044810616.1|2878219_2879377_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.6e-137
WP_000233312.1|2879664_2879937_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_104951207.1|2879949_2880360_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001368652.1|2880369_2880558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044810615.1|2880671_2880923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104951208.1|2881123_2882524_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.6e-115
WP_000770178.1|2882520_2882820_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_104951209.1|2882825_2883059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104951210.1|2883051_2883516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|2883505_2883718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|2883710_2883908_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000022147.1|2884037_2884217_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	56.9	4.4e-10
WP_000953273.1|2884834_2885023_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.2e-13
WP_104951211.1|2885386_2886616_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.6	2.3e-134
WP_001295435.1|2886864_2887986_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359438.1|2888131_2889361_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2889610_2890747_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2889623:2889637	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799400.1|2890730_2891594_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938120.1|2891957_2893319_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.4	4.7e-51
WP_032361506.1|2893381_2893657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950789.1|2893736_2894717_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	48.6	8.0e-85
WP_001023427.1|2894894_2895164_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_001449501.1|2896542_2897166_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	8.7e-69
WP_104951212.1|2897234_2900714_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	94.6	0.0e+00
WP_000649829.1|2900847_2901375_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_158672593.1|2901565_2902198_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	6.5e-104
WP_104951190.1|2902143_2902887_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_104951191.1|2902897_2903596_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	6.8e-131
WP_000807940.1|2903595_2903937_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_104951214.1|2903929_2907172_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.6	0.0e+00
WP_000526113.1|2907299_2907758_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_001453698.1|2907935_2908145_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2908240_2908615_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|2908620_2909337_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133391.1|2909395_2909740_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_104951215.1|2909736_2910183_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	4.0e-76
WP_001007905.1|2910179_2910530_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125996.1|2910540_2910867_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001063096.1|2913393_2913615_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173042.1|2913659_2915597_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.5	0.0e+00
WP_001299891.1|2915660_2917322_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000958403.1|2917318_2917882_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	84.0	2.4e-70
WP_000829192.1|2918173_2918539_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095749.1|2918580_2918808_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000736096.1|2919176_2919401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082547.1|2919397_2919892_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	100.0	1.7e-83
WP_104951216.1|2920190_2920724_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	2.8e-100
WP_000731192.1|2920774_2921119_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000411809.1|2921123_2921330_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_104951217.1|2921631_2923482_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000216623.1|2923889_2924057_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_001299895.1|2924053_2924485_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
WP_000798624.1|2924792_2925167_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000573777.1|2925227_2925488_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000917767.1|2926813_2927011_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000762928.1|2927237_2928059_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000904098.1|2928055_2928430_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
WP_001265175.1|2928442_2929492_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_001341388.1|2929493_2929772_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000884071.1|2929939_2930152_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.1	1.2e-17
WP_001278450.1|2930340_2930445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627694.1|2930560_2931145_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.0e-34
WP_104951218.1|2931201_2931597_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	50.7	1.9e-29
WP_000450874.1|2931612_2932383_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.3	2.2e-82
WP_000788938.1|2932408_2933149_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095671.1|2933155_2934118_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693916.1|2934140_2934566_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2934549_2934873_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948452.1|2934997_2935474_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001443692.1|2935792_2935948_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	5.7e-06
WP_001171966.1|2936107_2936326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358071.1|2936329_2936494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2936894_2937083_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2937079_2937271_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048412.1|2937363_2939835_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|2939896_2940166_+	excisionase	NA	NA	NA	NA	NA
WP_000074973.1|2940134_2941253_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_001113310.1|2941329_2941797_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
2942222:2942236	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 8
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	3030113	3121141	5052887	terminase,transposase,tail,head,integrase,protease,holin,capsid	Enterobacteria_phage(35.06%)	101	3067673:3067687	3122120:3122134
WP_085950013.1|3030113_3031275_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
WP_000409883.1|3031316_3032675_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_000287434.1|3033261_3035685_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_024215820.1|3035693_3037712_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|3037704_3039030_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_089645745.1|3039031_3039445_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_001295604.1|3039494_3040418_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	4.1e-91
WP_001199458.1|3040901_3042173_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_089645744.1|3042178_3043306_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497941.1|3043363_3044194_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018496.1|3044735_3046244_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|3046402_3046612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104951221.1|3046666_3050629_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001331086.1|3050668_3051307_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_158672594.1|3051594_3052686_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|3052685_3053378_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|3053389_3053776_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001345413.1|3053783_3054584_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_104951223.1|3054593_3055184_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|3055194_3055689_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|3055709_3057038_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|3057120_3057294_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_104951224.1|3057666_3058263_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3058283_3058511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044263.1|3058548_3059790_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000097604.1|3060078_3061338_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420629.1|3061597_3062518_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|3062517_3062823_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_104951225.1|3062915_3063515_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062102.1|3063511_3066058_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	5.9e-71
WP_001230242.1|3066057_3067230_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3067359_3068052_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
3067673:3067687	attL	AACTGCGCGAACTGG	NA	NA	NA	NA
WP_001264955.1|3068024_3069053_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001023417.1|3070638_3070908_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_104951226.1|3070909_3072223_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	3.3e-78
WP_089645828.1|3072287_3072887_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	3.0e-111
WP_122995614.1|3076669_3077302_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	1.2e-105
WP_000967281.1|3077247_3077985_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	97.1	6.1e-146
WP_001428824.1|3078039_3078963_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_001154345.1|3079033_3079207_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|3079314_3079635_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_064482889.1|3079651_3080350_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	1.5e-130
WP_032272839.1|3080349_3080691_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	96.5	6.2e-61
WP_062893485.1|3080683_3083926_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.3	0.0e+00
WP_122987477.1|3083976_3084186_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	4.4e-33
WP_001030042.1|3084281_3084656_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_062893616.1|3084661_3085378_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	1.5e-128
WP_000133388.1|3085444_3085789_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3085785_3086232_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3086228_3086579_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3086588_3086915_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|3089603_3089825_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_069722247.1|3089869_3091807_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_069722248.1|3091870_3093532_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.5	0.0e+00
WP_000958398.1|3093528_3094092_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_104951227.1|3094380_3094746_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	4.2e-63
WP_000095732.1|3094787_3094988_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_000828070.1|3095119_3095446_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012816791.1|3095846_3096032_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280923.1|3096254_3096386_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661708.1|3096480_3097176_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	3.6e-124
WP_025380493.1|3097449_3097983_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.3e-100
WP_024216148.1|3098033_3098378_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	2.1e-56
WP_000411813.1|3098382_3098589_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_024216036.1|3098881_3100732_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_024216035.1|3101210_3101639_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.1	6.4e-63
WP_000512807.1|3102280_3102769_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|3102759_3103431_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_024216034.1|3103427_3104030_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	3.9e-90
WP_001108084.1|3104004_3104571_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_069720699.1|3105146_3106919_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.3	0.0e+00
WP_001254221.1|3107422_3107605_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_000153288.1|3107601_3108129_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_024216032.1|3108125_3108572_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	98.6	1.2e-80
WP_001281772.1|3108528_3108765_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103678.1|3108775_3108991_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|3109123_3109402_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145908.1|3109472_3109763_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	100.0	5.7e-47
WP_069720698.1|3109759_3110461_-	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	99.1	4.9e-129
WP_000185454.1|3110457_3111396_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000442609.1|3111428_3111725_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000276885.1|3111834_3112020_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|3112100_3112751_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|3113065_3113371_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|3113373_3113712_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|3113845_3114316_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_072795882.1|3114465_3114834_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	98.4	2.9e-64
WP_001198861.1|3114906_3115071_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3115039_3115183_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995416.1|3115257_3115554_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_001373974.1|3115559_3116345_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000186759.1|3116341_3117022_+	YqaJ viral recombinase family protein	NA	H6WZG6	Escherichia_phage	98.7	1.8e-131
WP_000682299.1|3117018_3117201_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	98.3	3.7e-28
WP_000548531.1|3117173_3117365_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3117375_3117657_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_104951228.1|3117755_3117977_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	2.4e-34
WP_069720661.1|3117973_3118744_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.8	4.7e-141
WP_044805131.1|3118745_3119483_+	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	51.0	4.2e-54
WP_001277767.1|3119579_3119759_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_001303849.1|3119871_3120090_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_069720662.1|3120067_3121141_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.1	1.8e-194
3122120:3122134	attR	CCAGTTCGCGCAGTT	NA	NA	NA	NA
>prophage 9
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	3140250	3193594	5052887	terminase,transposase,holin,portal,tail,head,protease,capsid	Enterobacteria_phage(39.53%)	62	NA	NA
WP_000003671.1|3140250_3140838_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_089645770.1|3140834_3141542_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_089645771.1|3141560_3143354_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_032267472.1|3143350_3144469_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_059225203.1|3145308_3145620_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_024215812.1|3145735_3146944_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.3	2.1e-204
WP_024215811.1|3147503_3148064_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	67.5	1.2e-64
WP_001023428.1|3148178_3148448_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_024215810.1|3148449_3149763_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	6.7e-79
WP_104951230.1|3149823_3153237_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090891.1|3153297_3153930_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_047378280.1|3153866_3154610_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.8e-146
WP_001152639.1|3154615_3155314_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3155313_3155643_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_104951231.1|3155639_3158201_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.3	0.0e+00
WP_000533431.1|3158181_3158595_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|3158621_3159053_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|3159066_3159819_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|3159826_3160222_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_024216041.1|3160218_3160794_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	4.9e-50
WP_097344466.1|3160986_3162199_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
WP_000201528.1|3162467_3162842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|3162893_3163922_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256818.1|3163979_3164327_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_104951232.1|3165857_3167450_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.2e-184
WP_000258991.1|3167446_3167653_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_024216039.1|3167636_3169565_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.0e-261
WP_000235436.1|3169536_3170046_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001431375.1|3170440_3170665_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	5.9e-20
WP_001303878.1|3170746_3171061_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3171587_3171773_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3171994_3172108_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3172328_3172862_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3173021_3173294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|3173549_3173756_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_104951233.1|3174203_3176054_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3176821_3177535_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3177629_3177869_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3178155_3178974_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|3179125_3179497_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|3179486_3179858_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_024215596.1|3179870_3180920_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.5e-108
WP_001341388.1|3180921_3181200_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3181367_3181580_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3181624_3181762_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160655.1|3182127_3182901_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3183252_3183666_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_024215598.1|3183681_3184452_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	1.0e-79
WP_000788751.1|3184473_3185220_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205820.1|3185226_3186342_-	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000273724.1|3186420_3186876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3187082_3187508_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3187491_3187764_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3187872_3188274_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3188301_3188493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3188492_3188780_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3189056_3189212_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3189353_3189743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024215602.1|3189929_3190115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3190688_3190877_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3190873_3191065_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_104951234.1|3191158_3193594_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.4e-59
>prophage 10
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	3380946	3470818	5052887	terminase,transposase,holin,portal,tail,head,integrase,protease,lysis,capsid	Enterobacteria_phage(49.33%)	110	3395659:3395693	3472252:3472286
WP_001067858.1|3380946_3381651_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000569080.1|3381726_3382449_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_089645723.1|3382565_3384791_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001295299.1|3384787_3385714_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_001350031.1|3385989_3386250_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	53.1	5.7e-06
WP_000430057.1|3386514_3388797_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|3388838_3389516_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|3389589_3389856_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3390120_3390381_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|3390609_3391695_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|3391835_3392798_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|3392825_3394976_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145128.1|3395095_3395578_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
3395659:3395693	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_104951248.1|3395809_3397174_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	32.1	2.3e-53
WP_001296991.1|3397402_3398074_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|3398076_3399072_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996099.1|3399064_3400801_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|3400793_3401927_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3401937_3403044_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3403005_3403416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113351.1|3403548_3404310_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|3404306_3405548_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045448.1|3405547_3406504_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446932.1|3406539_3407253_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|3407457_3408162_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|3408298_3408751_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_104951249.1|3408752_3408998_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3408990_3409476_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|3409478_3409991_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|3410012_3411002_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|3411398_3412307_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3412498_3414520_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|3415098_3415776_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|3415768_3416524_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_024215917.1|3416510_3417665_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3417661_3418702_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001389241.1|3418788_3420078_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
WP_000767389.1|3420136_3420613_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001121571.1|3421116_3421770_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000354291.1|3421782_3422004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|3422087_3422468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104951250.1|3423686_3424058_+|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	94.3	1.1e-58
WP_001381875.1|3424161_3425016_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.9	1.1e-149
WP_000950982.1|3425232_3426114_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_104951251.1|3426219_3426489_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_104951252.1|3426490_3427813_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.9	2.4e-76
WP_001358466.1|3427877_3428477_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	7.0e-108
WP_104951253.1|3428547_3431961_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090891.1|3432021_3432654_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_047378280.1|3432590_3433334_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.8e-146
WP_001152639.1|3433339_3434038_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3434037_3434367_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_104951254.1|3434363_3436925_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.5	0.0e+00
WP_000459457.1|3436917_3437352_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479193.1|3437333_3437756_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_001317730.1|3437771_3438512_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000683129.1|3438519_3438915_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|3438911_3439490_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|3439501_3439855_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|3439866_3440262_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063254.1|3440303_3441329_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_104951255.1|3441384_3441717_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	4.2e-54
WP_104951256.1|3441726_3443046_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	2.4e-233
WP_089645795.1|3443026_3444628_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.2e-309
WP_000198149.1|3444624_3444831_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_053890143.1|3444827_3446753_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|3446727_3447273_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001307652.1|3447661_3447856_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|3448043_3448661_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092318.1|3448810_3449248_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|3449244_3449742_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|3449741_3449948_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023271.1|3450395_3452246_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_114145326.1|3452547_3452703_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001097238.1|3453715_3454405_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3454419_3454542_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3454881_3455841_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|3456052_3456241_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|3456237_3456600_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_001286917.1|3456879_3457092_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950962.1|3457084_3457261_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386661.1|3457260_3457620_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_001254220.1|3457622_3457799_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_000153280.1|3457795_3458323_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736904.1|3458319_3458760_-	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_000145931.1|3458833_3459124_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788869.1|3459120_3459822_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000185522.1|3459818_3460718_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	2.1e-172
WP_001177650.1|3460752_3461031_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000276886.1|3461139_3461325_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001095981.1|3461405_3462056_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_001358311.1|3462368_3462641_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
WP_001066169.1|3462657_3463239_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065374.1|3463499_3463868_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3463940_3464105_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3464073_3464217_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995416.1|3464291_3464588_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_001373974.1|3464593_3465379_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000186759.1|3465375_3466056_+	YqaJ viral recombinase family protein	NA	H6WZG6	Escherichia_phage	98.7	1.8e-131
WP_000682299.1|3466052_3466235_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	98.3	3.7e-28
WP_000548531.1|3466207_3466399_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001395510.1|3466409_3466691_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763369.1|3466789_3467011_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	5.5e-34
WP_000111054.1|3467007_3467259_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	5.8e-32
WP_000748282.1|3467557_3468172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104951258.1|3468465_3468804_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	85.7	7.1e-49
WP_000762731.1|3468832_3469261_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_000545741.1|3469344_3469512_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|3469551_3469770_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3469747_3470818_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3472252:3472286	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 11
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	3702042	3710232	5052887	transposase	Shigella_phage(72.73%)	12	NA	NA
WP_101973092.1|3702042_3703255_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
WP_001250269.1|3704164_3704344_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515829.1|3704519_3705077_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000649477.1|3705120_3705321_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3705411_3706086_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000559922.1|3706300_3706816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3707286_3707649_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|3707714_3708539_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|3708666_3709203_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|3709193_3709556_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206810.1|3709555_3709861_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_000433946.1|3709860_3710232_+	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	82.8	2.5e-47
>prophage 12
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	3988920	4042592	5052887	plate,integrase,capsid	Enterobacteria_phage(20.0%)	49	3988815:3988834	4001014:4001033
3988815:3988834	attL	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_059250309.1|3988920_3990255_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_104951292.1|3990335_3991049_-	hypothetical protein	NA	A0A291LAA9	Escherichia_phage	47.0	1.3e-47
WP_104951293.1|3991082_3992918_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.8	1.9e-31
WP_000452041.1|3992932_3993136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059250304.1|3993221_3994250_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_059250302.1|3994268_3994631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032314825.1|3994627_3994840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059250300.1|3995172_3995508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001403519.1|3995509_3995920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000617150.1|3996049_3996328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072249530.1|3996339_3996897_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_040080436.1|3997140_3997329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021558589.1|3999280_3999820_+	recombinase family protein	NA	Q2A092	Sodalis_phage	42.5	2.4e-27
WP_024215450.1|4001204_4002458_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	6.4e-95
4001014:4001033	attR	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_001285288.1|4002469_4003573_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_104951294.1|4003860_4004916_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.6e-118
WP_000174677.1|4004954_4005356_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189539.1|4005413_4006658_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4006749_4007208_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_104951295.1|4007468_4008926_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602114.1|4008982_4009597_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001059855.1|4010976_4011429_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|4011425_4012481_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_089645775.1|4012551_4013322_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001358298.1|4013281_4015021_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_024216089.1|4015125_4015404_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030486.1|4015396_4015753_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543897.1|4015809_4016583_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.6e-19
WP_024216090.1|4016768_4017029_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|4017031_4017310_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4017465_4018206_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4018176_4018944_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4019149_4019728_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_104951296.1|4019967_4022412_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4022454_4022928_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118037.1|4023081_4023849_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_089645811.1|4025469_4025919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021499015.1|4025930_4030184_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
WP_024216093.1|4030259_4032401_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4032610_4033129_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037389.1|4033826_4034327_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4034361_4034586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104951297.1|4034636_4036112_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_089645755.1|4036118_4036532_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_104951298.1|4036535_4038386_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4038349_4039432_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4039456_4040737_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4040733_4041258_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246421.1|4041260_4042592_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 13
NZ_CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	4417367	4427875	5052887	integrase	Enterobacteria_phage(80.0%)	12	4407239:4407253	4435475:4435489
4407239:4407253	attL	CTTAGAAAACAAGCT	NA	NA	NA	NA
WP_001022619.1|4417367_4418837_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
WP_001218329.1|4419037_4420303_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
WP_122984246.1|4420518_4420713_-|integrase	integrase	integrase	Q38404	Enterobacteria_phage	98.0	3.8e-23
WP_104951314.1|4421059_4423393_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_104951315.1|4423407_4423728_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459294.1|4423863_4424319_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_104951316.1|4424311_4424599_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	96.8	1.9e-47
WP_000980222.1|4424591_4425182_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	4.1e-60
WP_001149160.1|4425178_4425445_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_097519058.1|4425997_4426732_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	1.8e-129
WP_000638628.1|4426728_4427229_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446131.1|4427302_4427875_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
4435475:4435489	attR	AGCTTGTTTTCTAAG	NA	NA	NA	NA
