The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	115570	183251	4023351	transposase,protease,integrase	Paenibacillus_phage(31.82%)	53	179706:179722	190597:190613
WP_024092920.1|115570_116794_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
WP_024092922.1|118104_120612_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_096761233.1|120655_121771_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	3.2e-05
WP_042119400.1|121904_122720_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.0	1.6e-30
WP_023483149.1|122928_124011_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_024092924.1|124084_125311_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_024092925.1|125368_126163_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_036655748.1|126216_127416_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	2.1e-31
WP_024092926.1|127434_128394_+	ornithine carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	29.2	1.0e-23
WP_024092927.1|128419_129646_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_024092928.1|129733_131143_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_024092929.1|131317_132808_-	VanW family protein	NA	NA	NA	NA	NA
WP_042118303.1|133186_133873_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.5	6.5e-25
WP_036655756.1|133862_134783_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023483138.1|134935_136207_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	47.4	2.9e-18
WP_042119402.1|136307_137741_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.7	2.1e-25
WP_042118306.1|137879_139166_+|protease	serine protease	protease	NA	NA	NA	NA
WP_096761231.1|139814_140591_-	OmpA family protein	NA	NA	NA	NA	NA
WP_024092935.1|140562_141360_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_024092936.1|141611_143606_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_024092937.1|143791_146674_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.2	0.0e+00
WP_024092938.1|146982_147381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024092939.1|147472_149089_-	ferredoxin--nitrite reductase NirA	NA	NA	NA	NA	NA
WP_036655768.1|149331_149532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024092940.1|149723_150692_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_052337358.1|150966_152646_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_080675774.1|152447_153143_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.1	8.3e-12
WP_052337360.1|155531_155855_+	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
WP_023483236.1|155969_157193_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023482390.1|157431_158718_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	37.0	3.2e-73
WP_023482391.1|158878_160240_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.2	8.4e-117
WP_024092942.1|160264_160711_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_024092943.1|160707_162663_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_042119404.1|162680_163598_-	DUF2232 domain-containing protein	NA	NA	NA	NA	NA
WP_036655655.1|164002_164338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024092945.1|164516_165740_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.1e-227
WP_042118312.1|165895_166198_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	67.0	2.2e-30
WP_051427959.1|166423_167086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024092947.1|167387_168635_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	44.5	1.2e-16
WP_036657280.1|168869_169589_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.5	1.2e-37
WP_023482385.1|169589_171416_+	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	26.6	3.0e-24
WP_023482384.1|171412_172726_+	regulator of YycFG-like protein	NA	NA	NA	NA	NA
WP_023482383.1|172758_173526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024092948.1|173572_174379_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	36.1	1.3e-40
WP_024092949.1|174347_174557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024092950.1|174718_175933_+	PDZ domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	28.4	1.2e-10
WP_024092951.1|175989_176157_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_023482379.1|177426_177942_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_042119405.1|178135_179371_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
179706:179722	attL	GGGAAGGATCATATTGA	NA	NA	NA	NA
WP_024092954.1|180274_180754_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_042118318.1|180756_181509_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	45.1	3.5e-64
WP_077585141.1|181453_181597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|182027_183251_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
190597:190613	attR	TCAATATGATCCTTCCC	NA	NA	NA	NA
>prophage 2
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	217638	292518	4023351	bacteriocin,transposase	Paenibacillus_phage(26.32%)	58	NA	NA
WP_024092852.1|217638_218862_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
WP_024092981.1|219066_220227_+	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_023483112.1|220287_221124_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.3	1.1e-21
WP_023483111.1|221480_222179_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_024092982.1|222327_224658_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.9	3.4e-134
WP_024092983.1|224746_226768_+	NAD-dependent DNA ligase LigA	NA	Q332J4	Clostridium_botulinum_C_phage	35.3	6.9e-99
WP_023485000.1|232890_233208_-	MTH1187 family thiamine-binding protein	NA	NA	NA	NA	NA
WP_036657354.1|233295_234870_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_042118342.1|234865_235462_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_036655789.1|235467_235860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024092985.1|236048_236954_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_023485006.1|237035_238142_+	lipoyl synthase-like protein	NA	NA	NA	NA	NA
WP_023485007.1|238240_239362_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	32.3	2.7e-20
WP_023483236.1|239425_240649_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023485008.1|240884_241820_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_024092986.1|241858_242866_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_024092987.1|242862_243525_+	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_024092989.1|244346_245573_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_024092990.1|245565_246201_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_024092991.1|246223_247510_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_023485015.1|247506_248106_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_024092992.1|248109_248715_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_023485017.1|248843_249578_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_042118347.1|249664_250423_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_024092994.1|250419_251148_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_023485021.1|251217_252024_+	histidinol-phosphatase HisJ	NA	NA	NA	NA	NA
WP_023485022.1|252213_253164_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	32.7	7.8e-37
WP_024092995.1|253244_255011_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_024092996.1|255027_255975_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	50.0	3.4e-72
WP_036655797.1|256166_257114_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_023485026.1|257174_258056_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.3	2.3e-06
WP_024092997.1|258067_259045_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	39.2	5.4e-57
WP_024092998.1|259050_259977_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	8.1e-55
WP_036655800.1|260170_260440_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_040930513.1|260549_260783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042118352.1|260809_261433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158442216.1|261466_261964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093001.1|261882_262728_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	1.7e-22
WP_158676949.1|262724_263678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158676950.1|264437_264680_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_023483236.1|264761_265985_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023485033.1|266278_266860_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.6	7.4e-54
WP_024093002.1|267395_268424_+	central glycolytic genes regulator	NA	NA	NA	NA	NA
WP_042118357.1|268480_269485_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_024093004.1|269623_270805_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_023485037.1|270826_271579_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_024093005.1|271580_273119_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023485039.1|273275_274568_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	71.9	1.1e-171
WP_023485040.1|274636_275350_+	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_024093006.1|275482_275719_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_024093007.1|276006_278511_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.9	4.5e-92
WP_024093008.1|279094_279574_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	54.5	8.2e-43
WP_158442218.1|281157_281553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093012.1|282818_283202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|283306_284530_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023485049.1|288553_289423_-	VOC family protein	NA	NA	NA	NA	NA
WP_036657365.1|289609_291073_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_023483236.1|291294_292518_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 3
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	309997	455868	4023351	integrase,transposase,tRNA	Paenibacillus_phage(33.33%)	118	312892:312951	383282:384670
WP_024093026.1|309997_311221_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	6.2e-228
WP_042118373.1|311309_311903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051427968.1|311914_312637_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.0	5.4e-14
312892:312951	attL	AAGTTGAGTCCGTATAATTGTGTAAAAAGCTAGGTTCCAAAAAATGAAAGGAGCCATATT	NA	NA	NA	NA
WP_023483236.1|313012_314236_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093027.1|314676_314919_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052337364.1|315653_318395_-	AAA family ATPase	NA	G3MA40	Bacillus_virus	32.6	2.2e-76
WP_023482446.1|318563_319205_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_036655831.1|319331_319571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482447.1|319749_321666_+	two-component sensor histidine kinase-like protein	NA	NA	NA	NA	NA
WP_024093030.1|321655_322348_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.4	1.2e-26
WP_023482449.1|322566_323214_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	30.4	1.9e-10
WP_024093032.1|323324_323528_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_077585278.1|326707_326785_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_024093034.1|326813_328493_+	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
WP_024093035.1|328515_330546_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.0	1.9e-27
WP_023482455.1|330580_331201_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_024093036.1|331218_333528_+	sensor protein KdpD	NA	NA	NA	NA	NA
WP_023482457.1|334637_335162_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042118381.1|335356_335803_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_042118384.1|335920_337060_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_036655837.1|337161_337740_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	54.3	3.2e-49
WP_144083280.1|337983_338376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482462.1|338497_339157_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023482464.1|340183_340927_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023483236.1|341057_342281_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036655838.1|342474_343908_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_024093043.1|343921_344827_-	DNA polymerase LigD	NA	NA	NA	NA	NA
WP_024093044.1|344848_345796_-	ATP-dependent DNA ligase-like protein	NA	A0A2H4JD86	uncultured_Caudovirales_phage	27.1	1.2e-13
WP_024093045.1|345797_346640_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	33.3	5.3e-37
WP_155116214.1|347255_347522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093047.1|347573_348512_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023482471.1|348524_349358_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_036655842.1|349439_350546_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	36.0	5.9e-20
WP_052337366.1|350969_351338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932469.1|351429_352476_+	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
WP_024093052.1|352479_353667_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_024093053.1|353786_355145_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024093055.1|355771_357205_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A218MMS0	uncultured_virus	25.6	2.6e-20
WP_024093056.1|357333_358467_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024093057.1|358790_360728_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_023482485.1|362688_362946_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_023482488.1|365409_365889_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_023482489.1|365885_366764_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_023482490.1|366770_367289_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036655844.1|367301_368330_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.7	4.3e-65
WP_096761331.1|369827_370130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042118391.1|371092_372109_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_024093065.1|372204_374136_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	30.7	1.5e-58
WP_036655852.1|374416_375046_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_042118394.1|375059_375557_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_023482499.1|375575_376067_+	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_023482500.1|376063_377074_+	molybdopterin-binding protein	NA	NA	NA	NA	NA
WP_024093067.1|377105_377369_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_024093068.1|377413_378175_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	27.7	1.8e-12
WP_023482502.1|378496_378778_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.2	2.4e-18
WP_024093070.1|378867_380496_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.1	1.4e-158
WP_077585167.1|380584_381082_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	59.8	5.3e-45
WP_080675781.1|381614_381818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585169.1|382056_382269_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077585170.1|382347_382581_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077585279.1|382587_382740_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_042118398.1|383023_383338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|383402_384626_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_051427969.1|384801_385278_-	hypothetical protein	NA	NA	NA	NA	NA
383282:384670	attR	AAGTTGAGTCCGTATAATTGTGTAAAAAGCTAGGTTCCAAAAAATGAAAGGAGCCATATTCATAGCCCTCAGTTAGAATAATGTTGGGACACAAAATTCTAAATATACGAGGTGTTATGAAATGGCTCAATACCAGATTAACGTAGATTCGCAGCTTTTGCATCAACTATTTTTGGGAAATTCTCAGGATGCGGGTGTAGCCAAGCTGCTCGAGTCTGTACTGAACCAAGTCTTACAAGCACAGGTGAGTGAACAAGTGGAAGCAGATCGTTATGAACGAACAGAGAATCGAAAAGCGTACCGGAATGGATCGTATCCACATGGGCTGCATACGCGGGTGGGAACCATTACACTAAGTGTTCCGCGCATCCGTGGCGGGAAGTTCACGACAGAGCTCTTTAGTCGTTACCAGAGAAGTGAACAAGCGTTAATCTTAGCGATGATGGAAATGGTCGTAAACGGCGTCTCTACGCGTAAAGTCTCGCAAGTAACCGAAGAACTCTGCGGAACCGAGTTTTCTAAATCCACTGTTTCAGACCTTTGTAAGCGGCTGGATCCCATCGTAACTGCTTGGAATAATCGAAGCCTGGCAGACAGCCTCTTTCCGTTTGTTCTCGTAGATGCGATGTATCTCAAGGTCCGTGAAGACGGTCGTGTACGCTCACGAGGCATCATGATTGCCATTGGTGTAAACACCGAGGGCTATCGTGAAGTCCTTGGCCTGATGCTGGGTGACACAGAATCTGAAGCAAGCTGGAGTGAGTTTTTCAGCTCTCTAAAAGGACGTGGATTACGAGGTGTGGATCTCATTACCTCCGACGATCATGGCGGCCTTGTACGCGCGGTACGGCAGCAGCTGCAAGGGGTAACATGGCAGCGATGCCAGACTCACTTCACGCGAAATGTATTAGAAGCCTCACCCAAAGCCTTGAAGGATGAGATCCATGGCCGTCTACGGTCGATTCTAGATGCTCCTGATACTGGAACGGCAAGGTTTTTATTAAAACAGACCTTAGCGGCTTATGAAGATAAGGCGGGTAAGGCGATGGGCGTGCTGGAAAGCGGATTTGACGATGCTACCGCCGTCTTAATGCTGCCAGAGCGTTACCGAAAACGGCTGCGCACGACAAATAGCGTTGAGCGTCTCAACGAAGAGGTTAGACGCCGGGAACGTGTCATTCGCATCTTCCCAAACCGTGAATCCGTGATTCGTCTTATTGGTGCTCTATTGATGGAACAGGATGAAAAATGGGCAGCCGGCAAGAAATATCTCGACATGACCGAGTACATGGAATGGCGGAAGGATCGGCCAAAGTCCGATGCCAAAGTGACTCGCATTATGTAGCACAGTCTAGCTGAGGGAATTTACACACAAATTTGGACTTGATC	NA	NA	NA	NA
WP_024093078.1|385292_386393_-	endospore germination permease	NA	NA	NA	NA	NA
WP_080675782.1|386389_387850_-	spore germination protein	NA	NA	NA	NA	NA
WP_024093080.1|388716_389967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|391849_393073_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118402.1|393713_395165_+	amino acid permease	NA	NA	NA	NA	NA
WP_024093084.1|395176_397045_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_024093085.1|397115_398504_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_042118407.1|399053_400316_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.3	1.3e-87
WP_023483974.1|400347_401049_+	protein rep	NA	NA	NA	NA	NA
WP_023483236.1|401519_402743_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093087.1|403476_404925_+	amino acid permease	NA	NA	NA	NA	NA
WP_042119415.1|404982_406845_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_042118410.1|407860_409246_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_023483979.1|409532_409829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042118413.1|410138_410789_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_080675783.1|411018_411834_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWP2	uncultured_phage	53.5	6.9e-42
WP_023483983.1|413294_413852_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.6	7.1e-38
WP_024093094.1|413848_414808_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.0	2.3e-76
WP_024093095.1|414804_415659_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_024093098.1|416771_417137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|417275_418499_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_144083281.1|418491_418797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655893.1|418972_419296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024093101.1|419722_420499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158442219.1|421072_421249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|421636_422860_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093105.1|423861_424743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093106.1|424765_425698_+	type III-B CRISPR module RAMP protein Cmr1	NA	NA	NA	NA	NA
WP_024093107.1|425697_427371_+	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_042118425.1|427373_428495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042118428.1|429387_429792_+	type III-B CRISPR module-associated protein Cmr5	NA	NA	NA	NA	NA
WP_144083282.1|429760_430624_+	type III-B CRISPR module RAMP protein Cmr6	NA	NA	NA	NA	NA
WP_104932516.1|432115_433160_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_023485410.1|433466_434138_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	3.6e-12
WP_024093121.1|435829_436012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024092852.1|436223_437447_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
WP_024093122.1|437978_439235_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_024093123.1|439402_440590_+	alanine racemase	NA	NA	NA	NA	NA
WP_024093124.1|440824_441106_+	CopG family ribbon-helix-helix protein	NA	NA	NA	NA	NA
WP_023485406.1|441109_441460_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	6.9e-15
WP_042119417.1|441631_443836_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_036657428.1|444037_444604_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023485404.1|445000_445459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093128.1|446050_446278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093129.1|446533_447538_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	38.4	7.5e-38
WP_052337368.1|447552_447732_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_096761197.1|448040_448148_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_036655908.1|448309_448666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485402.1|448764_449235_+	SprT family protein	NA	NA	NA	NA	NA
WP_024093134.1|450936_451545_-	LexA repressor-like protein	NA	NA	NA	NA	NA
WP_023483236.1|451609_452833_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093136.1|453396_453987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093137.1|453998_454286_+	hypothetical protein	NA	E2ELK3	Clostridium_phage	51.6	3.8e-19
WP_023483236.1|454644_455868_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 4
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	459407	519731	4023351	transposase,protease	Paenibacillus_phage(43.75%)	53	NA	NA
WP_042118448.1|459407_459758_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023483236.1|459949_461173_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118451.1|461215_462298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093142.1|462311_463526_-	sporulation killing factor system radical SAM maturase	NA	NA	NA	NA	NA
WP_024093143.1|463599_463785_-	sporulation killing factor	NA	NA	NA	NA	NA
WP_042119418.1|464195_464564_+	lectin	NA	NA	NA	NA	NA
WP_023485422.1|465349_465676_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_024093145.1|465814_466117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585116.1|466178_466286_-	TipAS antibiotic-recognition domain-containing protein	NA	NA	NA	NA	NA
WP_042118454.1|466756_468796_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.3	1.4e-11
WP_023483236.1|469079_470303_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093147.1|470407_471022_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_023483236.1|471200_472424_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_158442220.1|472456_472750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093148.1|472846_473059_-	VOC family protein	NA	NA	NA	NA	NA
WP_023485427.1|473246_473702_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093149.1|473698_476866_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_023485429.1|477064_477652_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	36.8	1.2e-11
WP_023485430.1|477706_478675_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_023485431.1|479379_479841_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036655432.1|481622_482051_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093152.1|482282_483008_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042118457.1|483216_483690_+	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_036657176.1|483717_484476_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_036655428.1|484465_485338_+	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
WP_023485438.1|485355_485778_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_036655426.1|485842_489538_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	30.8	2.3e-76
WP_023485440.1|489622_491326_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	3.0e-15
WP_158442221.1|491825_492122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144083284.1|492162_492390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042118461.1|492630_494211_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_036655424.1|494740_495970_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023485444.1|496414_497482_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_042118468.1|497757_498162_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_042118471.1|498139_498709_+	Gx transporter family protein	NA	NA	NA	NA	NA
WP_024093160.1|498744_499578_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	33.7	1.2e-20
WP_036655420.1|499553_500420_+	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	28.9	4.2e-13
WP_024093161.1|500436_501240_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_024093162.1|501372_503295_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_024093163.1|503330_504605_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.4	8.9e-28
WP_023485453.1|504618_506058_+	menaquinone biosynthesis decarboxylase	NA	NA	NA	NA	NA
WP_024093164.1|506047_506914_+	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_024093165.1|507261_507591_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_036655414.1|507600_507906_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_077585262.1|507902_508208_-	response regulator	NA	NA	NA	NA	NA
WP_023483236.1|508376_509600_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118476.1|509684_510455_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
WP_052337372.1|510441_512319_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023483236.1|512362_513586_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118480.1|515576_517559_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	32.2	2.9e-41
WP_036655400.1|517575_518079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093174.1|518283_518841_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	92.0	3.5e-85
WP_104932471.1|518861_519731_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	7.5e-135
>prophage 5
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	528800	593163	4023351	bacteriocin,transposase,tRNA	Paenibacillus_phage(52.94%)	58	NA	NA
WP_023483236.1|528800_530024_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_080675785.1|530102_530435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|531079_532303_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093187.1|532614_532752_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_023483605.1|533448_535152_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.3	3.1e-76
WP_024093190.1|535700_536372_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.8	1.5e-66
WP_023483607.1|536368_536854_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
WP_024093191.1|536846_537584_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
WP_024093192.1|537610_538129_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	1.7e-49
WP_023483611.1|539465_540908_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_024093193.1|541047_542271_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
WP_023483612.1|542560_542962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119424.1|543067_544480_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_080675786.1|544709_545273_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_042118492.1|545256_545877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093197.1|546439_546658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655384.1|546881_547394_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_052337475.1|547814_548438_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_024093199.1|548421_549234_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036655382.1|549290_549494_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_024093200.1|549495_550296_+	thiazole synthase	NA	NA	NA	NA	NA
WP_024093201.1|550292_551219_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_080675787.1|551275_551617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093202.1|553544_553781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|553885_555109_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_158442222.1|556665_556821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093206.1|557197_557575_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_144083285.1|557904_558120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093208.1|558433_559129_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.3	7.8e-18
WP_024093209.1|559125_559482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093210.1|559846_561820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080675788.1|562071_562164_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_104932473.1|562160_563021_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.0	1.6e-44
WP_024093212.1|562936_563626_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023483570.1|563736_564042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093213.1|564366_565356_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_042118504.1|565531_566668_-	virulence factor	NA	NA	NA	NA	NA
WP_024093216.1|566945_567530_-	guanylate kinase	NA	A0A0K2FM14	Brevibacillus_phage	27.8	2.9e-10
WP_036655362.1|568068_569076_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_077996146.1|571071_571689_+	cytochrome (ubi)quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_024093219.1|571693_572008_+	cytochrome c oxidase subunit IV	NA	NA	NA	NA	NA
WP_024093220.1|572134_573001_+	cytochrome c oxidase assembly factor CtaG	NA	NA	NA	NA	NA
WP_023483236.1|573620_574844_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093222.1|575792_576698_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	4.7e-23
WP_023483561.1|576690_577959_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093223.1|578293_579931_+	L-2,4-diaminobutyrate decarboxylase	NA	NA	NA	NA	NA
WP_024093224.1|580155_580953_-	MFS transporter	NA	NA	NA	NA	NA
WP_023483558.1|580953_581439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052337375.1|581681_582800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|582792_584016_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_080675789.1|583974_585438_+	ATP-binding domain-containing protein	NA	A0A2I7SCM7	Paenibacillus_phage	100.0	5.3e-24
WP_024093225.1|585486_586665_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_023483555.1|586847_587654_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_023483554.1|588101_588935_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_024093227.1|589062_590301_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024093228.1|590783_591353_+	maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
WP_024093229.1|591622_591919_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023483236.1|591939_593163_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 6
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	596280	647637	4023351	transposase,holin	Paenibacillus_phage(46.15%)	54	NA	NA
WP_023483236.1|596280_597504_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093234.1|597734_597986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655352.1|598596_599010_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	53.1	1.1e-30
WP_024093236.1|599366_599792_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_024093237.1|599793_600165_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042119436.1|600428_600743_+	MGMT family protein	NA	NA	NA	NA	NA
WP_024093240.1|601132_601303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093241.1|601699_602185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093242.1|602595_603078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093243.1|603601_603901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093244.1|603985_605026_+	oxidoreductase	NA	NA	NA	NA	NA
WP_024093245.1|605303_606365_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_024093246.1|606488_607079_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093247.1|607144_608362_+	MFS transporter	NA	NA	NA	NA	NA
WP_024093248.1|608619_609603_+	phosphotransferase	NA	NA	NA	NA	NA
WP_024093249.1|609934_610837_+	EamA family transporter	NA	NA	NA	NA	NA
WP_024093250.1|610833_611625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093251.1|612024_612756_+	VOC family protein	NA	NA	NA	NA	NA
WP_024093252.1|612806_613289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093253.1|613362_613884_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_024093254.1|614041_615421_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	32.4	5.7e-20
WP_024093255.1|615410_616112_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	7.3e-32
WP_024093257.1|617203_617887_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_023484761.1|617979_618573_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_024093261.1|620075_621089_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	30.6	1.3e-18
WP_080675790.1|621451_622057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042118522.1|622135_622498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042118524.1|622596_623832_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	60.2	1.0e-28
WP_024093264.1|623864_624887_-	Ser/Thr phosphatase family protein	NA	NA	NA	NA	NA
WP_023485180.1|625026_625713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093265.1|625972_626263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042118526.1|626317_626983_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_023485178.1|626989_627508_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_024093267.1|627510_628233_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_024093268.1|628350_629217_+	diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_024093269.1|629220_629574_+	DUF3905 domain-containing protein	NA	NA	NA	NA	NA
WP_080675873.1|629718_630147_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_023485173.1|630593_631400_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	45.2	1.3e-53
WP_036655321.1|631604_632531_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.9	1.0e-36
WP_144083286.1|632514_633429_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093271.1|633523_633916_+	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_042118533.1|633994_634483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|634665_635889_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093995.1|636206_637430_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
WP_023485365.1|638031_638475_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_024093274.1|638830_639202_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_023485363.1|639278_640790_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_024093275.1|640813_641074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093276.1|641119_641536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485361.1|641800_642112_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_024093278.1|643271_644378_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_024093279.1|644397_645627_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_024093280.1|645845_646295_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.3	8.5e-42
WP_023483236.1|646413_647637_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 7
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	654458	706018	4023351	transposase,coat,holin	Paenibacillus_phage(73.68%)	53	NA	NA
WP_023483236.1|654458_655682_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_158676954.1|656559_657288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093289.1|657538_658141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585193.1|658125_658473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485348.1|658503_658905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093291.1|659180_659843_+	hypothetical protein	NA	A0A2I7SC02	Paenibacillus_phage	46.7	5.1e-11
WP_024093292.1|659818_660049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093293.1|660308_660548_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	96.2	4.1e-35
WP_024093295.1|661296_661539_+	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	90.0	6.2e-31
WP_024093296.1|662525_663254_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093297.1|663366_663639_+	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	47.9	1.1e-07
WP_024092850.1|663743_664967_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	3.1e-227
WP_052337378.1|665089_665848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|665854_667078_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_104932476.1|667248_668320_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	98.2	8.3e-152
WP_024093300.1|668707_669034_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024093302.1|669444_669711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093303.1|669794_670838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042118544.1|670857_671163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225766.1|671193_671292_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_024093305.1|671525_671924_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_023483236.1|672012_673236_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093306.1|673512_674520_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_023483236.1|674590_675814_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093307.1|676033_676366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093308.1|676558_677527_+	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_023484380.1|677711_679127_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_023484381.1|679271_680123_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_023483236.1|680487_681711_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_077585292.1|681907_683011_+	radical SAM/CxCxxxxC motif protein YfkAB	NA	NA	NA	NA	NA
WP_023484383.1|683063_684434_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_024093257.1|685487_686171_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	1.7e-118
WP_077585196.1|686351_686564_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_024093310.1|686836_687103_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_040932682.1|687144_687714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093311.1|688106_688403_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	70.6	3.5e-12
WP_023484389.1|688632_689538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225767.1|689660_689795_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093313.1|690741_690939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093314.1|691430_692654_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	2.4e-227
WP_158442257.1|693081_693918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093317.1|695402_695711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155116254.1|695850_695994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932516.1|696802_697847_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_024093318.1|698060_698501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585084.1|698787_699069_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_024093319.1|698876_699173_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_042119445.1|700291_701014_-	NTP transferase domain-containing protein	NA	H9NC64	Sphingomonas_phage	41.0	7.8e-45
WP_158225756.1|701224_701407_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093324.1|701994_702885_+	hypothetical protein	NA	A0A024B055	Bacillus_phage	43.6	3.7e-12
WP_077585255.1|702980_703862_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051427935.1|704427_705303_+	hypothetical protein	NA	D2KRB9	Lactobacillus_phage	33.0	2.6e-10
WP_023484075.1|705619_706018_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
>prophage 8
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	717998	794463	4023351	transposase,tRNA,holin	Paenibacillus_phage(41.18%)	54	NA	NA
WP_023483236.1|717998_719222_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036657135.1|719370_720531_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_144083289.1|720762_720942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585258.1|721253_721409_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	46.0	9.8e-06
WP_023483236.1|721718_722942_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483236.1|723572_724796_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023485165.1|724919_725867_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.8e-23
WP_024093337.1|725882_726659_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_042118565.1|726655_727642_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093339.1|727702_730321_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_024093340.1|730438_731053_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	62.6	7.5e-73
WP_024093342.1|731716_732721_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093343.1|732766_733741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093344.1|733746_735048_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_036657132.1|735470_736619_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.6	8.9e-27
WP_023485156.1|736615_737272_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_036655313.1|737288_738182_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024093345.1|738225_738855_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093346.1|739135_739564_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024093347.1|739844_740432_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_023485151.1|740460_741630_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_023485150.1|741700_742735_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_023483236.1|742934_744158_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093348.1|744231_744441_+	YneF family protein	NA	NA	NA	NA	NA
WP_023485149.1|744796_745387_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	54.4	5.5e-49
WP_024093349.1|745607_746888_-	DUF2935 domain-containing protein	NA	Q56AR7	Bacillus_thuringiensis_phage	42.8	8.1e-37
WP_023485147.1|746961_747993_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023485146.1|748330_749074_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093350.1|749181_750153_+	cation transporter	NA	NA	NA	NA	NA
WP_024093351.1|750312_753012_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_024093353.1|753354_754374_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_024093354.1|754396_755518_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_144083290.1|755678_755894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093356.1|756030_757059_+	UV DNA damage repair endonuclease UvsE	NA	A0A2I2L3D9	Orpheovirus	27.5	7.7e-22
WP_023485140.1|757247_758018_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_036655307.1|758151_758442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485139.1|758952_759807_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_052304390.1|759934_760327_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_024093358.1|760487_761492_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_080675875.1|761567_766067_-	glutamate synthase	NA	NA	NA	NA	NA
WP_023485134.1|766604_767918_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_080675876.1|768009_769011_-	LCP family protein	NA	NA	NA	NA	NA
WP_036657123.1|769584_770055_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_023485131.1|770346_771702_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_042118574.1|773401_773881_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_024093366.1|775604_777488_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.1	6.7e-56
WP_023483479.1|777632_778202_+	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_024093368.1|778507_780046_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	4.4e-21
WP_023483236.1|780289_781513_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093369.1|781685_781859_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024093370.1|781876_782908_-	D-alanine--(R)-lactate ligase VanF	NA	NA	NA	NA	NA
WP_023483236.1|783600_784824_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093373.1|785158_786553_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.9	1.9e-47
WP_023483236.1|793239_794463_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 9
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	805097	867045	4023351	transposase	Paenibacillus_phage(21.74%)	51	NA	NA
WP_023483236.1|805097_806321_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_080675795.1|806331_807525_+	solute:sodium symporter family transporter	NA	NA	NA	NA	NA
WP_023485281.1|807639_808617_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_036655292.1|809171_809657_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.9	1.1e-21
WP_042119450.1|809761_810949_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_036655290.1|811016_812312_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.3	6.3e-21
WP_036655288.1|812385_813270_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.9	1.1e-37
WP_024093384.1|813360_813603_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	35.4	7.4e-08
WP_023485275.1|813676_814372_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_042118586.1|814349_816593_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.4	5.9e-168
WP_080675796.1|816577_818152_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.6	1.5e-48
WP_023485273.1|818246_819293_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.7	3.3e-68
WP_024093387.1|819289_819913_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.3	7.0e-26
WP_042118590.1|820123_821671_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.8	7.7e-74
WP_023485269.1|821689_822970_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_023485268.1|824056_824539_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_024093391.1|824865_825300_-	thiol-disulfide oxidoreductase DCC family protein	NA	NA	NA	NA	NA
WP_024093392.1|825407_826481_-	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_052337382.1|826821_827106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485264.1|827679_827970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093394.1|828137_828926_+	sirohydrochlorin cobaltochelatase CbiX	NA	NA	NA	NA	NA
WP_024093395.1|829075_830020_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_104932477.1|830016_831594_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.1	2.1e-95
WP_024093445.1|831791_834068_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_023483236.1|834295_835519_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118629.1|835683_836346_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080675800.1|837555_837714_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158442225.1|837766_838210_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080675878.1|838618_840556_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.4	1.2e-12
WP_144029518.1|841216_841501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051428052.1|841821_842070_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_158442226.1|842126_843077_+	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	28.5	1.0e-20
WP_023484496.1|843092_843791_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
WP_023484495.1|843796_844951_+	ABC transporter-like protein	NA	NA	NA	NA	NA
WP_023483236.1|845173_846397_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093457.1|847949_848975_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.3	6.7e-18
WP_077996042.1|848880_849759_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093459.1|849763_850561_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024093460.1|851288_853172_+	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.4	3.6e-94
WP_023483236.1|853371_854595_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118638.1|855004_856057_-	Fic family protein	NA	NA	NA	NA	NA
WP_023484171.1|856447_857395_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
WP_024093462.1|857571_858726_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_104932478.1|858731_859151_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_023484174.1|859147_860098_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024093464.1|860090_860837_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
WP_023483236.1|861046_862270_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093465.1|862355_862643_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_024093466.1|862649_863138_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_024093467.1|863134_865933_+	acetyltransferase	NA	NA	NA	NA	NA
WP_104932516.1|866000_867045_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
>prophage 10
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	969818	1064072	4023351	terminase,tRNA,transposase,protease,coat,integrase	Paenibacillus_phage(63.64%)	100	998802:998861	1044323:1045711
WP_023483874.1|969818_972263_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	70.7	0.0e+00
WP_024093537.1|972266_973094_-	late competence protein ComER	NA	NA	NA	NA	NA
WP_077585014.1|973223_973796_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036656460.1|973894_975187_+	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	27.8	8.5e-18
WP_023483878.1|975212_975725_+	dCMP deaminase family protein	NA	A0A222YXY3	Mycobacterium_phage	44.9	3.5e-23
WP_052337397.1|975782_977681_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_023483880.1|977692_978925_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	75.1	4.8e-180
WP_023483881.1|978992_979718_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	42.2	1.5e-11
WP_042118682.1|979992_980202_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	44.3	6.3e-08
WP_077585012.1|980341_981166_+	phage antirepressor Ant	NA	A0A0C5AFE7	Paenibacillus_phage	94.7	1.1e-130
WP_077585011.1|981098_981359_+	helix-turn-helix domain-containing protein	NA	A0A0K2CZS5	Paenibacillus_phage	85.9	1.5e-35
WP_024093542.1|981374_981635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158442230.1|981611_981767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042118685.1|981967_982345_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	89.6	3.8e-59
WP_024093545.1|982341_982563_+	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	91.8	5.6e-31
WP_023485299.1|982700_982934_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	49.3	5.8e-18
WP_024093546.1|982963_983128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093547.1|983156_983912_+	antirepressor	NA	A0A0C5AEJ9	Bacteriophage	76.5	1.5e-107
WP_023485301.1|983908_984217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093548.1|984252_984441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080675807.1|984437_985214_+	hypothetical protein	NA	A0A2I7SCV5	Paenibacillus_phage	73.8	1.8e-55
WP_042118689.1|985228_985420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093551.1|985456_985720_+	hypothetical protein	NA	A0A0K2CZE9	Paenibacillus_phage	56.3	2.2e-13
WP_024093552.1|985727_986159_+	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	53.7	8.5e-07
WP_024093553.1|986155_986734_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	41.2	1.2e-24
WP_023485305.1|986803_988432_+	hypothetical protein	NA	R9TQJ2	Paenibacillus_phage	76.6	3.8e-225
WP_023485306.1|988435_989260_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.8	1.9e-87
WP_042118692.1|989240_990053_+	hypothetical protein	NA	R9TMF6	Paenibacillus_phage	68.9	5.4e-111
WP_158676955.1|990662_991337_+	hypothetical protein	NA	A0A0K2CY85	Paenibacillus_phage	100.0	6.7e-107
WP_052337398.1|991227_992049_+	ATP-binding protein	NA	A0A0K2CYM7	Paenibacillus_phage	98.6	4.9e-120
WP_036656473.1|992167_992377_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	86.8	5.0e-29
WP_042118695.1|992378_992753_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	66.1	7.6e-44
WP_024093562.1|992943_993309_+	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	86.0	1.5e-57
WP_023485190.1|993323_993845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080675881.1|993919_994585_+	site-specific DNA-methyltransferase	NA	A0A1D8KTH4	Synechococcus_phage	51.6	9.3e-61
WP_023485192.1|994678_994987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155116272.1|995449_995620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093566.1|996261_996465_+	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	89.6	2.9e-26
WP_023485194.1|996962_997703_+|terminase	phage-related terminase-like protein small subunit	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	47.5	1.4e-44
WP_024093568.1|997695_998853_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	64.2	1.9e-138
998802:998861	attL	GATCAAGTCCAAATTTGTGTGTAAATTCCCTCAGCTAGACTGTGCTACATAATGCGAGTC	NA	NA	NA	NA
WP_023483236.1|998845_1000069_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023484913.1|1000906_1002208_-	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	35.6	2.5e-62
WP_024093569.1|1002402_1003362_+	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	89.9	2.6e-112
WP_023484911.1|1003376_1003739_+	hypothetical protein	NA	A0A2I7SCG2	Paenibacillus_phage	79.2	6.4e-48
WP_023483236.1|1004207_1005431_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483236.1|1006189_1007413_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118716.1|1007541_1007841_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_144029521.1|1008094_1008445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042118708.1|1008746_1010276_-	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	32.7	4.3e-37
WP_042118705.1|1010287_1010851_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_036658506.1|1010994_1011159_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_023483236.1|1011749_1012973_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023484507.1|1013322_1013526_+|coat	spore coat-like protein	coat	NA	NA	NA	NA
WP_024093574.1|1013544_1013847_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024093577.1|1016051_1016405_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_024093578.1|1016416_1016818_+	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_024093579.1|1017082_1017655_+	ANTAR domain-containing response regulator	NA	NA	NA	NA	NA
WP_024093580.1|1017647_1019072_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_024093581.1|1020671_1022036_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_023484515.1|1022057_1023008_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_023484516.1|1023026_1023680_+	ethanolamine utilization microcompartment protein EutL	NA	NA	NA	NA	NA
WP_024093582.1|1023691_1024432_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_024093583.1|1024582_1026046_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_024093584.1|1026095_1026383_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_036657048.1|1026527_1027355_+	ethanolamine utilization cobalamin adenosyltransferase	NA	NA	NA	NA	NA
WP_024093586.1|1027366_1028005_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_024093587.1|1028023_1028707_+	putative ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_036655159.1|1028719_1028992_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_036655157.1|1028984_1029530_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_024093589.1|1029549_1030665_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_042118720.1|1031002_1031842_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036655155.1|1033278_1033473_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023484522.1|1033806_1034268_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	30.5	2.0e-22
WP_144029556.1|1035187_1035490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093598.1|1035506_1036031_+	VanZ family protein	NA	NA	NA	NA	NA
WP_051427927.1|1036100_1036514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484526.1|1036785_1037088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484527.1|1037473_1037911_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_024093599.1|1038185_1038824_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_024093601.1|1039112_1040174_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_042118723.1|1040228_1041281_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_024093603.1|1041541_1042012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093604.1|1042074_1042452_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_077585253.1|1042498_1042645_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023483236.1|1043114_1044338_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_077585252.1|1044621_1045146_-	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	28.3	1.0e-06
WP_023483236.1|1046815_1048039_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
1044323:1045711	attR	GACTCGCATTATGTAGCACAGTCTAGCTGAGGGAATTTACACACAAATTTGGACTTGATCGTTATTTTCGTAATAAGCAGATAACTCTGCGTATCATTTGGATGAACATGGACGATGGTTGTGCCCATCATCTTCTTTGATTATCTTTCTCCTATTGAATTTGAGAAGGCTGAACATAAAATTTGCCTGACTTAGTGTCCAGTGAATGTTGACAAGTCCAACGGTCACTTTTTTCAAATTGTCCATCTTGCGGATCACGGTTCAACCTTCATTTGGGTCCCGTTTTTTAAGACAATTTTTTATTTTTGATAGTCTTCCGCCAGGATAGCGAAGTTGATATGATCCTCCCACTTGCCGTTGATTTTCAGATAATTCCTGCTGTAACCTTCCCTTGTGAATCCGTTCTTCTCCAGAACGCGCTGTGAAGCAAGATTGCGGGGCATTACATTAGCCTGAACCCGGTGAAGCTTGAGTGCTCCGAAGGCTACATTCAGGCAGAGGTTAACAGCCTCGGTCATAAAACCATGCCCGTTATATTTTTCAGCCATGGAATAGCCCAAATATGCATTCTGGAAGACCCCTCGGGAAATCATACTGAGCCGGATTGTTCCGATCAGGGTCCCGGAGGCACGCAAAAAAATACCGAAACCGTAAGCTTTGTCCAAATCGGCTTCCTCAACGGACTGCTGGACAGCTGCCTGGTGCGAGGCAAGCGTGAAGGAAGCATCATCCTTTAACCCTTCAAATGGGGTGAAAAAGGGCCGGTTCTCATTACGGAATTGATGGTAAGCTTTCGTATACCGGGGTTGGAGGAGCTGCAGCATGACGGATTTTCCGGAAAAACGTTCCTCTATGCCAATATAAGGTGTCATCTCTAGTCCTCCTTTTACATTAATTTCCAACTGAAAGCCCACGGTTTTAATCGTGGGATGAAAGCCGGCTTTGCCAGAACATCCCTTCATGGGATGGGCAGGGCAAACAAATAGCCATGTGCGTGTATTTTTCGTTCAATTGTTGTAGTTGTATAGTTGAACGGATGATATGGAACTGTTAAGAAAAGCCAAACTTGGATTGATGCGTATTATCGAAAAGTCAGGAAAATGGTACGCTCAAATTTCAATAGAAGTACCTACAAGCGTAACAAACAACGAAAACATCATGGGTATTGATCTTGGTTTGAAAGTTCCCGCTGTTTCTGTAACTTCTACGGGTAAAACCCGATTCTTTGGAAACGGCAGAGAAAACAAGTATATACGAAGAAAGTACCAACAACGCAGACGTAAATTAGGTAAACTGAAAAAATTGTCTGTCATTCGTAAGCCAGGTAATAAAGAGCAACGTTGGATGAAAGATCAAAATCATAAGATTAGTCGGCAAATTGTCGATACA	NA	NA	NA	NA
WP_024093610.1|1049128_1050427_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_158442231.1|1050728_1050986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1051729_1052953_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_158442232.1|1053833_1054472_-	ETX/MTX2 family pore-forming toxin	NA	A0A2I7SC07	Paenibacillus_phage	90.5	4.1e-98
WP_024093613.1|1054553_1055777_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	2.4e-227
WP_042118727.1|1056218_1056659_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042118729.1|1056696_1057881_+	MFS transporter	NA	NA	NA	NA	NA
WP_023483961.1|1058054_1058861_+	glutamate racemase	NA	NA	NA	NA	NA
WP_023483960.1|1058966_1060169_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024093618.1|1060253_1060562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093619.1|1060687_1060969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093620.1|1061002_1061194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1062848_1064072_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 11
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1097493	1153892	4023351	transposase,integrase	Paenibacillus_phage(35.71%)	54	1097374:1097433	1152549:1153936
1097374:1097433	attL	AGTTGAGTCCGTATAATTGTGTAAAAAGCTAGGTTCCAAAAAATGAAAGGAGCCATATTC	NA	NA	NA	NA
WP_023483236.1|1097493_1098717_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483928.1|1098926_1099502_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093646.1|1099799_1100468_-	DUF4247 domain-containing protein	NA	NA	NA	NA	NA
WP_024093647.1|1100496_1101030_-	DUF4178 domain-containing protein	NA	NA	NA	NA	NA
WP_024093648.1|1101401_1102919_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.9	2.4e-64
WP_024093649.1|1103034_1103754_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_023483923.1|1104213_1104870_+	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	47.7	1.1e-50
WP_023483922.1|1104905_1105913_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_023483236.1|1107536_1108760_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036655118.1|1109108_1109498_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_023483919.1|1109582_1110101_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_024093650.1|1110246_1111176_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080675885.1|1111193_1111859_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_036655114.1|1111919_1112336_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023483236.1|1112500_1113724_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_158225771.1|1114028_1114454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655110.1|1114547_1115861_-	MFS transporter	NA	NA	NA	NA	NA
WP_096761302.1|1116104_1116584_+	TlpA family protein disulfide reductase	NA	A0A2I2L415	Orpheovirus	33.9	8.0e-06
WP_104932481.1|1116811_1118329_-	citramalate synthase	NA	NA	NA	NA	NA
WP_036655106.1|1118540_1119833_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	33.2	8.8e-23
WP_024093655.1|1119912_1120146_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	50.6	2.3e-14
WP_024093656.1|1120261_1121764_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_024093658.1|1122247_1123345_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_024093659.1|1123371_1124178_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_023483906.1|1124174_1124594_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_036657018.1|1124814_1125540_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_024093660.1|1125567_1126371_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_042119488.1|1126423_1127944_+	MFS transporter	NA	NA	NA	NA	NA
WP_024093662.1|1128096_1128600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052337400.1|1128575_1128860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144083298.1|1128825_1129044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483901.1|1129169_1129487_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	45.7	4.5e-21
WP_024093664.1|1129604_1129874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119489.1|1129843_1131220_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_024093666.1|1131335_1131983_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_023483897.1|1133980_1135471_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_042118766.1|1135519_1136338_-	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	38.9	9.7e-36
WP_023483895.1|1136516_1137074_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_024093669.1|1137271_1137691_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	38.6	2.3e-12
WP_024093670.1|1137936_1138326_-	helix-turn-helix transcriptional regulator	NA	A0A0U4KKM4	Exiguobacterium_phage	31.4	2.2e-09
WP_036655097.1|1138497_1138704_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024093672.1|1139248_1140373_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_036657013.1|1140387_1141689_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_024093673.1|1141685_1144943_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_024093674.1|1145084_1146017_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_024093675.1|1146090_1146963_-	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_024093676.1|1147220_1148018_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_042118769.1|1148119_1149163_-	membrane protein	NA	NA	NA	NA	NA
WP_036657011.1|1149307_1149925_+	DedA family protein	NA	NA	NA	NA	NA
WP_024093678.1|1150082_1150529_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEA5	Paenibacillus_phage	53.1	2.0e-35
WP_024093679.1|1150552_1150798_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_042118772.1|1151058_1151649_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024093681.1|1151740_1152385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1152668_1153892_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
1152549:1153936	attR	AGTTGAGTCCGTATAATTGTGTAAAAAGCTAGGTTCCAAAAAATGAAAGGAGCCATATTCATAGCCCTCAGTTAGAATAATGTTGGGACACAAAATTCTAAATATACGAGGTGTTATGAAATGGCTCAATACCAGATTAACGTAGATTCGCAGCTTTTGCATCAACTATTTTTGGGAAATTCTCAGGATGCGGGTGTAGCCAAGCTGCTCGAGTCTGTACTGAACCAAGTCTTACAAGCACAGGTGAGTGAACAAGTGGAAGCAGATCGTTATGAACGAACAGAGAATCGAAAAGCGTACCGGAATGGATCGTATCCACATGGGCTGCATACGCGGGTGGGAACCATTACACTAAGTGTTCCGCGCATCCGTGGCGGGAAGTTCACGACAGAGCTCTTTAGTCGTTACCAGAGAAGTGAACAAGCGTTAATCTTAGCGATGATGGAAATGGTCGTAAACGGCGTCTCTACGCGTAAAGTCTCGCAAGTAACCGAAGAACTCTGCGGAACCGAGTTTTCTAAATCCACTGTTTCAGACCTTTGTAAGCGGCTGGATCCCATCGTAACTGCTTGGAATAATCGAAGCCTGGCAGACAGCCTCTTTCCGTTTGTTCTCGTAGATGCGATGTATCTCAAGGTCCGTGAAGACGGTCGTGTACGCTCACGAGGCATCATGATTGCCATTGGTGTAAACACCGAGGGCTATCGTGAAGTCCTTGGCCTGATGCTGGGTGACACAGAATCTGAAGCAAGCTGGAGTGAGTTTTTCAGCTCTCTAAAAGGACGTGGATTACGAGGTGTGGATCTCATTACCTCCGACGATCATGGCGGCCTTGTACGCGCGGTACGGCAGCAGCTGCAAGGGGTAACATGGCAGCGATGCCAGACTCACTTCACGCGAAATGTATTAGAAGCCTCACCCAAAGCCTTGAAGGATGAGATCCATGGCCGTCTACGGTCGATTCTAGATGCTCCTGATACTGGAACGGCAAGGTTTTTATTAAAACAGACCTTAGCGGCTTATGAAGATAAGGCGGGTAAGGCGATGGGCGTGCTGGAAAGCGGATTTGACGATGCTACCGCCGTCTTAATGCTGCCAGAGCGTTACCGAAAACGGCTGCGCACGACAAATAGCGTTGAGCGTCTCAACGAAGAGGTTAGACGCCGGGAACGTGTCATTCGCATCTTCCCAAACCGTGAATCCGTGATTCGTCTTATTGGTGCTCTATTGATGGAACAGGATGAAAAATGGGCAGCCGGCAAGAAATATCTCGACATGACCGAGTACATGGAATGGCGGAAGGATCGGCCAAAGTCCGATGCCAAAGTGACTCGCATTATGTAGCACAGTCTAGCTGAGGGAATTTACACACAAATTTGGACTTGATC	NA	NA	NA	NA
>prophage 12
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1193345	1237565	4023351	transposase,protease	uncultured_Mediterranean_phage(25.0%)	42	NA	NA
WP_023483236.1|1193345_1194569_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118793.1|1197433_1198939_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.0	1.1e-19
WP_036658387.1|1198935_1199592_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_036657864.1|1199606_1200305_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_158442258.1|1200772_1200952_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093713.1|1200996_1201206_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_036657866.1|1201367_1202006_+	stage V sporulation protein AA	NA	NA	NA	NA	NA
WP_023482597.1|1201998_1202418_+	stage V sporulation-like protein AB	NA	NA	NA	NA	NA
WP_104932482.1|1202518_1204276_+	spore germination protein	NA	NA	NA	NA	NA
WP_023482599.1|1204397_1205735_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_023483236.1|1206022_1207246_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023482600.1|1207355_1207793_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
WP_036658391.1|1208737_1209850_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.2e-52
WP_023482602.1|1209853_1210519_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
WP_042118800.1|1210553_1211783_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.0	8.1e-111
WP_024093718.1|1211817_1212288_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	6.2e-43
WP_036657869.1|1212718_1213501_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.2	9.7e-09
WP_036658393.1|1213469_1214111_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
WP_158442234.1|1214501_1214984_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_023482608.1|1215063_1215570_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_024093720.1|1215690_1216992_-	ArsB/NhaD family transporter	NA	NA	NA	NA	NA
WP_024093721.1|1217231_1218419_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	31.4	2.4e-19
WP_024093722.1|1218443_1219034_+	spore maturation protein A	NA	NA	NA	NA	NA
WP_024093723.1|1219049_1219583_+	spore maturation protein	NA	NA	NA	NA	NA
WP_036657872.1|1219673_1220012_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_023482614.1|1220031_1220781_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_042118804.1|1220846_1221413_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_024093725.1|1221427_1223098_+	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_024093726.1|1223094_1224339_+	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_023482618.1|1224414_1225128_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.3	3.9e-49
WP_024093727.1|1225129_1226983_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.8	5.4e-34
WP_042119491.1|1227106_1228690_-	phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	35.3	9.0e-46
WP_023482621.1|1229154_1229643_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	41.8	6.2e-30
WP_023482622.1|1229829_1230147_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_036658398.1|1230166_1230760_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_158676956.1|1230801_1230978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657880.1|1231160_1231460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482625.1|1231684_1232293_+	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_024093731.1|1232429_1233680_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_023482627.1|1233720_1234410_+|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_024093733.1|1234811_1236164_+	germination protein YpeB	NA	NA	NA	NA	NA
WP_023483236.1|1236341_1237565_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 13
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1308021	1382245	4023351	transposase,tRNA	Paenibacillus_phage(33.33%)	56	NA	NA
WP_024093784.1|1308021_1309320_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.5	1.3e-61
WP_023482697.1|1309344_1310016_+	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	46.1	8.9e-19
WP_024093785.1|1310100_1310769_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_023483236.1|1311057_1312281_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023482699.1|1312356_1313022_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_024093787.1|1313667_1314933_-	2,3-diketo-5-methylthiopentyl-1-phosphate enolase	NA	NA	NA	NA	NA
WP_042118841.1|1315008_1315866_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_024093789.1|1316008_1317256_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	8.3e-103
WP_024093790.1|1317277_1318399_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.1	4.4e-79
WP_042118843.1|1320167_1321013_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_077585204.1|1321421_1322528_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	48.8	3.8e-51
WP_036658421.1|1322957_1323380_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_036657929.1|1323460_1323796_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_023482710.1|1323816_1324266_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_024093796.1|1324262_1325045_+	sigma-70 family RNA polymerase sigma factor	NA	A0A173GBT3	Bacillus_phage	26.0	1.2e-14
WP_023482712.1|1325365_1326274_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042118848.1|1326421_1327843_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_024093798.1|1327872_1328481_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_042118850.1|1328698_1330033_+	AMIN domain-containing protein	NA	Q0H257	Geobacillus_phage	39.7	1.4e-20
WP_023482716.1|1330046_1330634_+	GerMN domain-containing protein	NA	NA	NA	NA	NA
WP_024093801.1|1330853_1331519_+	endonuclease III	NA	NA	NA	NA	NA
WP_024093802.1|1331580_1331853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052337405.1|1331906_1335587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093806.1|1337258_1338071_+	exported lipase-like protein	NA	NA	NA	NA	NA
WP_023482722.1|1338118_1339096_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.4	4.0e-36
WP_036658426.1|1339088_1340081_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023482724.1|1340108_1342082_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	1.7e-126
WP_042118854.1|1342143_1344603_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.0	4.3e-111
WP_042119500.1|1344667_1345504_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093809.1|1345720_1346299_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023483236.1|1346305_1347529_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_052337406.1|1347655_1348120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093811.1|1348164_1349097_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_024093812.1|1349116_1350265_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_104932484.1|1350282_1351140_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.3	5.3e-24
WP_036657937.1|1351236_1351992_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023482734.1|1352007_1352706_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.5	6.4e-12
WP_023482735.1|1352702_1353095_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093815.1|1353282_1353519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658430.1|1353751_1353982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657941.1|1353978_1354509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093817.1|1354659_1354911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1356225_1357449_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024093819.1|1357682_1366079_+	glycosyltransferase family 36 protein	NA	NA	NA	NA	NA
WP_144083301.1|1367836_1368025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1368351_1369575_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036657950.1|1370370_1370775_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023482813.1|1370785_1371517_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_024093823.1|1371520_1372387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093824.1|1372590_1374525_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_023482817.1|1374521_1375670_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_023482818.1|1375676_1376786_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_042118863.1|1376816_1378262_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_023483236.1|1379106_1380330_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118866.1|1380688_1380979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1381021_1382245_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 14
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1543073	1649462	4023351	coat,transposase,tRNA	Paenibacillus_phage(61.9%)	108	NA	NA
WP_024093941.1|1543073_1544363_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	31.5	4.8e-53
WP_023485109.1|1545291_1546743_+	amino acid permease	NA	NA	NA	NA	NA
WP_077584971.1|1547080_1547347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654351.1|1547734_1548358_+	YhbD family protein	NA	NA	NA	NA	NA
WP_024093944.1|1548466_1548685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093945.1|1549249_1549366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485113.1|1549494_1550391_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_023485114.1|1550550_1551756_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	45.1	3.1e-99
WP_024093947.1|1551827_1552499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052337410.1|1552515_1553043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093949.1|1553039_1553234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093950.1|1553234_1553978_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	3.9e-23
WP_042118943.1|1553974_1554688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1554851_1556075_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023485119.1|1556545_1556980_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042119526.1|1557101_1557701_+	membrane protein	NA	NA	NA	NA	NA
WP_023485122.1|1558343_1559081_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_024093955.1|1559365_1560655_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_024093957.1|1561087_1561990_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_052337411.1|1562857_1563637_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_024093960.1|1563725_1564559_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_036654335.1|1564767_1565202_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024093962.1|1565324_1565636_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_042118945.1|1565797_1566487_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024093964.1|1566585_1567617_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093965.1|1568016_1569300_+	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042118947.1|1569382_1570696_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_024093967.1|1570692_1571538_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023483510.1|1571603_1572020_-	DUF1992 domain-containing protein	NA	NA	NA	NA	NA
WP_036656706.1|1572231_1572699_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024093968.1|1572765_1573839_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_024093969.1|1574070_1575351_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_023483236.1|1575455_1576679_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483514.1|1576873_1577800_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_023483515.1|1578725_1579088_+	replication terminator-like protein	NA	NA	NA	NA	NA
WP_024093972.1|1579124_1580600_-	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_144083307.1|1581803_1581995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093974.1|1582106_1582985_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_023483519.1|1583042_1584476_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_024093975.1|1584475_1585405_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_023483521.1|1585575_1586358_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023483236.1|1586430_1587654_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483522.1|1587837_1588395_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_024093977.1|1588389_1588794_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_036654326.1|1588786_1589119_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_024093978.1|1589124_1589697_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093979.1|1589989_1590340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483525.1|1590701_1591460_-|coat	spore coat associated-like protein	coat	NA	NA	NA	NA
WP_023483236.1|1592940_1594164_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_104932523.1|1594170_1594311_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	94.1	6.5e-09
WP_052337414.1|1594536_1596060_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_023483236.1|1596052_1597276_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_052337415.1|1597357_1598014_+	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_024093982.1|1598467_1599016_+	hypothetical protein	NA	A0A2I7SC06	Paenibacillus_phage	87.9	1.1e-78
WP_024093984.1|1599660_1599864_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	91.0	1.2e-27
WP_024093985.1|1600155_1601571_-	N-acetyl-anhydromuranmyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036654320.1|1602360_1602603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077584962.1|1602580_1602727_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_104932485.1|1602926_1604277_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	62.3	5.3e-95
WP_024093987.1|1604389_1604635_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093988.1|1605131_1605713_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024093989.1|1605807_1606674_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023483541.1|1607375_1608122_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.6	1.2e-35
WP_023483542.1|1608166_1608589_+	OsmC family protein	NA	NA	NA	NA	NA
WP_051427842.1|1608708_1609083_+	cyanase	NA	NA	NA	NA	NA
WP_158442236.1|1609568_1610432_+	phosphotransferase	NA	NA	NA	NA	NA
WP_144083309.1|1610586_1610829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093994.1|1610990_1611413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042118951.1|1611441_1611636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093995.1|1611747_1612971_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
WP_023483236.1|1613141_1614365_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483488.1|1614591_1615224_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_080675819.1|1616417_1616813_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	52.8	3.1e-32
WP_077584958.1|1616933_1617140_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093998.1|1617298_1617619_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	48.1	7.2e-19
WP_024093999.1|1617676_1617976_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023484254.1|1620829_1621384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080548081.1|1622110_1622284_-	DUF3951 domain-containing protein	NA	NA	NA	NA	NA
WP_024094003.1|1622883_1625832_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_023484252.1|1625834_1626326_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_023484251.1|1626342_1627146_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_024094004.1|1627448_1628402_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	55.3	1.4e-94
WP_024094005.1|1628391_1629345_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_023484248.1|1629338_1630097_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.8	7.7e-19
WP_023484247.1|1630223_1631141_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024094007.1|1631363_1631621_+	YqkE family protein	NA	NA	NA	NA	NA
WP_042119545.1|1631651_1632791_+	lactonase family protein	NA	NA	NA	NA	NA
WP_162471813.1|1633071_1633227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484245.1|1633347_1633662_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_024094010.1|1633820_1634300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654303.1|1634450_1635218_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_024094011.1|1635270_1635426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096761326.1|1635455_1636109_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_023484241.1|1636254_1636668_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024094012.1|1636670_1637486_+	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_077585235.1|1637654_1638290_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_024094013.1|1638298_1638733_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_023484237.1|1638775_1639498_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	2.6e-08
WP_077584953.1|1639602_1639776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484236.1|1639941_1640316_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024094015.1|1641123_1641579_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024094016.1|1641760_1642594_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_036656682.1|1642605_1642986_+	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_024094018.1|1643167_1645099_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023484229.1|1645169_1646687_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_042119547.1|1646673_1647900_+	peptidoglycan bridge formation glycyltransferase FemA/FemB family protein	NA	NA	NA	NA	NA
WP_080675820.1|1648015_1648228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1648238_1649462_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 15
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1688922	1804173	4023351	transposase	Paenibacillus_phage(42.11%)	58	NA	NA
WP_023483236.1|1688922_1690146_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_080675889.1|1690292_1692188_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023484191.1|1692611_1693970_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_023483236.1|1694442_1695666_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036656669.1|1695882_1696473_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_023484187.1|1697400_1698228_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024094047.1|1698320_1706087_+	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	38.7	9.5e-64
WP_024094048.1|1706125_1715164_+	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	A0A2K9L3I8	Tupanvirus	26.2	1.3e-96
WP_144083310.1|1715181_1720476_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	31.0	4.8e-59
WP_024094050.1|1720495_1724494_+	non-ribosomal peptide synthase	NA	A0A2K9KZV5	Tupanvirus	26.5	1.3e-69
WP_024094051.1|1724540_1727840_+	non-ribosomal peptide synthase	NA	A0A2K9KZV5	Tupanvirus	26.3	4.0e-96
WP_024094052.1|1728022_1732606_+	type I polyketide synthase	NA	NA	NA	NA	NA
WP_024094053.1|1732606_1738189_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	39.2	3.2e-53
WP_024094054.1|1738203_1746426_+	non-ribosomal peptide synthase	NA	A0A2K9L3I8	Tupanvirus	26.5	6.1e-154
WP_042118959.1|1746441_1747383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042118960.1|1747399_1750501_+	cyclic peptide export ABC transporter	NA	G1BNF7	Mycobacterium_phage	27.7	6.6e-16
WP_023485312.1|1750577_1751390_+	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024094058.1|1751418_1751688_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_024094059.1|1751702_1752233_-	antiterminator LoaP	NA	NA	NA	NA	NA
WP_051427829.1|1752573_1757073_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	24.8	3.6e-79
WP_023485315.1|1757169_1758222_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_024094060.1|1758227_1758479_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_024094061.1|1758481_1759651_+	acyl-CoA dehydrogenase YngJ	NA	NA	NA	NA	NA
WP_023485317.1|1759745_1760729_+	2,3-diaminopropionate biosynthesis protein SbnA	NA	C3U2M1	Lactococcus_phage	30.2	8.1e-29
WP_024094062.1|1760754_1761723_+	2,3-diaminopropionate biosynthesis protein SbnB	NA	NA	NA	NA	NA
WP_023485319.1|1761794_1762565_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_144083311.1|1762728_1762869_+	amidohydrolase	NA	NA	NA	NA	NA
WP_024094063.1|1763190_1764054_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_023485323.1|1764906_1765785_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_024094064.1|1765842_1767381_+	DUF4127 family protein	NA	A0A218KDG5	Bacillus_phage	27.4	4.8e-36
WP_023485325.1|1767447_1769310_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2I2L3T4	Orpheovirus	24.7	1.0e-32
WP_024094065.1|1769449_1770343_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024094066.1|1770599_1771358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485328.1|1771379_1772279_+	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_024094067.1|1772275_1773172_+	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_023483236.1|1773276_1774500_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_144083312.1|1775712_1775901_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024094069.1|1775966_1779437_+	CoA-substrate-specific enzyme activase	NA	NA	NA	NA	NA
WP_024094070.1|1781450_1781825_+	YxeA family protein	NA	NA	NA	NA	NA
WP_023484562.1|1782465_1783848_+	amino acid permease	NA	NA	NA	NA	NA
WP_024094071.1|1784006_1785209_-	MFS transporter	NA	NA	NA	NA	NA
WP_036654217.1|1785231_1785813_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024094073.1|1785985_1786570_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023483236.1|1786834_1788058_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094074.1|1788184_1788535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094075.1|1788537_1788852_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_144083313.1|1790370_1790631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144083314.1|1790594_1791266_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_024094080.1|1792001_1792874_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_042118962.1|1794712_1795495_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_023483236.1|1796695_1797919_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094087.1|1798100_1798568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094088.1|1798635_1799448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484571.1|1799434_1800241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094089.1|1800237_1801041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654223.1|1801053_1801704_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	3.4e-31
WP_024094090.1|1801700_1802699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1802949_1804173_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 16
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1850925	1908838	4023351	bacteriocin,transposase	Paenibacillus_phage(73.33%)	47	NA	NA
WP_104932487.1|1850925_1851970_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_023483236.1|1852047_1853271_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118965.1|1853335_1854829_+	antitoxin	NA	NA	NA	NA	NA
WP_036656629.1|1854912_1855476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094102.1|1855600_1856497_-	cation transporter	NA	NA	NA	NA	NA
WP_024094104.1|1857479_1857848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094105.1|1858038_1858773_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023484542.1|1858828_1859614_-	delta-lactam-biosynthetic de-N-acetylase	NA	NA	NA	NA	NA
WP_024094106.1|1859727_1861245_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_104932525.1|1861323_1862340_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_023484539.1|1862914_1863187_-	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
WP_023483236.1|1863810_1865034_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094111.1|1865529_1866960_-	MBL fold metallo-hydrolase	NA	A0A2N9QVZ6	Dishui_lake_phycodnavirus	36.6	1.3e-06
WP_036654194.1|1867034_1868234_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023483236.1|1869265_1870489_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094115.1|1871886_1872945_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_024094116.1|1873059_1874076_+	NTP transferase domain-containing protein	NA	K7QKA7	Escherichia_phage	33.5	8.7e-26
WP_023483236.1|1874144_1875368_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_104932488.1|1876413_1876641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484729.1|1876730_1877504_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_024094118.1|1877781_1878996_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	8.3e-225
WP_080675823.1|1879226_1879754_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_023483236.1|1879812_1881036_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042119567.1|1881078_1881414_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024094119.1|1881449_1882130_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_024094120.1|1882134_1883667_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_023483236.1|1883876_1885100_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023484736.1|1885435_1886554_-	glycosyltransferase-like protein	NA	NA	NA	NA	NA
WP_023484737.1|1886730_1887558_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_080548066.1|1887541_1888045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042118973.1|1888005_1889568_-	gluconokinase	NA	NA	NA	NA	NA
WP_042118974.1|1889602_1890964_-	GntP family permease	NA	NA	NA	NA	NA
WP_024094123.1|1891074_1891752_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042118976.1|1892929_1893247_-	DUF4870 domain-containing protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	45.0	5.8e-13
WP_023483236.1|1893887_1895111_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_077995404.1|1896249_1896516_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_024094127.1|1896892_1897039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1897204_1898428_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094128.1|1898594_1899365_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
WP_023483236.1|1899981_1901205_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094130.1|1902451_1903000_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023484629.1|1903233_1904406_+	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_023484628.1|1904489_1904918_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_024094131.1|1905084_1905474_-	DoxX family protein	NA	NA	NA	NA	NA
WP_051427817.1|1906674_1906980_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_024094134.1|1907209_1907476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1907614_1908838_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 17
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	1913959	1987743	4023351	transposase	Paenibacillus_phage(46.67%)	42	NA	NA
WP_023483236.1|1913959_1915183_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118982.1|1915592_1916423_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_023484619.1|1917113_1918322_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_023483236.1|1918873_1920097_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042118983.1|1921614_1922307_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.2	1.0e-46
WP_042118984.1|1925453_1925912_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.6	6.5e-13
WP_042119570.1|1926121_1927456_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024094146.1|1927563_1930212_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.9	4.0e-38
WP_023484611.1|1931412_1931730_+	multifunctional tetracycline-metal/hydrogen antiporter-like protein	NA	NA	NA	NA	NA
WP_024094150.1|1931982_1933224_-	lipase Lip	NA	NA	NA	NA	NA
WP_024094151.1|1933476_1935777_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_023484608.1|1936362_1937445_+	tyrosine recombinase XerS	NA	A0A2R2ZGM9	Clostridioides_phage	25.6	3.9e-08
WP_036654135.1|1937506_1939252_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	1.7e-61
WP_024094153.1|1939431_1940235_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_023484605.1|1940241_1940871_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042119572.1|1940963_1943657_-	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	40.6	1.2e-95
WP_024094155.1|1943656_1943821_-	GapA-binding peptide SR1P	NA	NA	NA	NA	NA
WP_024094156.1|1944102_1945338_-	MFS transporter	NA	NA	NA	NA	NA
WP_024094157.1|1945567_1947097_-	fumarate hydratase class I, aerobic	NA	NA	NA	NA	NA
WP_024094158.1|1947183_1948077_-	phosphonopyruvate hydrolase PphA	NA	NA	NA	NA	NA
WP_023484600.1|1948097_1949093_-	oxidoreductase-like protein	NA	NA	NA	NA	NA
WP_024094159.1|1949114_1950320_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_024094160.1|1950316_1951552_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_024092920.1|1951612_1952836_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
WP_024094161.1|1953111_1953594_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_023483236.1|1953953_1955177_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094163.1|1958333_1959392_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_023484594.1|1959649_1960927_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_042118988.1|1961095_1962022_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_023484592.1|1962025_1962457_-	NfeD family protein	NA	NA	NA	NA	NA
WP_023483236.1|1964124_1965348_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023484590.1|1965572_1966454_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_036654129.1|1966480_1967143_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_042118989.1|1967611_1976005_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.1	1.4e-92
WP_042119574.1|1976026_1979248_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.2	1.3e-83
WP_096761293.1|1981413_1981593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094172.1|1982167_1982353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077584916.1|1982812_1982974_+	serine hydrolase	NA	NA	NA	NA	NA
WP_158442238.1|1982868_1983759_+	DUF3471 domain-containing protein	NA	NA	NA	NA	NA
WP_023483236.1|1983986_1985210_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042119576.1|1985609_1986599_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_104932490.1|1986780_1987743_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.1	6.9e-57
>prophage 18
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2019050	2072761	4023351	transposase,tRNA	Paenibacillus_phage(50.0%)	41	NA	NA
WP_024093891.1|2019050_2020274_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
WP_024094200.1|2020596_2021559_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	34.0	2.5e-38
WP_023483094.1|2021705_2022725_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	9.7e-17
WP_023483095.1|2022711_2023638_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.8e-20
WP_036654095.1|2023651_2024617_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023483097.1|2024635_2025541_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024094202.1|2025555_2027355_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023483099.1|2027515_2028547_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	46.7	1.3e-90
WP_046655160.1|2028601_2030881_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	65.1	1.5e-267
WP_104932526.1|2031117_2032163_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	4.6e-06
WP_042119003.1|2032785_2033970_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_042119005.1|2034023_2034794_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023483236.1|2034858_2036082_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483236.1|2036405_2037629_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094206.1|2037621_2038515_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_024094207.1|2038697_2041247_+	O-GlcNAcase NagJ	NA	NA	NA	NA	NA
WP_024094209.1|2043307_2044120_-	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	37.2	7.9e-38
WP_024094210.1|2044261_2045665_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_024094211.1|2045741_2046020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119006.1|2046218_2046908_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104932490.1|2046823_2047786_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.1	6.9e-57
WP_023484814.1|2047935_2049663_-	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_023484813.1|2049659_2050859_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.5	1.8e-30
WP_023484812.1|2051158_2051737_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_052337480.1|2051988_2053488_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_023484810.1|2053537_2054710_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_036654081.1|2054725_2054905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144083353.1|2055862_2056120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094215.1|2055960_2056806_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_024094216.1|2056821_2057781_-	glycerophosphodiester phosphodiesterase family protein	NA	NA	NA	NA	NA
WP_024094217.1|2057978_2059202_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
WP_036656585.1|2059387_2060476_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_024094218.1|2060672_2061671_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_052337429.1|2063338_2063671_+	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
WP_023483236.1|2064044_2065268_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036656580.1|2066564_2066768_+	YqaE/Pmp3 family membrane protein	NA	A0A2I7SCF5	Paenibacillus_phage	97.0	1.6e-27
WP_024094226.1|2066969_2067401_+	universal stress protein	NA	NA	NA	NA	NA
WP_024094227.1|2067639_2068941_-	LCP family protein	NA	NA	NA	NA	NA
WP_023483236.1|2069160_2070384_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042119594.1|2070825_2071215_-	membrane protein	NA	NA	NA	NA	NA
WP_024094229.1|2071279_2072761_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2164924	2219461	4023351	integrase,transposase,protease,tRNA	Paenibacillus_phage(39.13%)	59	2203846:2203860	2219475:2219489
WP_042119028.1|2164924_2166319_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	3.8e-40
WP_024094291.1|2166488_2167031_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024094292.1|2167209_2168538_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_024094293.1|2168550_2170641_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
WP_024094294.1|2170788_2171157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|2171259_2172483_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_144083316.1|2172571_2173405_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	42.9	4.9e-27
WP_023483236.1|2173360_2174584_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023484651.1|2174792_2175728_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_024094296.1|2175784_2176945_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_024094298.1|2177332_2177593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094299.1|2177624_2178020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119030.1|2178235_2179759_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_024094301.1|2179856_2180261_-	YraN family protein	NA	NA	NA	NA	NA
WP_023484363.1|2180270_2180603_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_024094302.1|2180599_2182411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094303.1|2182465_2183149_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.7	9.7e-21
WP_024094304.1|2183441_2184323_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_023484359.1|2184414_2185017_-	signal peptidase I	NA	NA	NA	NA	NA
WP_023484358.1|2185128_2185470_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024094305.1|2185612_2186365_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_024094306.1|2186361_2186883_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_023484355.1|2187108_2187339_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_023484354.1|2187361_2187634_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_023484353.1|2187675_2189043_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_024094307.1|2189072_2189435_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_023484351.1|2189568_2190576_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_023484350.1|2190660_2194239_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_024094308.1|2194407_2195109_-	ribonuclease III	NA	A0A167RGU4	Powai_lake_megavirus	30.0	9.3e-27
WP_024094309.1|2195288_2196524_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024094310.1|2196613_2196847_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.0	6.0e-07
WP_024094311.1|2196965_2197706_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	36.4	5.0e-23
WP_023484345.1|2197805_2198741_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024094312.1|2198772_2199759_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_024094313.1|2199769_2200756_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_080675831.1|2200757_2201348_-	transcription factor FapR	NA	NA	NA	NA	NA
WP_023484341.1|2201523_2201697_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_024094315.1|2201815_2202328_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_042119611.1|2202415_2203489_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_024094317.1|2203673_2205023_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
2203846:2203860	attL	TTATTTTATCTGAAA	NA	NA	NA	NA
WP_023484338.1|2205033_2205543_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	2.0e-26
WP_024094318.1|2205560_2206118_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_024094320.1|2206667_2206865_-	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	76.9	2.4e-09
WP_024094321.1|2206929_2207343_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	98.6	8.7e-33
WP_024094322.1|2207490_2207880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932493.1|2208324_2208771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094325.1|2209141_2210473_-	GlcNAc-binding protein A	NA	A0A2D1GD28	Mycobacterium_phage	29.3	4.1e-07
WP_024094326.1|2210863_2211106_-	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	97.5	7.3e-32
WP_080675891.1|2211115_2211784_-	hypothetical protein	NA	A0A0K2CXQ8	Paenibacillus_phage	95.5	4.4e-127
WP_024094328.1|2211783_2212023_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
WP_042119035.1|2214994_2215345_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.0	8.4e-29
WP_077584875.1|2215601_2215928_-	hypothetical protein	NA	A0A0C5AFG5	Paenibacillus_phage	82.2	1.6e-45
WP_024094334.1|2216039_2216555_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_042119037.1|2216637_2216841_-	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	40.0	6.8e-07
WP_024094338.1|2217436_2217661_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052337432.1|2217807_2218251_+	LexA family transcriptional regulator	NA	A6XML9	Bacillus_virus	37.5	1.0e-10
WP_052337433.1|2218257_2218506_+	hypothetical protein	NA	A0A0N9RTK0	Paenibacillus_phage	53.7	1.0e-17
WP_024094340.1|2218525_2218861_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	43.2	6.8e-12
WP_052752961.1|2218975_2219461_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	57.9	1.7e-27
2219475:2219489	attR	TTATTTTATCTGAAA	NA	NA	NA	NA
>prophage 20
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2297906	2389505	4023351	tail,transposase,plate	Paenibacillus_phage(44.23%)	100	NA	NA
WP_023483236.1|2297906_2299130_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023484131.1|2299842_2300268_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_036658850.1|2300286_2301078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094395.1|2301118_2302411_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_042119625.1|2302537_2302888_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_024094397.1|2302892_2303279_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_096761131.1|2303382_2303901_-	shikimate kinase	NA	NA	NA	NA	NA
WP_042119048.1|2304031_2305267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658354.1|2305272_2305977_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.2e-13
WP_042119050.1|2306314_2306800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|2306959_2308183_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_144083318.1|2308175_2308940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077584869.1|2309684_2309786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119627.1|2310263_2310527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485372.1|2310528_2311941_-	NADP-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	29.4	3.9e-32
WP_024094401.1|2312617_2312857_-	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	67.5	1.0e-22
WP_024094402.1|2313617_2315180_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_024094403.1|2315995_2316481_+	hypothetical protein	NA	A0A0C5AN10	Bacteriophage	66.2	1.5e-52
WP_023483534.1|2316691_2317441_+	DUF4065 domain-containing protein	NA	A0A0C5ABL3	Bacteriophage	67.5	5.1e-92
WP_024094405.1|2317648_2318872_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	5.8e-226
WP_024094406.1|2319184_2319736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094407.1|2319937_2320420_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.3	1.4e-26
WP_023483236.1|2321957_2323181_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094410.1|2323173_2323578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484264.1|2323597_2324710_-	AAA family ATPase	NA	A0A1S5V1G7	Saudi_moumouvirus	28.8	1.5e-15
WP_024094411.1|2325022_2325265_-	hypothetical protein	NA	A0A0K2CZD0	Paenibacillus_phage	96.2	9.5e-32
WP_024094415.1|2326721_2326961_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
WP_024094416.1|2326996_2327155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094417.1|2327147_2327543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094418.1|2327555_2328959_-	kelch-like protein	NA	S5MNY5	Brevibacillus_phage	37.5	5.4e-10
WP_024094419.1|2328962_2329241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094420.1|2329237_2329801_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	46.9	1.8e-36
WP_024094421.1|2329811_2330888_-|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	52.4	2.5e-100
WP_024094422.1|2330880_2331291_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	48.5	1.1e-27
WP_024094423.1|2331293_2331536_-	DUF2577 domain-containing protein	NA	S5MC71	Brevibacillus_phage	37.6	9.9e-13
WP_024094424.1|2331535_2332519_-	phage cell wall hydrolase	NA	S5MNC9	Brevibacillus_phage	55.6	1.0e-103
WP_024094425.1|2332523_2333162_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	50.5	4.4e-52
WP_144083319.1|2333158_2335108_-	hypothetical protein	NA	S5MNW9	Brevibacillus_phage	46.9	8.6e-139
WP_023485206.1|2335490_2335916_-	hypothetical protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_024094428.1|2335942_2336407_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	62.1	2.7e-51
WP_024094429.1|2336408_2337740_-	phage protein	NA	A0A0K2CNL4	Brevibacillus_phage	48.7	2.5e-113
WP_042119056.1|2337740_2337923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485203.1|2337915_2338326_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	46.8	7.8e-26
WP_024094431.1|2338322_2338733_-	HK97 gp10 family phage protein	NA	S5MNW5	Brevibacillus_phage	61.1	1.4e-38
WP_024094432.1|2338732_2339092_-	hypothetical protein	NA	S5M673	Brevibacillus_phage	54.7	3.7e-32
WP_036656482.1|2339093_2339462_-	hypothetical protein	NA	S5MP25	Brevibacillus_phage	55.8	2.1e-30
WP_024094434.1|2339448_2339682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|2340671_2341895_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042119629.1|2342225_2342918_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024094437.1|2342890_2345293_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_023483599.1|2345305_2346055_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_024094438.1|2346068_2347241_-	unsaturated glucuronyl hydrolase Ugl	NA	NA	NA	NA	NA
WP_024094439.1|2347254_2347971_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_023483596.1|2347990_2348476_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_024094440.1|2348489_2349281_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_024094441.1|2349273_2350053_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_024094442.1|2350064_2350493_-	PTS IIA component	NA	NA	NA	NA	NA
WP_104932495.1|2351424_2352048_+	DUF1054 domain-containing protein	NA	NA	NA	NA	NA
WP_042119632.1|2352559_2353828_-	MFS transporter	NA	NA	NA	NA	NA
WP_024094445.1|2354004_2355474_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_023483588.1|2355617_2356037_+	DUF1885 family protein	NA	NA	NA	NA	NA
WP_023483587.1|2356111_2356426_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_024094447.1|2356483_2357494_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_036654741.1|2357595_2357778_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_042119059.1|2357784_2358261_-	cytochrome c biogenesis protein CcdC	NA	NA	NA	NA	NA
WP_080675892.1|2358449_2359184_+	MBL fold metallo-hydrolase	NA	U5PU04	Bacillus_phage	39.7	7.9e-45
WP_104932496.1|2359314_2359542_-	DUF3892 domain-containing protein	NA	G3MB34	Bacillus_virus	38.9	4.9e-06
WP_024094452.1|2359719_2361348_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_096761174.1|2361353_2361797_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023483236.1|2362133_2363357_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483580.1|2363550_2364003_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_023483579.1|2364158_2364584_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_023483578.1|2364892_2365300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148295689.1|2365248_2366112_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	3.7e-17
WP_152532817.1|2366203_2366932_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.9	6.2e-18
WP_152532850.1|2366897_2367053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483575.1|2367402_2367924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483574.1|2367998_2368370_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023483236.1|2368545_2369769_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483236.1|2369939_2371163_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042119637.1|2371392_2372682_+	NCS2 family permease	NA	NA	NA	NA	NA
WP_024094456.1|2372963_2373350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|2373494_2374718_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_080675893.1|2375336_2376551_-	family 10 glycosylhydrolase	NA	A0A2I7SC76	Paenibacillus_phage	88.5	3.2e-27
WP_024094458.1|2377185_2377518_-	hypothetical protein	NA	A0A2I7SCG0	Paenibacillus_phage	89.2	1.6e-29
WP_023484756.1|2377667_2378057_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	49.3	6.5e-06
WP_024094459.1|2378246_2378450_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	88.1	5.0e-26
WP_042119063.1|2379074_2379407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|2379413_2380637_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094461.1|2380701_2381115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094463.1|2382000_2382222_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
WP_024094464.1|2382718_2382910_+	hypothetical protein	NA	A0A2I7SC20	Paenibacillus_phage	98.4	1.6e-29
WP_042119065.1|2382906_2383176_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	98.8	9.0e-39
WP_024094466.1|2383179_2383392_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	78.8	6.4e-24
WP_036654757.1|2383728_2384277_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	81.4	1.3e-73
WP_036654758.1|2384613_2385114_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	7.1e-05
WP_104932516.1|2385707_2386752_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_024094469.1|2387285_2387696_+	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	38.8	6.6e-09
WP_024094470.1|2387727_2388144_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
WP_023483236.1|2388281_2389505_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 21
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2468126	2534587	4023351	transposase,tRNA	Paenibacillus_phage(29.41%)	54	NA	NA
WP_024094515.1|2468126_2469335_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_024094516.1|2469337_2470510_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_080675894.1|2470641_2471235_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	43.8	4.0e-23
WP_024094518.1|2471548_2472325_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023483698.1|2472321_2473245_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.7	4.9e-36
WP_023483697.1|2473388_2473694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094519.1|2473727_2473937_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_024094520.1|2474120_2474621_-	YpuI family protein	NA	NA	NA	NA	NA
WP_052337434.1|2474818_2475499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052337435.1|2475492_2476653_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	38.3	6.2e-60
WP_024093891.1|2476799_2478023_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
WP_024093613.1|2478193_2479417_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	2.4e-227
WP_024094521.1|2480057_2481173_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_024094522.1|2481148_2481907_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024094523.1|2481910_2482741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094524.1|2482884_2484012_-	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	37.2	3.8e-38
WP_024094525.1|2484058_2485885_-	DNA primase	NA	A0A1S5REW9	Helicobacter_phage	32.7	1.8e-42
WP_023483689.1|2485927_2486401_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_024094526.1|2486482_2487310_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_023483687.1|2487535_2488288_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_104932500.1|2488329_2488482_-	YqzL family protein	NA	NA	NA	NA	NA
WP_023483686.1|2488586_2489489_-	GTPase Era	NA	NA	NA	NA	NA
WP_023483685.1|2489534_2489945_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_024094527.1|2489961_2490678_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_024094528.1|2490674_2491187_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_036656868.1|2491278_2493519_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_024094530.1|2493557_2494529_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	47.4	1.8e-49
WP_023483680.1|2494547_2495726_-	sporulation protein YqfD	NA	NA	NA	NA	NA
WP_024094531.1|2495749_2496031_-	sporulation protein YqfC	NA	NA	NA	NA	NA
WP_023483678.1|2496224_2496665_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.4	1.2e-19
WP_024094532.1|2496679_2496853_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_036656869.1|2496999_2497344_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_024094534.1|2499763_2501185_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	32.9	3.6e-38
WP_024094535.1|2501171_2501882_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	4.6e-34
WP_024094536.1|2501910_2503281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052337436.1|2503476_2504436_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_024094538.1|2504683_2505427_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_024094539.1|2505595_2507860_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	44.7	2.1e-189
WP_024094540.1|2507985_2510601_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_023483236.1|2510818_2512042_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094541.1|2512282_2512813_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_023483665.1|2512955_2513567_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_024094542.1|2513787_2514510_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_024094543.1|2514676_2515015_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_024094544.1|2515029_2517474_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024094545.1|2517647_2518871_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	3.4e-226
WP_024094546.1|2519113_2519338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094547.1|2519442_2522895_-	AAA family ATPase	NA	A0A1D8KRV2	Synechococcus_phage	32.0	3.5e-10
WP_024094548.1|2522908_2524081_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_042119081.1|2524097_2528273_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	25.1	2.6e-07
WP_024094550.1|2528250_2531853_-	helicase-exonuclease AddAB subunit AddB	NA	NA	NA	NA	NA
WP_024093116.1|2532320_2532830_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158442240.1|2532847_2533282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|2533363_2534587_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 22
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2540724	2592832	4023351	transposase,protease,tRNA	Paenibacillus_phage(47.06%)	42	NA	NA
WP_024094558.1|2540724_2542074_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_024094559.1|2542076_2542844_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_023483648.1|2543009_2543687_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_023483646.1|2544874_2545246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094561.1|2545262_2545403_-	YfhD family protein	NA	NA	NA	NA	NA
WP_024094562.1|2545553_2546675_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	34.8	2.0e-31
WP_024094563.1|2546834_2548688_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.2	1.9e-143
WP_023483643.1|2548744_2549344_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_024094564.1|2549466_2550498_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_104932501.1|2550541_2550988_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042119652.1|2551077_2551494_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024094566.1|2551636_2552788_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_023483638.1|2552868_2554683_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.7	4.4e-20
WP_024094567.1|2554759_2555203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094568.1|2556636_2557632_-	GPR endopeptidase	NA	NA	NA	NA	NA
WP_036656512.1|2557817_2558090_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_036656508.1|2558188_2559214_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_042119084.1|2559545_2560583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094570.1|2560572_2561127_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024094571.1|2561651_2562326_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	1.6e-31
WP_024092852.1|2562401_2563625_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
WP_024094572.1|2563713_2566242_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_023483236.1|2566714_2567938_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_144083321.1|2568046_2568325_-	hypothetical protein	NA	M1PSD2	Streptococcus_phage	54.2	2.7e-14
WP_024094574.1|2568764_2569004_-	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	66.2	3.0e-22
WP_024094402.1|2569764_2571327_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_144083322.1|2572076_2572628_+	hypothetical protein	NA	A0A0C5AN10	Bacteriophage	66.2	1.7e-52
WP_024093891.1|2572830_2574054_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
WP_024093613.1|2574224_2575448_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	2.4e-227
WP_023484146.1|2576719_2577676_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_024094577.1|2577850_2581291_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	5.1e-09
WP_023484144.1|2581567_2582110_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_023484143.1|2582215_2583010_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_036654904.1|2583036_2583222_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_036656935.1|2583403_2583649_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023484142.1|2583926_2584544_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	6.5e-16
WP_024094581.1|2584689_2584956_-	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	72.7	1.9e-28
WP_042119086.1|2585452_2585683_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	47.9	7.5e-10
WP_052337438.1|2585783_2586875_-	LCP family protein	NA	NA	NA	NA	NA
WP_104932485.1|2588292_2589644_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	62.3	5.3e-95
WP_024094586.1|2590990_2591341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094545.1|2591608_2592832_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	3.4e-226
>prophage 23
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2607387	2746321	4023351	terminase,tRNA,tail,portal,transposase,protease,coat,integrase	Paenibacillus_phage(79.07%)	143	2620598:2620614	2702861:2702877
WP_024094599.1|2607387_2608350_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_024094600.1|2608337_2609117_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024094601.1|2609237_2611286_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.5	2.0e-66
WP_024094602.1|2611316_2613998_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.2	1.3e-28
WP_023482838.1|2614121_2615477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482839.1|2615578_2616148_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_024094604.1|2616961_2617456_+	DUF4352 domain-containing protein	NA	A0A0N7GFE7	Paenibacillus_phage	100.0	2.7e-41
WP_024094605.1|2617492_2618125_+	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	68.1	3.7e-51
WP_024094606.1|2618291_2618567_+	hypothetical protein	NA	A0A2I7SCF3	Paenibacillus_phage	95.6	3.3e-44
WP_052337440.1|2618617_2618968_+	hypothetical protein	NA	A0A2I7SCF2	Paenibacillus_phage	90.5	7.5e-54
WP_042119092.1|2619390_2619624_-	helix-turn-helix transcriptional regulator	NA	A0A2K9V490	Faecalibacterium_phage	37.3	2.5e-05
WP_024094610.1|2619763_2620186_+	hypothetical protein	NA	O48383	Streptococcus_phage	75.0	3.7e-07
WP_042119095.1|2620323_2621415_+	hypothetical protein	NA	NA	NA	NA	NA
2620598:2620614	attL	AGCAAAAAATAAAGCTG	NA	NA	NA	NA
WP_024094612.1|2621561_2622194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094613.1|2622196_2622406_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042119096.1|2622545_2622827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094615.1|2622967_2623186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119098.1|2623239_2623518_+	hypothetical protein	NA	A0A0K2CZR1	Paenibacillus_phage	80.5	3.2e-31
WP_052337441.1|2623702_2624572_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	94.8	6.1e-161
WP_042119101.1|2624967_2625399_-	hypothetical protein	NA	A0A0N9S7V6	Paenibacillus_phage	67.8	2.0e-48
WP_024094620.1|2625404_2627723_-	phage minor structural protein	NA	A0A0N9SIL8	Paenibacillus_phage	93.9	0.0e+00
WP_024094621.1|2627725_2629183_-|tail	phage tail family protein	tail	A0A0N9RRA9	Paenibacillus_phage	96.9	4.7e-283
WP_024094622.1|2629184_2630021_-	hypothetical protein	NA	A0A0N9SJR9	Paenibacillus_phage	52.4	1.8e-32
WP_052337442.1|2630177_2632079_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	75.4	3.3e-220
WP_024094624.1|2632106_2632277_-	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	70.9	1.8e-13
WP_024094625.1|2632456_2632840_-	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	67.7	5.0e-43
WP_042119103.1|2632842_2633100_-	hypothetical protein	NA	A0A0K2CZ43	Paenibacillus_phage	51.9	1.4e-12
WP_042119105.1|2633164_2633713_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	98.4	6.2e-95
WP_024094628.1|2633725_2634100_-	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	96.0	1.6e-62
WP_024094629.1|2634096_2634522_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	95.0	1.3e-71
WP_024094630.1|2634518_2634851_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	94.5	1.1e-54
WP_024094631.1|2634851_2635235_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	95.3	9.7e-63
WP_024094633.1|2636292_2636928_-	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	83.4	1.6e-54
WP_024094634.1|2637016_2637880_-	hypothetical protein	NA	A0A0N9SJR1	Paenibacillus_phage	92.7	4.9e-147
WP_042119106.1|2637876_2639373_-|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	93.5	1.3e-251
WP_024094636.1|2639402_2639861_-	hypothetical protein	NA	A0A0K2CZJ8	Paenibacillus_phage	86.1	8.6e-74
WP_080675896.1|2639873_2641559_-|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	98.0	1.8e-310
WP_024094640.1|2642601_2642853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094642.1|2643694_2644093_-	helix-turn-helix domain-containing protein	NA	A0A0N7GFF5	Paenibacillus_phage	99.2	7.5e-66
WP_024094643.1|2644082_2644520_-	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	79.3	5.7e-59
WP_158442241.1|2644521_2644689_-	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	75.9	4.3e-15
WP_024093193.1|2644977_2646201_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
WP_024094644.1|2646390_2646783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094646.1|2647113_2647518_-	HicB family protein	NA	A0A0N9RRE8	Paenibacillus_phage	88.9	7.4e-61
WP_158676957.1|2647582_2647720_-	hypothetical protein	NA	A0A0N9SJZ3	Paenibacillus_phage	93.3	6.0e-15
WP_042119109.1|2647904_2648363_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	91.4	7.3e-73
WP_024094649.1|2648352_2648760_-	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	94.1	1.0e-62
WP_024094650.1|2648747_2650046_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX25	Bacillus_phage	44.8	5.4e-97
WP_042119110.1|2650124_2650508_+	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	76.4	8.8e-56
WP_024094651.1|2650464_2651025_-	AAA family ATPase	NA	A0A0N9SJZ0	Paenibacillus_phage	96.7	3.2e-99
WP_024094652.1|2651008_2651869_-	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	78.0	4.6e-121
WP_042119112.1|2651872_2652337_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	99.4	1.8e-87
WP_024094654.1|2652330_2652624_-	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	82.6	5.7e-39
WP_042119113.1|2652624_2652864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094656.1|2652865_2653255_-	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	76.7	4.6e-52
WP_024094657.1|2653268_2653595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094658.1|2653789_2654086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119676.1|2654078_2654363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119118.1|2654387_2654591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094660.1|2654577_2654832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094661.1|2654824_2655178_-	hypothetical protein	NA	A0A0K2CZG5	Paenibacillus_phage	85.7	2.2e-37
WP_024094662.1|2655207_2655666_-	dUTP diphosphatase	NA	D2XR49	Bacillus_phage	53.8	2.9e-37
WP_024094663.1|2655677_2656709_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0E3X9K0	Bacillus_phage	60.3	5.6e-121
WP_080675843.1|2656953_2659272_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	63.8	2.0e-283
WP_024094665.1|2659416_2659725_-	crossover junction endodeoxyribonuclease	NA	A0A0N9ST03	Paenibacillus_phage	85.5	1.1e-29
WP_042119126.1|2659924_2660944_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	87.1	1.3e-146
WP_042119128.1|2660928_2661543_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	89.2	4.8e-96
WP_104932503.1|2661543_2662677_-	hypothetical protein	NA	A0A0N9RTM8	Paenibacillus_phage	78.4	4.8e-174
WP_080675897.1|2662676_2664308_-	DNA polymerase I	NA	A0A0N9S7Z3	Paenibacillus_phage	92.0	8.9e-299
WP_024094670.1|2664472_2665282_-	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	75.8	1.0e-106
WP_024094672.1|2665490_2665904_-	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	97.1	1.7e-73
WP_024094673.1|2666286_2667024_-	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	98.4	8.0e-138
WP_024094674.1|2667109_2667634_-	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	66.7	3.9e-54
WP_024094675.1|2667699_2668263_-	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	88.8	3.0e-76
WP_042119133.1|2668316_2669267_-	hypothetical protein	NA	A0A0N9S7Y2	Paenibacillus_phage	88.6	4.1e-163
WP_024094677.1|2669279_2670656_-	AAA family ATPase	NA	A0A0N9SIP5	Paenibacillus_phage	98.0	3.8e-258
WP_024094679.1|2671430_2671697_-	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	85.2	3.4e-38
WP_024094680.1|2671707_2672235_-	hypothetical protein	NA	A0A0N9SJU7	Paenibacillus_phage	83.4	4.3e-77
WP_024094681.1|2672372_2673206_-	DUF3102 domain-containing protein	NA	A0A0N9RZE9	Paenibacillus_phage	67.9	7.0e-90
WP_042119134.1|2673220_2673589_-	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	89.3	6.3e-59
WP_024094683.1|2673572_2673950_-	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	70.9	1.0e-40
WP_024094684.1|2674007_2674379_-	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	43.1	2.9e-19
WP_024094685.1|2674409_2674658_-	hypothetical protein	NA	A0A0N9RTL0	Paenibacillus_phage	98.8	5.9e-45
WP_024094686.1|2674826_2675153_-	helix-turn-helix domain-containing protein	NA	A0A0N7GFE9	Paenibacillus_phage	98.1	1.2e-53
WP_024094687.1|2675173_2675500_-	hypothetical protein	NA	A0A0N9SGJ1	Paenibacillus_phage	99.1	3.4e-56
WP_024094688.1|2675526_2675829_-	hypothetical protein	NA	A0A0N9S7X2	Paenibacillus_phage	86.0	3.7e-41
WP_024094692.1|2676843_2677077_-	helix-turn-helix transcriptional regulator	NA	A0A0N9SHK5	Paenibacillus_phage	91.5	8.6e-22
WP_024094693.1|2677250_2677886_+	helix-turn-helix domain-containing protein	NA	A0A0N9RTK0	Paenibacillus_phage	85.9	1.2e-78
WP_024094694.1|2677898_2679077_+|integrase	site-specific integrase	integrase	A0A0N9SGH8	Paenibacillus_phage	97.4	1.1e-216
WP_024094695.1|2679198_2680161_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_023483236.1|2683465_2684689_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094699.1|2684998_2686519_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_042119138.1|2686625_2686961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094700.1|2686983_2687574_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_042119140.1|2687570_2688125_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_024094702.1|2688252_2688684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094703.1|2688683_2688962_+	DUF2653 family protein	NA	NA	NA	NA	NA
WP_024094704.1|2689138_2691376_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_024094706.1|2692153_2695279_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024094707.1|2695414_2697001_-	malate synthase A	NA	NA	NA	NA	NA
WP_024094708.1|2697042_2698335_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_023483236.1|2698464_2699688_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483236.1|2699858_2701082_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_158442242.1|2701792_2702221_+	hypothetical protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.7	7.7e-08
WP_024094710.1|2702427_2702811_-	kinase-associated lipoprotein B	NA	NA	NA	NA	NA
WP_023483496.1|2702930_2703269_-	thioredoxin family protein	NA	NA	NA	NA	NA
2702861:2702877	attR	CAGCTTTATTTTTTGCT	NA	NA	NA	NA
WP_023483495.1|2703291_2703825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656763.1|2703907_2705527_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.9	2.4e-54
WP_042119142.1|2705557_2707471_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	6.4e-54
WP_036656764.1|2708864_2709155_-	Dabb family protein	NA	NA	NA	NA	NA
WP_024094713.1|2709180_2710737_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	4.9e-52
WP_042119144.1|2710866_2712618_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_042119145.1|2712630_2713146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483047.1|2713153_2713858_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_024094717.1|2713827_2716041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483045.1|2716091_2717105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654710.1|2717098_2717317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483044.1|2717346_2718018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483043.1|2718220_2719135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482805.1|2719842_2720649_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_144083324.1|2720738_2722607_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_077585026.1|2722744_2724892_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	1.8e-09
WP_042119153.1|2725105_2726407_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.7	1.3e-37
WP_023482801.1|2726462_2727395_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_077585027.1|2727425_2728556_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_036656402.1|2728560_2728857_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_023482799.1|2728853_2729162_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_023482798.1|2729173_2729584_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_036656400.1|2729604_2729868_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_042119697.1|2729965_2732590_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	35.7	5.3e-67
WP_036656396.1|2732942_2734013_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_024094726.1|2734099_2734579_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023482793.1|2734769_2734964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094727.1|2735047_2735563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094728.1|2735622_2736771_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	30.0	2.2e-33
WP_036656394.1|2736787_2737207_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_023482789.1|2737459_2738554_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024094729.1|2738707_2740012_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	47.3	2.2e-98
WP_024094730.1|2740313_2741060_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_042119699.1|2741145_2742930_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2I2L4Y8	Orpheovirus	29.1	6.0e-14
WP_024094732.1|2742947_2744222_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_036656391.1|2744657_2744963_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023483236.1|2745097_2746321_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 24
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2821750	2883399	4023351	tail,transposase,protease,tRNA	Paenibacillus_phage(20.0%)	57	NA	NA
WP_024094783.1|2821750_2823151_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_023484282.1|2823322_2823856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094784.1|2823993_2824395_-	adenosylmethionine decarboxylase	NA	A0A0E3FA82	Synechococcus_phage	36.4	1.2e-18
WP_024094785.1|2824767_2825355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094786.1|2825745_2826360_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024094787.1|2826378_2828712_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.5	4.3e-169
WP_024094788.1|2828861_2830580_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	24.7	4.7e-16
WP_052304436.1|2830795_2831503_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_023484289.1|2831553_2832675_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_023484290.1|2832779_2834039_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	4.5e-149
WP_024094790.1|2834054_2834645_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.6	4.2e-57
WP_023484292.1|2834809_2836111_-	trigger factor	NA	NA	NA	NA	NA
WP_024094791.1|2836289_2837192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484294.1|2837322_2838543_-	CapA family protein	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	33.9	4.8e-55
WP_024094793.1|2838769_2838883_-	DUF4023 family protein	NA	NA	NA	NA	NA
WP_024094794.1|2838937_2840452_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_024094795.1|2840444_2840921_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_024094796.1|2841086_2841440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094797.1|2841728_2843573_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	24.7	5.8e-28
WP_023484299.1|2843640_2844273_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_024094798.1|2844259_2845015_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_023484301.1|2845350_2846382_-	germination protein	NA	NA	NA	NA	NA
WP_024094799.1|2846618_2847134_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.6	1.9e-37
WP_024094800.1|2847245_2848055_+	MFS transporter	NA	NA	NA	NA	NA
WP_023483236.1|2848177_2849401_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094801.1|2849515_2849962_-	lethal factor domain protein	NA	NA	NA	NA	NA
WP_024094802.1|2850188_2850995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094804.1|2851520_2852195_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CYE7	Paenibacillus_phage	94.6	2.0e-127
WP_023483236.1|2852674_2853898_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094806.1|2854140_2855148_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	77.2	1.7e-53
WP_155116279.1|2855459_2855627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094807.1|2855849_2856164_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_023485249.1|2856163_2856505_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_024094809.1|2856572_2857154_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023484956.1|2857402_2858386_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024094810.1|2858395_2859130_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042119717.1|2859632_2860577_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_023483236.1|2861083_2862307_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094813.1|2862994_2863219_-	response regulator transcription factor	NA	A0A290GJH9	Caldibacillus_phage	70.5	3.7e-14
WP_024094814.1|2863359_2864670_-	permease	NA	NA	NA	NA	NA
WP_036654839.1|2864809_2865742_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_024094816.1|2865722_2866424_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_024094817.1|2866838_2867705_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_080675845.1|2867788_2868625_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_158442244.1|2868611_2869433_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_042119724.1|2869632_2870409_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_036654840.1|2870577_2871498_+	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	31.2	7.4e-32
WP_024094820.1|2871579_2872299_-	glycosyltransferase	NA	K7Z8A5	Megavirus	23.6	1.2e-10
WP_024094821.1|2872306_2873212_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A291LAD7	Escherichia_phage	25.7	1.2e-15
WP_024094822.1|2873208_2874039_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024094823.1|2874035_2875022_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.4	1.6e-40
WP_023482886.1|2875011_2876106_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	44.4	1.9e-87
WP_052337448.1|2876102_2877560_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_036654842.1|2878204_2879341_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_023482882.1|2879315_2880506_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_024094825.1|2880502_2881225_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	40.9	5.4e-46
WP_024094826.1|2881479_2883399_-|tail	WIAG-tail domain	tail	NA	NA	NA	NA
>prophage 25
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	2924562	3051107	4023351	tRNA,holin,transposase,protease,coat	Paenibacillus_phage(34.62%)	116	NA	NA
WP_042119189.1|2924562_2926167_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023483304.1|2926250_2928230_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_023483303.1|2928361_2928673_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	45.7	4.8e-20
WP_024094847.1|2928963_2929113_+	YqzM family protein	NA	NA	NA	NA	NA
WP_036656914.1|2929214_2930219_+	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.1	1.1e-09
WP_036656916.1|2930357_2931305_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	33.0	5.4e-38
WP_024094849.1|2931333_2932830_-	helicase DnaB	NA	NA	NA	NA	NA
WP_024094850.1|2933053_2933365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483298.1|2933508_2934255_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_024094851.1|2934314_2934587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483297.1|2934731_2935952_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023483296.1|2936301_2937336_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	44.4	2.0e-22
WP_024094855.1|2937726_2937882_-	sporulation histidine kinase inhibitor Sda	NA	NA	NA	NA	NA
WP_042119192.1|2938301_2938463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096761320.1|2938640_2939114_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_036654865.1|2939147_2939486_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023483294.1|2939509_2940496_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024094859.1|2940765_2941185_+	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	50.0	5.2e-25
WP_023483292.1|2941483_2942134_+	spore cortex-lytic enzyme-like protein	NA	A0A0K2FM09	Brevibacillus_phage	30.9	2.5e-18
WP_024094860.1|2942399_2942762_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	50.0	8.1e-19
WP_036656920.1|2942909_2943089_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_023483290.1|2943587_2944691_+	aminofutalosine synthase MqnE	NA	A9ZMK9	Mamastrovirus	33.3	1.7e-14
WP_024094862.1|2944732_2945797_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024094863.1|2945844_2946093_-	YuzB family protein	NA	NA	NA	NA	NA
WP_023483287.1|2946208_2946457_+	NifU family protein	NA	NA	NA	NA	NA
WP_024094864.1|2946537_2947323_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024094865.1|2947319_2948048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094866.1|2948234_2949995_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_052337481.1|2950009_2950870_-	heme A synthase	NA	NA	NA	NA	NA
WP_036654871.1|2951035_2951218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094868.1|2951254_2951602_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_023483281.1|2951785_2952628_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_024094869.1|2952634_2952832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483280.1|2953149_2954481_+	DUF2515 family protein	NA	NA	NA	NA	NA
WP_023483279.1|2954477_2956172_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_024094870.1|2956355_2957078_-	trehalose utilization protein	NA	NA	NA	NA	NA
WP_023483277.1|2957135_2957618_-	DUF456 family protein	NA	NA	NA	NA	NA
WP_024094871.1|2957689_2958430_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_024094872.1|2958654_2960529_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	30.2	2.4e-37
WP_023483236.1|2962380_2963604_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_144083327.1|2963685_2964777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483273.1|2964758_2965229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158676958.1|2965672_2966305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932516.1|2967883_2968928_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_080675847.1|2968894_2970832_+	cellulose synthase	NA	NA	NA	NA	NA
WP_024094875.1|2971919_2972600_-	LrgB family protein	NA	NA	NA	NA	NA
WP_023483267.1|2972596_2972968_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_036654876.1|2973090_2973984_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052337451.1|2974359_2974917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094877.1|2975027_2976176_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_158442247.1|2976203_2976377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155116295.1|2976466_2976619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483263.1|2976737_2977880_+	MFS transporter	NA	NA	NA	NA	NA
WP_024094879.1|2978083_2978452_+	ribonuclease-like protein	NA	NA	NA	NA	NA
WP_104932485.1|2978462_2979814_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	62.3	5.3e-95
WP_023483261.1|2979876_2980518_-	SCO family protein	NA	NA	NA	NA	NA
WP_042119742.1|2980608_2981535_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_024094881.1|2981779_2983792_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	3.2e-11
WP_023483257.1|2984400_2984880_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_042119199.1|2984918_2985197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654885.1|2985284_2986268_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_023483255.1|2986404_2986629_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
WP_042119744.1|2986755_2986941_+	DUF5325 family protein	NA	NA	NA	NA	NA
WP_036654887.1|2987133_2988120_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024094882.1|2988498_2989962_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_036654889.1|2990129_2990768_-	ribonuclease H	NA	NA	NA	NA	NA
WP_024094883.1|2991591_2992815_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.3	5.8e-226
WP_042119203.1|2993065_2994871_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_077584864.1|2995093_2995294_+	YycC family protein	NA	NA	NA	NA	NA
WP_036658295.1|2995295_2995532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094886.1|2995659_2996361_-	DUF2225 domain-containing protein	NA	NA	NA	NA	NA
WP_024094887.1|2996388_2996772_-	globin	NA	NA	NA	NA	NA
WP_036658570.1|2997089_2998334_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_023483243.1|2998477_2999284_+	NAD kinase	NA	NA	NA	NA	NA
WP_077995951.1|3000960_3001380_-	YutD family protein	NA	NA	NA	NA	NA
WP_024094891.1|3001417_3002311_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_042119748.1|3002499_3003576_+	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	37.0	5.1e-08
WP_042119206.1|3003630_3004449_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_036658287.1|3004562_3004838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094895.1|3005099_3006005_-	ROK family protein	NA	NA	NA	NA	NA
WP_023483236.1|3006388_3007612_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_104932505.1|3007979_3008849_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
WP_024094897.1|3008869_3009553_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	98.2	1.8e-120
WP_042119208.1|3009641_3010580_-	cysteine synthase A	NA	C3U2M1	Lactococcus_phage	55.7	1.7e-84
WP_023484306.1|3010603_3011422_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_042119209.1|3011424_3012084_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_036658554.1|3012246_3012450_+	small acid-soluble spore protein SspI	NA	NA	NA	NA	NA
WP_023484309.1|3012710_3013472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094900.1|3013468_3014596_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024094901.1|3014787_3016374_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	34.3	1.0e-12
WP_024094902.1|3016491_3017337_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_036658279.1|3017336_3017525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119212.1|3017648_3019601_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036658274.1|3019575_3020358_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	5.3e-31
WP_024094904.1|3020539_3022057_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042119215.1|3022172_3023135_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_024094906.1|3023152_3024082_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_036658268.1|3024418_3025981_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_104932506.1|3025973_3027065_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_023483236.1|3027165_3028389_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_104932507.1|3028503_3029232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119219.1|3029554_3032692_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_042119752.1|3032788_3034069_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_024094911.1|3034200_3036927_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_023484324.1|3037103_3038174_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_023484325.1|3038217_3038916_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024094912.1|3039030_3040566_-	glucose-6-phosphate dehydrogenase	NA	C7BV85	Synechococcus_phage	37.5	2.8e-84
WP_023484327.1|3040719_3041034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484328.1|3041332_3041830_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036658253.1|3042371_3043016_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024094916.1|3043008_3044070_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_023484332.1|3044088_3044754_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_024094917.1|3045599_3046604_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_023483236.1|3047434_3048658_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042119222.1|3048874_3049258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3049883_3051107_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 26
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3065707	3117531	4023351	integrase,transposase,protease,tRNA	Paenibacillus_phage(72.73%)	52	3051782:3051795	3111385:3111398
3051782:3051795	attL	GTTGAGCAGATGTT	NA	NA	NA	NA
WP_024094927.1|3065707_3067156_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_024094928.1|3067174_3068632_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_023484446.1|3068665_3068953_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_023484445.1|3069168_3070233_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_023484444.1|3070327_3070708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077584857.1|3070875_3071310_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_024094929.1|3071358_3071982_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	40.9	1.5e-28
WP_023484441.1|3072005_3072572_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_036658236.1|3072687_3073293_-	DedA family protein	NA	NA	NA	NA	NA
WP_024094930.1|3073486_3073939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094931.1|3074016_3074328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094932.1|3074675_3075254_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042119228.1|3075391_3075748_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024092920.1|3075768_3076992_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
WP_158442249.1|3077073_3078543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094933.1|3078542_3079094_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077584856.1|3079162_3079276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484435.1|3079343_3080156_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_077585224.1|3080192_3080870_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_023484433.1|3081222_3081768_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.4	7.0e-22
WP_024094935.1|3082201_3082906_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023483236.1|3083134_3084358_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_144083329.1|3085239_3088086_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_158676959.1|3088165_3089434_+	lantibiotic biosynthesis protein	NA	NA	NA	NA	NA
WP_023484429.1|3089722_3091039_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_144083330.1|3091326_3092256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094943.1|3092651_3094679_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_024094944.1|3094718_3094991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094945.1|3095769_3096567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094946.1|3096784_3098242_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_024094947.1|3098427_3099513_-	micrococcal nuclease	NA	NA	NA	NA	NA
WP_052337483.1|3100123_3100876_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024094949.1|3100972_3102166_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_042119236.1|3102191_3103751_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_024094951.1|3104516_3104765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658206.1|3104771_3105035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094953.1|3105218_3106160_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_104932485.1|3106242_3107594_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	62.3	5.3e-95
WP_155116280.1|3107656_3107800_-	hypothetical protein	NA	A0A0K2CYN9	Paenibacillus_phage	93.9	3.7e-07
WP_023483236.1|3108135_3109359_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094955.1|3109391_3109709_+|integrase	phage integrase-like protein	integrase	A0A0K2CZ62	Paenibacillus_phage	71.1	2.5e-32
WP_144083331.1|3109692_3109896_+	hypothetical protein	NA	A0A0K2CZ62	Paenibacillus_phage	76.1	3.8e-26
WP_024094956.1|3109987_3110143_+|integrase	phage integrase family protein	integrase	A0A0K2CZ62	Paenibacillus_phage	88.2	4.5e-19
WP_023483158.1|3110373_3111108_-	oxo-acid lyase	NA	NA	NA	NA	NA
WP_023483159.1|3111111_3112218_-	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
3111385:3111398	attR	GTTGAGCAGATGTT	NA	NA	NA	NA
WP_024094957.1|3112259_3112925_-	DUF4310 family protein	NA	NA	NA	NA	NA
WP_024094958.1|3112927_3113713_-	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_024094959.1|3113733_3114072_-	DUF4312 family protein	NA	NA	NA	NA	NA
WP_023483163.1|3114075_3114432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094960.1|3114471_3114834_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_042119241.1|3115947_3116241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094962.1|3116307_3117531_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
>prophage 27
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3122093	3190641	4023351	transposase,integrase	Paenibacillus_phage(26.67%)	55	3121974:3122033	3144719:3146107
3121974:3122033	attL	AGTTGAGTCCGTATAATTGTGTAAAAAGCTAGGTTCCAAAAAATGAAAGGAGCCATATTC	NA	NA	NA	NA
WP_023483236.1|3122093_3123317_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094967.1|3123789_3124779_+	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	40.3	8.4e-50
WP_023483173.1|3124808_3126242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094968.1|3126542_3126974_+	oxidoreductase-like protein	NA	NA	NA	NA	NA
WP_023483175.1|3127070_3127583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119245.1|3127929_3128925_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_023483177.1|3129110_3130034_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024094971.1|3130257_3131826_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023483179.1|3131852_3132767_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	45.5	1.8e-70
WP_052337454.1|3133252_3135463_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	25.8	1.6e-11
WP_024094974.1|3135688_3136609_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_023483183.1|3136808_3137372_+	signal peptidase I	NA	NA	NA	NA	NA
WP_144083332.1|3137412_3138042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144083333.1|3138305_3138671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483185.1|3139519_3140473_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097BYJ7	Leuconostoc_phage	26.3	1.2e-05
WP_024094978.1|3140746_3141451_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_024094979.1|3142351_3143338_-	MFS transporter	NA	NA	NA	NA	NA
WP_023483236.1|3143434_3144658_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_051428076.1|3145278_3146265_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	25.1	3.7e-05
3144719:3146107	attR	GAATATGGCTCCTTTCATTTTTTGGAACCTAGCTTTTTACACAATTATACGGACTCAACTGTAAGTACAATATCAATGTATATACTTTTTGCATAATTATTAATATATAACTATATTTACAACTATACCTATAGAATGCCTTCTTTGAGACAATTCCTTTTGAAAGAGTACATAGATCAACATCAAAAAATTCTTCAATCTTTCCTATTGGACTGCATTTTCTTTGCTGAGGGTTTTCTTTCAGGATCATTCATTGGCAAGAGTCACTACATCGTCCAATCGCTATCCCGAGTTCTACAAAGTACCCGTACGGATATCGTACATCTGATCGGCACTTTATTAAAACTGCCATAATGATTGACAAACACGAAAGCTTCTATAGTTTCGATATTCATTTTATCCTCACTCTTCCTATATACTAACTTTGTTTTATAGAAACCCCTTTTCAGGAAAGTTAAGCTGTCTGTCAATGATCTGGGAATAATAAAAAAATGTATATCAAGCAGCCCAGAAGAAAGCCGTTCTTTCTTAATTGAAAGATTTGGCCTTATTCTGCAGTCTTAGGGATAAATATGAAAATGATAAGTGCCACGGAGTGCTTCCAGTTCCTGCAGCCGTGCATGTACATCAGAACGAATGTCACTGACCGCTAAATTTCCAACCAGAGGCTGTTTATCGTATATTTTACGAATTTCAGTACGGATGGAACCCGGAGTATCAGGATCACATTCAACAATACGGTGCGGCTCCCACAGCAGTACTTGAACCAGCTTCCGTACCGCTGCAGATTCCGCGGATTCAAGCTTCACAAGCAATTCATGGTCCGCCATGCCCGCTATCTTCTCCCCCAGTTCCGGGCGCTGCACACTATACAAGTGCACCGCCTCAGATAAGACAGCATTAACGCCCAAAAAATAGGGATTCAAAAATAACAGGTTCTCATTCAGCACAGCATCCATTATATGGATAGCAATCTCTTCGTCTGCTTCTATATAAGGACCTTTAAAACGAAGACGTGAGATTAGCTCCGAAGGGTGAATGTTAGAAAAGCCGGCGGCTTGTGTATCACGTAAAAAGCTGTCCAAGTGATCTAACCCAAGTTTGTTGGATGCGTTCGTAAGAGGCGTATACTCATTCAGCAGATGTACAATTTTATACGGAGATAATCCATATTTTTTCAAAACCAGCGCAACTTGAGGGGAAAGAATGGCCTGTTCCGTATTTTGATGATGATCGTACCCCAATGCCCTCTCTACGGCATGCGAAAAGGGAAGATGGCCTATGTCGTGCAAGATTGCCGCGACATGAAGTTCCCTCCATTCCGGAAAGAATGTTTTGGCCAAAACCCAAACTCCAATCGTATGTTCCAAACGGGAATGAATTAGAGGG	NA	NA	NA	NA
WP_024094980.1|3146307_3148551_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_077584824.1|3149690_3150686_-	allantoin permease	NA	NA	NA	NA	NA
WP_023483197.1|3150794_3151190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657987.1|3151717_3152380_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3T7R5	Bacillus_phage	51.9	1.3e-51
WP_023483199.1|3152550_3152982_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_023483200.1|3153544_3154285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483201.1|3154346_3154985_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_036657986.1|3155028_3155643_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.5	2.8e-59
WP_024094986.1|3155973_3157197_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
WP_023483205.1|3158904_3159789_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042119773.1|3160364_3162971_-	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	A0A0K2CP92	Brevibacillus_phage	46.3	3.1e-168
WP_024094992.1|3163419_3164268_+	D-amino-acid transaminase	NA	NA	NA	NA	NA
WP_036658443.1|3164384_3165227_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_023483209.1|3165400_3167200_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	29.3	2.1e-59
WP_023483210.1|3167196_3168216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119250.1|3168337_3169351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094994.1|3169400_3169652_-	YqzE family protein	NA	NA	NA	NA	NA
WP_104932485.1|3169813_3171164_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	62.3	5.3e-95
WP_024094995.1|3171253_3171892_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_023483213.1|3172091_3172616_-	DUF1572 family protein	NA	NA	NA	NA	NA
WP_079940317.1|3173058_3173745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483215.1|3174419_3175739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483216.1|3176166_3176871_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_023483218.1|3177799_3178612_-	ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	28.4	4.8e-11
WP_023483219.1|3178629_3179307_-	energy-coupling factor ABC transporter transmembrane protein	NA	NA	NA	NA	NA
WP_024095000.1|3179293_3179587_-	energy-coupling factor ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024095001.1|3180341_3181040_-	cobalt-factor II C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_023483222.1|3181032_3181821_-	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
WP_024095002.1|3182449_3183184_-	precorrin-6A reductase	NA	NA	NA	NA	NA
WP_023483224.1|3183180_3183906_-	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_042119252.1|3183902_3184979_-	cobalt-precorrin 5A hydrolase	NA	NA	NA	NA	NA
WP_023483226.1|3184965_3185715_-	cobalt-precorrin-4 methyltransferase	NA	NA	NA	NA	NA
WP_024095004.1|3185711_3186287_-	decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
WP_024095005.1|3186276_3186882_-	cobalt-precorrin-7 (C(5))-methyltransferase	NA	NA	NA	NA	NA
WP_042119255.1|3186878_3188000_-	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_024093995.1|3189417_3190641_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
>prophage 28
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3199545	3211652	4023351	transposase,integrase	Paenibacillus_phage(50.0%)	14	3190918:3190933	3214696:3214711
3190918:3190933	attL	TTCAATATTTCCTATG	NA	NA	NA	NA
WP_024095016.1|3199545_3200601_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	30.9	2.2e-16
WP_024095017.1|3200605_3201001_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	62.8	7.0e-40
WP_024095018.1|3202020_3202206_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	54.3	2.4e-06
WP_144083335.1|3202463_3202607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095019.1|3202509_3203178_-	adenosylcobinamide amidohydrolase	NA	NA	NA	NA	NA
WP_024095020.1|3203249_3203483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655087.1|3203875_3204184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655089.1|3204310_3204637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3204871_3206095_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024095023.1|3206465_3207887_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_024095024.1|3207960_3208848_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_104932516.1|3209036_3210082_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_080675854.1|3210168_3210288_-	DUF871 family protein	NA	NA	NA	NA	NA
WP_024093995.1|3210428_3211652_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
3214696:3214711	attR	TTCAATATTTCCTATG	NA	NA	NA	NA
>prophage 29
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3251490	3295765	4023351	transposase,tRNA	Paenibacillus_phage(44.44%)	33	NA	NA
WP_077584833.1|3251490_3253476_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.9	6.3e-97
WP_042119788.1|3253829_3254078_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.1	5.6e-19
WP_024095054.1|3254077_3254494_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_024095055.1|3254732_3256262_+	spore germination protein	NA	NA	NA	NA	NA
WP_024095056.1|3256258_3257359_+	endospore germination permease	NA	NA	NA	NA	NA
WP_024095057.1|3257355_3258486_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_023482903.1|3258605_3259451_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_024095058.1|3259641_3260631_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_042119262.1|3260805_3262245_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_052337456.1|3263403_3264558_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_024095061.1|3264673_3265537_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080675899.1|3265649_3266927_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_042119266.1|3266982_3268395_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_023483236.1|3268634_3269858_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023482910.1|3270083_3270521_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_036658022.1|3272929_3273670_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024095066.1|3273980_3275363_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	29.5	1.9e-47
WP_024095068.1|3275858_3276737_-	ROK family protein	NA	NA	NA	NA	NA
WP_023482915.1|3276776_3277766_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024095069.1|3278050_3280174_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_023483236.1|3282059_3283283_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_104932485.1|3284000_3285352_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	62.3	5.3e-95
WP_023484418.1|3285540_3286155_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_036658526.1|3286377_3287568_-	MFS transporter	NA	NA	NA	NA	NA
WP_023484416.1|3287603_3288293_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024095074.1|3289248_3289677_+	pyruvate formate-lyase-activating enzyme	NA	NA	NA	NA	NA
WP_024095075.1|3289671_3290436_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023483236.1|3290687_3291911_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042119269.1|3292343_3292862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3292926_3294150_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024095078.1|3294142_3294796_-	nucleoid-associated protein	NA	A0A090D855	Clostridium_phage	29.5	2.6e-07
WP_024095079.1|3294905_3295163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585076.1|3295627_3295765_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3337760	3395918	4023351	transposase,coat	Paenibacillus_phage(50.0%)	48	NA	NA
WP_024092852.1|3337760_3338984_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
WP_024095122.1|3340232_3341090_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_023483410.1|3341086_3341926_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_024095124.1|3342259_3343150_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023483412.1|3343865_3344948_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_024095126.1|3345087_3346014_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024095127.1|3346079_3346793_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	1.1e-38
WP_042119284.1|3346900_3348700_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	36.6	1.1e-39
WP_042119801.1|3348986_3350333_+	N-acyl-D-glucosamine 2-epimerase	NA	NA	NA	NA	NA
WP_024095130.1|3350601_3352143_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_023483418.1|3352323_3353475_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_023483419.1|3353779_3354721_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_023483420.1|3354746_3356045_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	75.9	4.0e-15
WP_024095131.1|3356151_3357264_-	citrate synthase	NA	NA	NA	NA	NA
WP_024095132.1|3357684_3358131_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_042119286.1|3358307_3360062_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_042119288.1|3360054_3361029_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_024095135.1|3361018_3361885_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_024095136.1|3361979_3362171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095137.1|3362523_3366180_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.9	7.6e-213
WP_023483236.1|3366904_3368128_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024095139.1|3368653_3368986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483429.1|3368982_3369561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095140.1|3370009_3371152_-	hypothetical protein	NA	A0A1W6DXV0	Rhodococcus_phage	40.2	6.2e-12
WP_023483236.1|3372034_3373258_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_158225759.1|3373377_3373524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144083340.1|3373946_3374339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095141.1|3374647_3375190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095143.1|3375433_3376657_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	5.2e-227
WP_024095144.1|3376900_3377875_-	isoprenyl transferase-like protein	NA	NA	NA	NA	NA
WP_023485469.1|3377896_3378526_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024095145.1|3378522_3380844_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_024095146.1|3380942_3381125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095147.1|3381344_3381497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485471.1|3381673_3381979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119292.1|3381962_3383300_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036655248.1|3383454_3383733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095151.1|3383860_3384103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119294.1|3384309_3384765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119296.1|3384783_3386121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093995.1|3386259_3387483_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
WP_023483995.1|3387689_3388049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095152.1|3388097_3389264_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_024095153.1|3389393_3390767_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_158442252.1|3391123_3391975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095154.1|3391987_3393358_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_023483990.1|3393357_3394476_+	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_023483989.1|3394481_3395918_+|coat	spore coat associated-like protein	coat	NA	NA	NA	NA
>prophage 31
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3399007	3455638	4023351	transposase,tRNA	Bacillus_phage(30.0%)	47	NA	NA
WP_023483236.1|3399007_3400231_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_104932485.1|3400607_3401958_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	62.3	5.3e-95
WP_024095157.1|3402356_3402863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095159.1|3403862_3405962_+	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	35.9	3.4e-32
WP_158442253.1|3406229_3406397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095161.1|3406545_3408099_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_024095162.1|3408320_3408575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484406.1|3408867_3409407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096761292.1|3409707_3409893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095166.1|3410507_3411941_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_023485369.1|3411937_3413089_-	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	40.7	5.6e-21
WP_024095167.1|3413690_3414350_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	24.0	8.5e-06
WP_024092945.1|3414725_3415949_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.1e-227
WP_024095169.1|3416275_3416794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095170.1|3416813_3417149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3417237_3418461_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_077996791.1|3418590_3418791_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	44.7	3.7e-05
WP_024095173.1|3419386_3421303_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.6	1.3e-126
WP_024095174.1|3421638_3421836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095175.1|3424945_3426841_-	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.1	1.3e-102
WP_042119303.1|3427092_3427833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657535.1|3427887_3428805_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024095177.1|3428910_3429576_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042119812.1|3429572_3430400_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023483236.1|3430572_3431796_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483796.1|3432043_3432988_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042119305.1|3433361_3433619_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	43.0	6.2e-13
WP_024095180.1|3433824_3434289_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_042119307.1|3434460_3435549_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	4.5e-89
WP_042119309.1|3435722_3436331_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_096761276.1|3436546_3436885_+	hypothetical protein	NA	G3MA03	Bacillus_virus	52.2	9.0e-20
WP_024095183.1|3436930_3437197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119311.1|3437296_3438721_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_024095185.1|3439133_3439811_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_024095186.1|3439893_3441198_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	57.4	3.1e-137
WP_042119313.1|3441241_3442426_-	pyrimidine nucleoside transporter NupC	NA	NA	NA	NA	NA
WP_042119315.1|3442887_3443844_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_036657530.1|3444166_3445120_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_024095190.1|3445189_3446695_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.5	1.4e-24
WP_023483783.1|3446695_3447385_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.5	2.3e-38
WP_036656051.1|3447545_3449054_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	25.1	1.1e-21
WP_024095191.1|3449319_3449982_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_052337485.1|3449994_3451017_-	HAMP domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_042119317.1|3451032_3452067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158442254.1|3452365_3452710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149867819.1|3452862_3453513_-	hypothetical protein	NA	L0LBX4	Bacillus_phage	35.9	6.4e-14
WP_023483777.1|3453688_3455638_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.2	3.9e-123
>prophage 32
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3477407	3524033	4023351	transposase,protease,tRNA,holin	Paenibacillus_phage(25.0%)	41	NA	NA
WP_023483236.1|3477407_3478631_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024095211.1|3478841_3482000_-	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_051427989.1|3482001_3482913_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_042119326.1|3483087_3484260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483755.1|3484259_3485399_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_023483754.1|3485551_3486598_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036656029.1|3486613_3486982_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	43.5	1.7e-19
WP_023483752.1|3487043_3487976_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042119329.1|3487972_3488542_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_024095216.1|3488557_3490174_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_042119331.1|3491301_3492105_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_104932510.1|3493084_3493660_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_042119334.1|3493792_3494839_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_036656025.1|3494896_3495694_-	heme ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.3e-16
WP_023483743.1|3495686_3496727_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_024095220.1|3496749_3497745_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024095221.1|3498236_3498542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095222.1|3498936_3499200_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_042119337.1|3499284_3500490_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X6WGT4	Pacmanvirus	24.4	1.8e-06
WP_023483739.1|3500505_3500997_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024095225.1|3501260_3501542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095227.1|3501769_3503101_-	MFS transporter	NA	NA	NA	NA	NA
WP_158442255.1|3503127_3504198_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024095229.1|3504346_3504841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483734.1|3504973_3505393_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_036656018.1|3505492_3506164_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_104932511.1|3506276_3508640_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	37.9	1.8e-13
WP_023483731.1|3508963_3509332_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_036656016.1|3509573_3509936_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_023483729.1|3510016_3510556_-	CvpA family protein	NA	NA	NA	NA	NA
WP_024095232.1|3510561_3513462_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_024095233.1|3513568_3516019_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_042119342.1|3516042_3517071_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.9	1.7e-29
WP_023483724.1|3518171_3518687_-	signal peptidase I	NA	NA	NA	NA	NA
WP_024095236.1|3518854_3519778_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_024095237.1|3519884_3520181_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144083344.1|3521036_3521225_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024095239.1|3521125_3521689_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	2.6e-24
WP_036656001.1|3521903_3522221_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158225718.1|3522379_3522520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3522809_3524033_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 33
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3532477	3585272	4023351	bacteriocin,transposase,integrase	Paenibacillus_phage(35.71%)	50	3532434:3532493	3549697:3551087
3532434:3532493	attL	GATCAAGTCCAAATTTGTGTGTAAATTCCCTCAGCTAGACTGTGCTACATAATGCGAGTC	NA	NA	NA	NA
WP_023483236.1|3532477_3533701_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_077585289.1|3534175_3534442_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_144083343.1|3534520_3534811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095249.1|3534831_3535611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3535871_3537095_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024095250.1|3537605_3537986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095251.1|3538129_3539035_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	57.0	6.2e-92
WP_104932516.1|3540829_3541875_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_024095239.1|3542250_3542814_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	2.6e-24
WP_083040599.1|3543360_3543543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655999.1|3543707_3544889_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_023484907.1|3545004_3545658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655998.1|3545932_3546640_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_024095255.1|3546711_3546876_-	rubredoxin	NA	NA	NA	NA	NA
WP_023483236.1|3548488_3549712_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024095256.1|3550180_3550882_+	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_080675859.1|3551282_3551453_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
3549697:3551087	attR	GACTCGCATTATGTAGCACAGTCTAGCTGAGGGAATTTACACACAAATTTGGACTTGATCGAAGGGAACCTCGCGGCAATCAATCTTTCCTACCCAGTAAATATCTTTGGACAACTTAATTTCAGTTTGCACTGGAATAACCTCCTGCTGATCATTTTAACGGCACCCTAATTCTACGCCTACTTGCTGGAAAAAAAGAGGATTCAAATCAAATTTTACGAAATAACAAAATGGTTCCTTAGCGGAGTGAGATCTGATCCGAAAAATAACCTTCTCAAGTTCAAGAATATCAGAAGAACAAATTCACTAAACGTATTATCAGGAAGAACAGGAGCAATAAATCCGAGATTTACCAAGGTTTGGCGAAACAAACGAAGTCACAAGCGAAAAACTGTAATAGTTTGATTTGCATTGATCCTAATCATTACCAAGAATACCGTATTATAATAGCCTTGTACTTGAATTAAATAAAGGAGGACCTATAATGACCTTTACTGCTCAAAGCAAAATCCGAGACATTGTCATACAGTTTCCCAAAGCAAGTGATTATTTTAAAACCCATAAAATTGACTTTTGCTGTGGAGGAAACAAGCCTTTGGAGGAAGTAGCAAAACAGCATGGATTGGATGTTAATGACCTTCTACGTGATATCCAGCACCTTCAGATGAAGAACGTTGAAAATCGGTCCGGTACGCCTGATCCTGCACATCTGTCTTCTACTGACCTTATTGATTTAATTGTGGACAAACACCACGCTTACTTGCGCGAGGAGCTTCCCCAGTTAGATACTTATGTAACCAAGGTGTTTCATGTTCACGGAGAAAATCATGTTCATCTGCAGGAAGTTTTCCGTTTATTTCGTGCTTTACGAACCGAACTGGAGCAGCATACCCTTAAGGAGGAGACTATTTCTTTTCCACAGATTCAAGCCTACGAAAATAAACCGTCGGAAGAAAGTAGAAACCTGCTTGCTGACACGATCAGGGAACTGGAGAAAGAGCATGATGAAGCGGGCCACTTGCTTAAAGAAATCCGCCGCGTAACTTCCGACTTTACATTACCTGAAGGCGCCTGCACCACTTACCAGATCACTTACCACCGTCTAGAGGAATTGGAATCTATGACTTTTGAGCATGTGCATTTAGAGAATAATATTCTTTTTCCACGGTATACTGAGTATCGGTGAATTCGATGAGACAAATACAAAGGAAAGCCCACCGGAGAACGGTGACTGTGACCTGCAAGAATGTCACTTTAAAAAGTGGCTGTCCTAAAAGTTATTGAAGTACCCCCGTCAAGTAGACAGAAATAAAATAACATCTATTATAAAGCCTTAGTTCGAACTTTCACCCGGATTAAGGCTGGTTTAACTTGTTTGCAGTATGGATATT	NA	NA	NA	NA
WP_023483236.1|3551485_3552709_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024095257.1|3553184_3553664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484901.1|3554053_3554410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095258.1|3554803_3556492_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_023484899.1|3556664_3556949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095259.1|3557672_3557915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119831.1|3558204_3559011_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_023484897.1|3559007_3559685_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036657482.1|3559774_3560398_+	YcnI family protein	NA	NA	NA	NA	NA
WP_024095262.1|3560454_3562881_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.0	8.2e-115
WP_023484894.1|3562975_3563176_-	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	40.0	6.3e-05
WP_144029658.1|3563196_3563481_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_023484892.1|3563573_3564059_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	1.1e-31
WP_023484891.1|3564113_3565070_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	63.7	6.7e-121
WP_077585182.1|3565099_3565384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484889.1|3565683_3566118_-	universal stress protein	NA	NA	NA	NA	NA
WP_024095265.1|3566339_3566729_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_024095266.1|3567343_3568450_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_024095267.1|3568490_3569846_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.4	1.4e-55
WP_024095268.1|3569842_3571309_+	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	39.4	6.8e-80
WP_052337463.1|3571669_3572209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095270.1|3572350_3573745_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_024095271.1|3573957_3575070_-	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_024095272.1|3575062_3575881_-	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_144029657.1|3576100_3577060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095273.1|3577314_3577740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095274.1|3577849_3579073_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.4e-227
WP_024095275.1|3579323_3579524_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_042119350.1|3579570_3581541_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_036657474.1|3581578_3581971_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_024095277.1|3582118_3582664_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_024095278.1|3582888_3583977_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_023484873.1|3584936_3585272_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
>prophage 34
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3598514	3656071	4023351	transposase,tRNA	Paenibacillus_phage(37.5%)	60	NA	NA
WP_024095290.1|3598514_3599240_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_036655973.1|3599437_3599917_-	WGxxGxxG-CTERM domain-containing protein	NA	NA	NA	NA	NA
WP_024095291.1|3600093_3601044_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	62.8	9.9e-48
WP_023484857.1|3601059_3601650_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	41.4	5.4e-36
WP_023484856.1|3601695_3602661_+	class I mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_024095292.1|3603194_3603422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144083345.1|3604008_3604203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3604223_3605447_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023484854.1|3607353_3607986_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_024095294.1|3608841_3610074_+	aminopeptidase	NA	NA	NA	NA	NA
WP_023484852.1|3610175_3611111_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_024095295.1|3611177_3611744_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_023484850.1|3611949_3612702_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_023484849.1|3612821_3613607_-	DUF4240 domain-containing protein	NA	NA	NA	NA	NA
WP_024095297.1|3614065_3614278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095298.1|3614496_3614739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3614882_3616106_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_077585287.1|3616384_3616783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119352.1|3616933_3617713_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_036655967.1|3618565_3619087_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024095303.1|3619465_3619810_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_077585286.1|3619991_3620735_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	4.3e-14
WP_042119837.1|3620766_3621759_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_023484841.1|3621827_3622817_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023483236.1|3622988_3624212_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023484840.1|3624585_3626529_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_024095307.1|3626515_3627286_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	9.5e-33
WP_023484838.1|3627537_3628128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144029656.1|3628418_3628643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095308.1|3628676_3628997_+	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_023484837.1|3629060_3629507_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_023484836.1|3629508_3630048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095310.1|3630127_3630352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484834.1|3630894_3631194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484833.1|3631817_3632573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119354.1|3632588_3633296_+	AAA family ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	2.0e-08
WP_024095313.1|3633406_3633697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655952.1|3633797_3634028_-	DUF1128 domain-containing protein	NA	NA	NA	NA	NA
WP_023484830.1|3634099_3634738_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	44.0	1.7e-35
WP_024095314.1|3634930_3636283_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_036655949.1|3636275_3636467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095315.1|3636606_3637521_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023484827.1|3637584_3639609_-	transketolase	NA	A0A2K9L6P9	Tupanvirus	23.6	1.2e-15
WP_077585284.1|3639732_3640566_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_023484825.1|3640667_3641813_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.1	2.0e-26
WP_104932528.1|3642035_3642446_+	DUF2621 domain-containing protein	NA	NA	NA	NA	NA
WP_024095317.1|3642718_3642931_-	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
WP_023484823.1|3642942_3643833_-	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	46.4	5.8e-58
WP_023484822.1|3644101_3644452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095318.1|3644553_3646071_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_024095319.1|3646149_3646323_+	putative motility protein	NA	NA	NA	NA	NA
WP_024092920.1|3646797_3648021_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.8e-227
WP_036657447.1|3648171_3648855_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	3.5e-39
WP_036655944.1|3650747_3651578_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_077585177.1|3651694_3651787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080675860.1|3652193_3652334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095323.1|3652482_3652908_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	62.6	1.1e-38
WP_144083347.1|3653119_3653374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095326.1|3653812_3654343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3654847_3656071_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 35
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3662763	3728861	4023351	transposase,tRNA	Paenibacillus_phage(53.33%)	52	NA	NA
WP_077585283.1|3662763_3662961_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051427985.1|3663635_3664118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484400.1|3664216_3664645_-	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	54.8	8.4e-23
WP_023483236.1|3665221_3666445_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_052337466.1|3667116_3668256_-	MFS transporter	NA	NA	NA	NA	NA
WP_023484396.1|3668498_3668924_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042119357.1|3669096_3669462_-	YjdF family protein	NA	NA	NA	NA	NA
WP_024095336.1|3669812_3670148_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080675861.1|3670245_3670779_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_024092852.1|3670883_3672107_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.5	1.5e-226
WP_036655922.1|3673150_3673549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095338.1|3673561_3675523_-	toxin-like protein	NA	A0A2I7SCU7	Paenibacillus_phage	80.5	8.8e-192
WP_042119358.1|3677008_3677656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3677688_3678912_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042119360.1|3679635_3679848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095342.1|3680350_3682678_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_144083348.1|3682738_3683458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095345.1|3684009_3684870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3685004_3686228_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_144083349.1|3686526_3686760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095347.1|3686870_3687611_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_024095348.1|3687617_3687914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3687946_3689170_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024095349.1|3689274_3690087_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_077585122.1|3690641_3690857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051427952.1|3690850_3691537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095352.1|3691503_3691866_-	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	34.6	1.7e-08
WP_024095353.1|3692131_3693958_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	41.4	1.2e-115
WP_023483236.1|3694701_3695925_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042119364.1|3696308_3697649_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_077997570.1|3697673_3698858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482933.1|3698898_3699714_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_024095356.1|3699888_3700494_-	anti-sigma-W factor RsiW	NA	NA	NA	NA	NA
WP_023482935.1|3700563_3701142_-	RNA polymerase sigma factor SigW	NA	A0A0F6TH34	Sinorhizobium_phage	23.7	1.7e-05
WP_024095357.1|3701369_3704153_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_023483236.1|3705146_3706370_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483469.1|3706521_3706842_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_024095358.1|3706842_3707463_-	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_023483471.1|3707473_3709411_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_024095359.1|3709429_3710404_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_024095360.1|3717715_3717934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655466.1|3718033_3718645_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_024095361.1|3718761_3719553_+	polysaccharide deacetylase family sporulation protein PdaB	NA	NA	NA	NA	NA
WP_024095362.1|3719832_3720627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095363.1|3720694_3721756_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_042119366.1|3721808_3722564_-	N-acetylmuramoyl-L-alanine amidase CwlD	NA	M4ZRP4	Bacillus_phage	31.3	1.0e-10
WP_042119367.1|3722656_3723835_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	31.5	1.1e-37
WP_024095366.1|3723853_3724555_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_024095367.1|3725274_3726444_-	gamma-D-glutamate-meso-diaminopimelate muropeptidase-like protein	NA	A0A1W6DXV0	Rhodococcus_phage	45.1	8.8e-14
WP_023482142.1|3727089_3727482_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_024095368.1|3727502_3727940_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_023482144.1|3728102_3728861_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 36
NZ_CP019652	Paenibacillus larvae subsp. larvae DSM 25430 chromosome, complete genome	4023351	3913142	3981072	4023351	bacteriocin,transposase,tRNA	Paenibacillus_phage(33.33%)	55	NA	NA
WP_024095474.1|3913142_3914366_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.1e-227
WP_024095475.1|3914646_3916716_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	5.3e-46
WP_036655569.1|3916712_3918473_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.2	9.1e-47
WP_024095476.1|3918642_3918786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482279.1|3920336_3920990_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	27.6	1.1e-10
WP_023483236.1|3921205_3922429_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_080675865.1|3922502_3922709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3923541_3924765_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023482281.1|3925386_3925962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095478.1|3926041_3926263_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_024095479.1|3926415_3926679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119384.1|3926915_3929915_+	peptidase M9	NA	NA	NA	NA	NA
WP_023482283.1|3929988_3930834_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_042119385.1|3930830_3931523_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_036655583.1|3931612_3932365_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	24.9	7.9e-08
WP_023482286.1|3932622_3933027_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_042119873.1|3933289_3935524_-	pyruvate synthase	NA	NA	NA	NA	NA
WP_024095483.1|3935611_3936622_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_052337472.1|3936938_3937661_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_080675866.1|3937873_3938959_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_024095486.1|3939315_3940632_+	APC family permease	NA	NA	NA	NA	NA
WP_024095487.1|3941042_3941354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655594.1|3941623_3941815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095488.1|3941890_3942544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3942658_3943882_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024095489.1|3944107_3944617_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_077585275.1|3944576_3944816_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.5	3.1e-06
WP_036655600.1|3945640_3946852_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023482298.1|3946848_3947529_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	4.7e-36
WP_024095491.1|3947525_3948725_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_024095492.1|3948819_3949497_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_024095493.1|3949493_3950075_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_024095494.1|3950093_3951563_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.2	2.3e-19
WP_024095495.1|3951552_3955233_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_024095496.1|3955452_3956088_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_042119387.1|3956084_3956621_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_024095498.1|3956651_3957899_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_024095499.1|3958021_3959026_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_023482308.1|3959100_3960315_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_052337474.1|3960400_3961336_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024095501.1|3961382_3962039_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_158442256.1|3962038_3963253_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_024095503.1|3963494_3964253_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_024095504.1|3964249_3965299_+	thiamine biosynthesis protein ThiS	NA	A0A1V0SAV8	Catovirus	26.6	4.1e-10
WP_023482314.1|3965397_3967062_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	55.9	2.8e-175
WP_036657247.1|3967292_3968099_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_024095505.1|3968471_3969785_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_042119388.1|3969861_3970641_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_036655604.1|3970938_3971838_-	EamA family transporter	NA	NA	NA	NA	NA
WP_024095507.1|3972059_3973388_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024095508.1|3973700_3975050_+	radical SAM protein	NA	A0A1L7N0Q5	Ralstonia_phage	22.2	5.0e-05
WP_144083350.1|3975572_3976478_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036655605.1|3976732_3977272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482323.1|3979152_3979716_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_024092945.1|3979848_3981072_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.8	1.1e-227
>prophage 1
NZ_CP019653	Paenibacillus larvae subsp. larvae DSM 25430 plasmid unnamed1, complete sequence	21567	10304	19765	21567	transposase	Paenibacillus_phage(66.67%)	8	NA	NA
WP_023483236.1|10304_11528_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_024094128.1|11694_12465_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
WP_023483236.1|12636_13860_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483236.1|14477_15701_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_042119567.1|15743_16079_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024094119.1|16114_16795_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_024094120.1|16799_18332_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.1	6.5e-09
WP_023483236.1|18541_19765_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
