The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020943	Pantoea ananatis strain PNA 97-1R chromosome, complete genome	4558720	663793	722922	4558720	terminase,tail,integrase,tRNA,head,portal,plate,lysis,capsid	Salmonella_phage(44.44%)	77	666648:666670	692079:692101
WP_015699474.1|663793_664378_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	42.2	2.5e-33
WP_104932945.1|664801_665170_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.5	2.7e-38
WP_028715824.1|665236_665455_+	DUF2732 family protein	NA	F1BUS3	Erwinia_phage	54.1	1.0e-08
WP_014594660.1|665454_665682_+	hypothetical protein	NA	F1BUS2	Erwinia_phage	50.0	1.4e-13
WP_104932944.1|665678_667742_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	70.5	7.7e-263
666648:666670	attL	ACCGCGCCGTCACGCTATCACGC	NA	NA	NA	NA
WP_013027286.1|667949_668174_+	hypothetical protein	NA	F1BUR9	Erwinia_phage	64.6	2.6e-15
WP_104932943.1|668867_669071_+|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	79.1	6.6e-26
WP_014604962.1|669076_669301_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	82.4	9.8e-31
WP_024471098.1|669284_669794_+	lysozyme	NA	E5G6N1	Salmonella_phage	66.3	3.6e-57
WP_015699480.1|669790_670225_+	hypothetical protein	NA	F1BUQ1	Erwinia_phage	59.0	2.5e-38
WP_168203635.1|670314_670782_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	62.5	2.8e-48
WP_013027279.1|670874_671459_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	79.4	9.9e-83
WP_013027278.1|671455_671806_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	81.9	2.1e-48
WP_104932942.1|671809_672718_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	82.1	1.6e-132
WP_104932941.1|672710_673319_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	82.7	5.3e-95
WP_158639815.1|674014_674161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158639816.1|674435_674588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042677392.1|674623_674842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932939.1|675005_675194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146109549.1|675190_675469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105082456.1|675395_675914_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	45.0	7.3e-29
WP_014594652.1|675913_676510_+|tail	tail assembly protein	tail	A0A218M4J2	Erwinia_phage	47.7	3.9e-50
WP_148239979.1|677158_677761_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	50.3	6.7e-34
WP_104932938.1|677753_678332_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	77.2	1.3e-71
WP_014594650.1|678412_679582_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	89.7	3.3e-202
WP_013027271.1|679594_680107_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	85.3	3.3e-82
WP_013027270.1|680161_680458_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	72.2	6.0e-28
WP_013027268.1|680490_680613_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	61.5	7.4e-09
WP_104932937.1|680605_682852_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	41.5	9.1e-68
WP_013027266.1|682858_683362_+|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	73.8	9.8e-55
WP_104932936.1|683363_684521_+	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	42.7	1.6e-79
WP_014604972.1|684594_684816_+	late control protein ogr/delta	NA	F1BUT0	Erwinia_phage	68.1	8.2e-22
WP_104932935.1|685193_685724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096011888.1|685861_686053_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_104933739.1|686674_687688_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.5	3.1e-116
WP_104933738.1|687693_688305_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	40.6	5.6e-36
WP_072404490.1|688395_688632_+	regulator	NA	NA	NA	NA	NA
WP_104933737.1|688666_689176_+	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	73.4	1.3e-62
WP_104933736.1|689186_689366_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	48.2	1.7e-09
WP_104933735.1|689367_689751_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	68.9	1.6e-41
WP_039342011.1|689822_690050_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
WP_104933734.1|690049_690277_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	61.3	1.9e-18
WP_104933733.1|690273_691110_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	60.6	1.1e-87
WP_104933732.1|691106_693395_+	replication protein	NA	F1BUS0	Erwinia_phage	77.5	0.0e+00
692079:692101	attR	ACCGCGCCGTCACGCTATCACGC	NA	NA	NA	NA
WP_104933731.1|693477_693666_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	76.7	8.5e-20
WP_104933730.1|693680_693914_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	74.0	1.7e-25
WP_104933792.1|694024_695047_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	60.2	1.6e-115
WP_158639817.1|695073_695754_-	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	32.9	4.0e-19
WP_104933729.1|695755_696898_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	42.8	6.3e-73
WP_104933790.1|697298_697760_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	34.2	9.4e-12
WP_104933728.1|697753_698053_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_104933727.1|698535_699162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933726.1|699310_700360_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.9	3.0e-162
WP_104933725.1|700359_702126_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	85.0	2.2e-306
WP_104933724.1|702270_703122_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	62.2	9.0e-85
WP_104933789.1|703166_704360_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.2	4.3e-133
WP_104933723.1|704363_705008_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	74.1	8.9e-85
WP_104933722.1|705105_705570_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	71.4	4.6e-59
WP_013027024.1|705569_705773_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	83.6	3.1e-28
WP_014605001.1|705776_705989_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	60.3	9.9e-17
WP_014605002.1|705969_706485_+	lysozyme	NA	E5G6N1	Salmonella_phage	79.9	1.1e-74
WP_104933721.1|706481_706913_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	52.1	6.5e-31
WP_104933720.1|707008_707440_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	72.7	2.4e-54
WP_104933719.1|707432_707876_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	61.5	8.4e-42
WP_104933718.1|707887_709345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933717.1|709420_709999_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	67.5	2.0e-67
WP_104933716.1|709998_710352_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	59.0	2.5e-36
WP_104933715.1|710338_711253_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	64.0	4.3e-101
WP_104933714.1|711249_711861_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	73.4	5.0e-85
WP_104933713.1|714153_714636_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	69.2	3.6e-54
WP_104933712.1|714635_715736_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	73.5	3.3e-148
WP_104933711.1|715796_716015_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.1	1.4e-21
WP_024471056.1|716556_717072_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_013027259.1|717144_718989_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_014594644.1|719552_721298_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.3	8.1e-72
WP_001144069.1|721414_721630_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013027257.1|721908_722922_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	5.0e-106
>prophage 2
NZ_CP020943	Pantoea ananatis strain PNA 97-1R chromosome, complete genome	4558720	1209362	1254401	4558720	tail,head,lysis,holin,capsid	uncultured_Caudovirales_phage(32.0%)	65	NA	NA
WP_104933612.1|1209362_1210565_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.8	2.1e-151
WP_024471313.1|1210522_1210729_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	77.4	1.1e-23
WP_104933611.1|1210725_1212708_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.1	2.4e-205
WP_104933610.1|1212704_1214036_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	66.3	1.2e-83
WP_104933609.1|1214513_1214795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933608.1|1215015_1215402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933607.1|1215391_1216006_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	72.9	1.5e-65
WP_104933784.1|1216005_1216323_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	54.5	3.6e-31
WP_104933606.1|1216781_1217072_-	hypothetical protein	NA	S4TU79	Salmonella_phage	49.5	6.5e-19
WP_104933605.1|1217064_1217598_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	62.6	9.7e-53
WP_104933604.1|1217682_1218378_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	38.6	1.9e-24
WP_015700102.1|1218377_1219043_-	ATP-binding protein	NA	G9L667	Escherichia_phage	59.9	2.9e-70
WP_104933603.1|1219044_1219713_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	35.3	1.3e-22
WP_024471305.1|1219681_1219891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933602.1|1220012_1220417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933601.1|1221416_1222100_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNG6	Salmonella_phage	44.4	3.0e-14
WP_104933600.1|1222138_1222375_+	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	68.1	2.4e-19
WP_014605612.1|1222387_1222690_+	hypothetical protein	NA	I6PCV6	Cronobacter_phage	46.7	1.6e-12
WP_104933599.1|1222682_1222868_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_158639819.1|1222926_1223079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104933783.1|1223071_1224136_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	42.7	1.1e-58
WP_104933598.1|1224128_1225517_+	replicative DNA helicase	NA	K7P852	Enterobacteria_phage	55.4	4.8e-128
WP_168203637.1|1225516_1225873_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	68.7	7.2e-44
WP_168203628.1|1225911_1226763_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	52.0	9.7e-71
WP_104933596.1|1226943_1227504_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	46.0	1.3e-42
WP_104933781.1|1228499_1228943_+	methyltransferase domain-containing protein	NA	H2BDB7	Pseudomonas_virus	49.7	1.9e-38
WP_014605618.1|1229084_1229438_+|holin	holin	holin	NA	NA	NA	NA
WP_168203638.1|1229443_1229926_+	lysozyme	NA	A0A1W6JP42	Morganella_phage	57.1	1.7e-43
WP_104933595.1|1229922_1230423_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	52.0	1.6e-28
WP_104933594.1|1230427_1230685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104933593.1|1230738_1230918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104933592.1|1231006_1231270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104933591.1|1231313_1231499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104933590.1|1231500_1232118_+	hypothetical protein	NA	F1C5D5	Cronobacter_phage	74.9	5.2e-90
WP_104933589.1|1232148_1232622_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	75.2	5.8e-49
WP_104933588.1|1232826_1234437_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	89.1	7.7e-295
WP_104933587.1|1234447_1235917_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	77.7	5.5e-223
WP_104933586.1|1235876_1236626_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	73.0	1.2e-80
WP_104933585.1|1236655_1237882_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	67.6	7.0e-147
WP_104933584.1|1237891_1238389_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	71.8	1.7e-59
WP_089517277.1|1238398_1239340_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	84.3	1.0e-153
WP_104933583.1|1239383_1239719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089517279.1|1239720_1240128_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	77.8	2.5e-56
WP_089517280.1|1240124_1240673_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	69.6	1.4e-59
WP_104933582.1|1240659_1241046_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	71.7	1.9e-45
WP_104933581.1|1241035_1241581_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	65.7	2.4e-70
WP_104933580.1|1241584_1242730_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	71.9	2.4e-157
WP_029570460.1|1242740_1243181_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	76.0	6.8e-60
WP_104933579.1|1243184_1243637_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	62.7	1.9e-41
WP_022623532.1|1243672_1243822_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	79.6	3.4e-16
WP_104933578.1|1243818_1245837_+	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.9	1.7e-238
WP_104933577.1|1245836_1246403_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	66.5	4.6e-61
WP_104933576.1|1246411_1246717_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	65.3	1.1e-32
WP_104933575.1|1246719_1247781_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	72.6	2.1e-147
WP_104933574.1|1247780_1248119_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	59.8	1.1e-30
WP_104933573.1|1248233_1248767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104933572.1|1248763_1249000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104933571.1|1249011_1249371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104933570.1|1249426_1250083_+	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	59.1	2.2e-75
WP_104933569.1|1250079_1250433_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	83.8	7.9e-51
WP_104933568.1|1250432_1251632_+	hypothetical protein	NA	A0A2H4J5T1	uncultured_Caudovirales_phage	73.9	6.4e-161
WP_104933567.1|1251628_1252309_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	80.2	2.9e-102
WP_104933566.1|1252308_1252914_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	62.9	1.4e-18
WP_104933565.1|1252923_1253322_+|tail	tail assembly chaperone	tail	F1BUK2	Cronobacter_phage	47.2	3.3e-13
WP_013026784.1|1253918_1254401_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
>prophage 3
NZ_CP020943	Pantoea ananatis strain PNA 97-1R chromosome, complete genome	4558720	1735856	1742674	4558720		Tupanvirus(33.33%)	7	NA	NA
WP_014594076.1|1735856_1736753_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.1	6.7e-46
WP_019106525.1|1736798_1737812_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	43.7	3.5e-75
WP_104933492.1|1738243_1739314_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.2	8.7e-101
WP_104933491.1|1739325_1740201_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.2e-112
WP_104933490.1|1740226_1741165_+	NAD-dependent epimerase/dehydratase family protein	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	25.5	6.4e-15
WP_104933489.1|1741166_1741934_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_104933488.1|1741933_1742674_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	3.5e-08
>prophage 4
NZ_CP020943	Pantoea ananatis strain PNA 97-1R chromosome, complete genome	4558720	2620402	2634149	4558720	tRNA	Pandoravirus(11.11%)	15	NA	NA
WP_013025587.1|2620402_2621449_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	47.9	3.0e-82
WP_072138718.1|2621450_2622887_-	YdiU family protein	NA	NA	NA	NA	NA
WP_014593597.1|2622977_2623712_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013025584.1|2624004_2624463_-	endopeptidase	NA	A0A217EQL1	Bacillus_phage	38.4	5.5e-12
WP_013025583.1|2624529_2625279_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	NA	NA	NA	NA
WP_013025582.1|2625279_2625825_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	40.7	1.8e-14
WP_104933345.1|2625858_2626860_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.7	8.0e-16
WP_006118960.1|2626959_2627262_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.6e-13
WP_014593594.1|2627266_2629654_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	30.9	4.6e-09
WP_013025578.1|2629668_2630652_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.1	1.4e-33
WP_106120997.1|2630800_2630845_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_006118956.1|2630966_2631323_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004157374.1|2631367_2631565_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_026020952.1|2631665_2632217_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.8	4.9e-15
WP_014593593.1|2632220_2634149_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	3.1e-125
>prophage 5
NZ_CP020943	Pantoea ananatis strain PNA 97-1R chromosome, complete genome	4558720	3330166	3349324	4558720	terminase,tail,transposase	Salmonella_phage(35.29%)	31	NA	NA
WP_104933245.1|3330166_3330403_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	46.2	3.2e-08
WP_013024953.1|3330469_3330703_-|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	66.2	1.1e-19
WP_024471185.1|3330723_3331161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104933243.1|3331933_3333053_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	3.3e-50
WP_104933242.1|3333088_3333652_-	hypothetical protein	NA	I6R9B3	Salmonella_phage	74.8	3.7e-50
WP_104933241.1|3334129_3334483_-|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	72.6	5.1e-42
WP_104933765.1|3334494_3336795_-	tape measure protein	NA	H6WRV7	Salmonella_phage	37.8	8.7e-98
WP_104933240.1|3337206_3337545_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	56.4	5.3e-28
WP_104933239.1|3337549_3338005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933238.1|3338088_3338418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933236.1|3338835_3339723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933235.1|3339764_3340652_-	hypothetical protein	NA	A0A1V0E5Q3	Salmonella_phage	85.8	3.5e-63
WP_028715195.1|3340635_3341082_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	75.6	7.9e-48
WP_104933234.1|3341155_3341608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050442525.1|3341859_3342222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028715198.1|3342247_3342514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933233.1|3342655_3343177_-	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	93.0	6.5e-94
WP_168203631.1|3343373_3343544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933232.1|3343540_3343720_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	67.4	2.6e-10
WP_168203632.1|3343682_3343952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933231.1|3343948_3344203_-	hypothetical protein	NA	S4TWQ5	Salmonella_phage	50.0	6.3e-10
WP_104933230.1|3344202_3344670_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	40.7	1.1e-23
WP_104933229.1|3344666_3344972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058706846.1|3344955_3345351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933228.1|3345540_3346386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933227.1|3346597_3347221_-	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	92.7	1.0e-106
WP_104933226.1|3347332_3347695_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2H4J472	uncultured_Caudovirales_phage	91.6	5.8e-57
WP_104933225.1|3347691_3347982_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	95.8	3.5e-49
WP_158639834.1|3347974_3348148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933223.1|3348250_3348460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933221.1|3348862_3349324_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	56.2	3.0e-42
>prophage 6
NZ_CP020943	Pantoea ananatis strain PNA 97-1R chromosome, complete genome	4558720	3525881	3535953	4558720		Streptococcus_phage(25.0%)	10	NA	NA
WP_104933195.1|3525881_3526793_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	35.8	3.0e-33
WP_015700885.1|3527094_3528843_-	phage EPS-depolymerase	NA	A0A1S6L3G8	Erwinia_phage	46.9	9.7e-158
WP_013024790.1|3529042_3529333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104933194.1|3529329_3529677_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	46.2	1.1e-17
WP_104933193.1|3529673_3530141_-	lysozyme	NA	H9C148	Vibrio_phage	44.7	3.9e-29
WP_013024787.1|3530337_3530616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013024786.1|3531037_3531757_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	35.4	5.5e-43
WP_028714856.1|3532116_3533370_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.8	3.9e-92
WP_014593015.1|3533379_3534483_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.4e-60
WP_015700888.1|3534834_3535953_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.5	1.1e-109
>prophage 7
NZ_CP020943	Pantoea ananatis strain PNA 97-1R chromosome, complete genome	4558720	4114556	4121602	4558720		Vibrio_phage(33.33%)	8	NA	NA
WP_104933750.1|4114556_4115009_+	hypothetical protein	NA	A0A067ZG68	Vibrio_phage	58.4	8.3e-45
WP_158639836.1|4115391_4115811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022622234.1|4115866_4116109_+	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	78.8	3.4e-29
WP_104933087.1|4116287_4117550_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	2.7e-146
WP_104933086.1|4117549_4117975_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	50.8	1.5e-24
WP_104933085.1|4118736_4119441_-	SAM-dependent DNA methyltransferase	NA	A0A2I7RHV5	Vibrio_phage	28.1	3.3e-16
WP_104933084.1|4119580_4120528_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_104933083.1|4120621_4121602_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.3	9.5e-54
