The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	325061	467751	4288947	transposase,bacteriocin,protease,integrase,tRNA	Bacillus_phage(15.38%)	121	400658:400673	405213:405228
WP_051427950.1|325061_326555_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023485421.1|326568_327783_-	sporulation killing factor system radical SAM maturase	NA	NA	NA	NA	NA
WP_024093143.1|327856_328042_-	sporulation killing factor	NA	NA	NA	NA	NA
WP_046655063.1|328452_328821_+	lectin	NA	NA	NA	NA	NA
WP_023485422.1|329606_329933_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_036657184.1|330071_330362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585116.1|330423_330531_-	TipAS antibiotic-recognition domain-containing protein	NA	NA	NA	NA	NA
WP_046655059.1|331001_333041_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.3	1.4e-11
WP_023485426.1|333160_333871_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_024093148.1|334298_334511_-	VOC family protein	NA	NA	NA	NA	NA
WP_023485427.1|334698_335154_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023485428.1|335150_338318_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_023485429.1|338516_339104_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	36.8	1.2e-11
WP_023485430.1|339158_340127_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_023485431.1|340831_341293_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023485432.1|341479_342700_+	MFS transporter	NA	NA	NA	NA	NA
WP_036655432.1|343073_343502_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_024093152.1|343733_344459_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036655430.1|344667_345141_+	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_036657176.1|345168_345927_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_036655428.1|345916_346789_+	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
WP_023485438.1|346806_347229_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_036655426.1|347293_350989_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	30.8	2.3e-76
WP_023485440.1|351073_352777_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	3.0e-15
WP_023485441.1|353276_353600_-	YcxB family protein	NA	NA	NA	NA	NA
WP_144083284.1|353613_353841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046655058.1|354081_355662_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_036655424.1|356191_357421_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023485444.1|357865_358933_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_036657173.1|359590_360160_+	Gx transporter family protein	NA	NA	NA	NA	NA
WP_023485447.1|360195_361029_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	34.2	1.4e-21
WP_036655420.1|361004_361871_+	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	28.9	4.2e-13
WP_036655417.1|361887_362691_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_023485452.1|364781_366056_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	3.4e-27
WP_023485453.1|366069_367509_+	menaquinone biosynthesis decarboxylase	NA	NA	NA	NA	NA
WP_023485454.1|367498_368365_+	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_023485455.1|368712_369042_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_036655414.1|369051_369357_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_077585262.1|369353_369659_-	response regulator	NA	NA	NA	NA	NA
WP_036655412.1|371944_372169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052304444.1|373915_374425_+	TULIP family P47-like protein	NA	NA	NA	NA	NA
WP_158225757.1|374449_375307_+	TULIP family P47-like protein	NA	NA	NA	NA	NA
WP_036655409.1|375410_375692_+	TULIP family P47-like protein	NA	NA	NA	NA	NA
WP_036655407.1|375678_376701_+	TULIP family P47-like protein	NA	NA	NA	NA	NA
WP_023483236.1|379767_380991_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_144029530.1|381120_382050_+	lethal factor domain protein	NA	NA	NA	NA	NA
WP_023484001.1|385506_386487_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_023484002.1|386499_386949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484003.1|387074_388952_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036655403.1|389097_389994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655402.1|391402_391693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932532.1|391769_392639_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	7.5e-135
WP_036655400.1|393432_393936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655398.1|393952_395935_-	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	32.2	3.8e-41
WP_040931538.1|397726_399673_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036654156.1|399659_400430_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
400658:400673	attL	GGGAGCTATTTCTTTG	NA	NA	NA	NA
WP_023484457.1|401196_402570_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_077585110.1|402808_403081_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	47.0	7.7e-14
WP_023484170.1|403052_403421_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036655393.1|403468_403756_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
WP_023483999.1|404427_405084_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_046655388.1|405818_406082_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
405213:405228	attR	GGGAGCTATTTCTTTG	NA	NA	NA	NA
WP_036655391.1|406048_406951_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.3	1.5e-45
WP_024093187.1|407986_408124_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_023483605.1|408820_410524_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.3	3.1e-76
WP_023483606.1|411072_411744_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.8	1.5e-66
WP_023483607.1|411740_412226_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
WP_024093191.1|412218_412956_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
WP_023483609.1|412982_413501_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	1.7e-49
WP_023483611.1|414837_416280_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_023483612.1|416535_416937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046655172.1|417042_418455_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_023483614.1|418684_419248_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_036655386.1|419234_419852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655384.1|420856_421369_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_051428054.1|421789_422413_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_023483618.1|422396_423101_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036655382.1|423157_423361_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_024093200.1|423362_424163_+	thiazole synthase	NA	NA	NA	NA	NA
WP_023483621.1|424159_425086_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036655381.1|425057_425756_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_144029627.1|425838_427596_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_052752965.1|427683_428364_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_158225745.1|428419_428665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427942.1|428814_429165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655379.1|429295_429910_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	4.8e-11
WP_036655377.1|429930_430386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655376.1|430400_431522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655374.1|431529_431829_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_036655372.1|431983_432166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093204.1|433635_433803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655370.1|434167_434545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655368.1|435403_436099_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.3	7.8e-18
WP_024093209.1|436095_436452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482872.1|436798_438772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585106.1|439023_439197_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_104932533.1|439151_439973_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	50.3	5.5e-39
WP_077585104.1|439888_440278_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158225750.1|440274_440577_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023483570.1|440687_440993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483569.1|441317_442307_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_036655364.1|442482_443619_-	virulence factor	NA	NA	NA	NA	NA
WP_023483567.1|443896_444481_-	guanylate kinase	NA	A0A0K2FM14	Brevibacillus_phage	28.3	2.9e-10
WP_036655362.1|445019_446027_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_046655223.1|448022_448640_+	cytochrome (ubi)quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_024093219.1|448644_448959_+	cytochrome c oxidase subunit IV	NA	NA	NA	NA	NA
WP_024093220.1|449085_449952_+	cytochrome c oxidase assembly factor CtaG	NA	NA	NA	NA	NA
WP_155116267.1|451222_451363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483562.1|451508_452414_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	4.7e-23
WP_023483561.1|452406_453675_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023483560.1|454009_455647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483559.1|455871_456669_-	MFS transporter	NA	NA	NA	NA	NA
WP_023483558.1|456669_457155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483557.1|457397_459758_+	AAA family ATPase	NA	A0A1E1ETV1	Acanthamoeba_castellanii_mimivirus	25.9	1.7e-08
WP_023483556.1|459806_460985_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_023483555.1|461167_461974_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_023483554.1|462421_463255_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023483553.1|463382_464621_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_023483552.1|465103_465673_+	maltose O-acetyltransferase-like protein	NA	NA	NA	NA	NA
WP_023483551.1|465942_466368_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023483236.1|466527_467751_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 2
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	616333	669098	4288947	holin,transposase	Staphylococcus_phage(26.67%)	42	NA	NA
WP_077585092.1|616333_616492_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158673674.1|616544_616988_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080548035.1|617396_619334_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.8	6.8e-11
WP_144029518.1|619994_620279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051428052.1|620599_620848_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023484497.1|620844_621855_+	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	28.6	9.9e-22
WP_023484496.1|621870_622569_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
WP_023484495.1|622574_623729_+	ABC transporter-like protein	NA	NA	NA	NA	NA
WP_036655279.1|623829_624051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484494.1|624152_625004_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080548033.1|624972_627315_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_023484492.1|628022_628532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077584997.1|628705_628792_+|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_023484491.1|629342_630800_+	SAM-dependent DNA methyltransferase	NA	A0A1W6JNK1	Staphylococcus_phage	26.9	3.2e-21
WP_023484490.1|630804_631950_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_036655276.1|631960_635311_+	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	23.2	2.0e-18
WP_158673675.1|636057_637269_+	DUF2399 domain-containing protein	NA	NA	NA	NA	NA
WP_051428051.1|637253_638714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657097.1|638745_639468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655272.1|639474_642693_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_036655270.1|644415_645441_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.0	4.4e-17
WP_077585087.1|645346_646225_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_036655268.1|646229_647027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093460.1|647754_649638_+	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.4	3.6e-94
WP_023484171.1|651517_652465_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
WP_036655264.1|653801_654221_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_023484174.1|654217_655168_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_023484175.1|655160_655907_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
WP_024093465.1|656029_656317_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_036655262.1|656323_656812_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_023484177.1|656808_659607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932612.1|659674_660719_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_023484069.1|660932_661373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585084.1|661659_661941_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_077585083.1|661748_662207_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_024093322.1|662987_663167_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_036657096.1|663163_663886_-	NTP transferase domain-containing protein	NA	H9NC64	Sphingomonas_phage	41.0	7.8e-45
WP_158225756.1|664096_664279_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077585256.1|665151_665757_+	hypothetical protein	NA	A0A024B055	Bacillus_phage	43.6	2.5e-12
WP_077585255.1|666060_666942_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051427935.1|667507_668383_+	hypothetical protein	NA	D2KRB9	Lactobacillus_phage	33.0	2.6e-10
WP_023484075.1|668699_669098_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
>prophage 3
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	762463	810069	4288947	transposase,coat,tail,plate,holin	Brevibacillus_phage(30.0%)	54	NA	NA
WP_023483236.1|762463_763687_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_158225747.1|763697_764804_+	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	28.6	8.9e-16
WP_036655218.1|764826_765120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655216.1|765328_765874_-	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_036655213.1|766160_767177_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_023483386.1|767390_767957_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_051427931.1|768063_768912_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.1	6.4e-06
WP_023483384.1|768895_770560_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.4	7.6e-11
WP_023483383.1|770617_771808_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_024095097.1|771956_772220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483382.1|772250_772790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655209.1|773116_773905_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040932142.1|774011_775499_+	membrane protein	NA	NA	NA	NA	NA
WP_023483379.1|775510_776566_+	DUF917 family protein	NA	NA	NA	NA	NA
WP_023483378.1|776595_777534_+	DUF1177 domain-containing protein	NA	NA	NA	NA	NA
WP_023483377.1|777595_778279_+	AroM family protein	NA	NA	NA	NA	NA
WP_023483376.1|778324_779272_+	aminopeptidase	NA	NA	NA	NA	NA
WP_023483375.1|779999_780311_+	hypothetical protein	NA	F8WQ63	Bacillus_phage	57.1	4.4e-13
WP_051427930.1|780724_782731_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_023484168.1|782727_783054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655205.1|783117_783948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655202.1|784145_784385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655200.1|784440_785298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095081.1|785706_786018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095080.1|786167_786329_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036655198.1|786793_787051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482424.1|787160_788216_+	nucleoid-associated protein	NA	A0A0A8WF33	Clostridium_phage	25.0	6.3e-11
WP_023482425.1|788230_789712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655196.1|789764_790241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585254.1|790558_790921_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	40.7	7.9e-14
WP_023482426.1|791021_791477_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023482427.1|791720_792170_+	hypothetical protein	NA	A0A0C5AC66	Paenibacillus_phage	77.3	1.9e-57
WP_036655191.1|792272_792944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482429.1|793414_793843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655187.1|793817_794000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482430.1|794000_795335_+	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	46.4	7.5e-110
WP_036655185.1|795336_795798_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	60.3	2.8e-48
WP_023482432.1|795817_796240_+	hypothetical protein	NA	X5JAB6	Clostridium_phage	41.8	5.8e-24
WP_036655183.1|796611_798657_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	40.5	2.5e-128
WP_023482434.1|798656_799298_+	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	46.3	2.7e-49
WP_023482435.1|799302_800271_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	59.5	3.4e-112
WP_023482436.1|800270_800558_+	DUF2577 domain-containing protein	NA	S5M5M4	Brevibacillus_phage	36.8	7.4e-15
WP_023482437.1|800560_800983_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	47.8	3.3e-27
WP_036655181.1|800960_802037_+|plate	baseplate J/gp47 family protein	plate	S5MUH6	Brevibacillus_phage	50.3	9.0e-98
WP_023482439.1|802041_802611_+	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	42.3	7.7e-32
WP_036655179.1|802607_802886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427929.1|802889_804989_+	kelch repeat-containing protein	NA	NA	NA	NA	NA
WP_023484501.1|805001_805394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484502.1|805586_805997_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	50.4	2.3e-30
WP_023484503.1|805993_806767_+	bacteriophage SPbeta N-acetylmuramoyl-L-alanine amidase-like protein	NA	D6QWN1	uncultured_phage	62.3	4.0e-55
WP_036655177.1|806984_808277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655172.1|808938_809286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484506.1|809336_809681_-	DUF2512 family protein	NA	NA	NA	NA	NA
WP_023484507.1|809865_810069_+|coat	spore coat-like protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	934086	951907	4288947	transposase,integrase	Paenibacillus_phage(50.0%)	20	923840:923853	939500:939513
923840:923853	attL	TTCCGCAGCTCATT	NA	NA	NA	NA
WP_077585061.1|934086_934533_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEA5	Paenibacillus_phage	53.1	9.0e-36
WP_158673676.1|934556_934802_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051427925.1|935062_935644_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024093681.1|935735_936380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655089.1|936725_937052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655087.1|937178_937487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095020.1|937879_938113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485292.1|938184_938853_+	adenosylcobinamide amidohydrolase	NA	NA	NA	NA	NA
WP_024095018.1|939156_939342_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	54.3	2.4e-06
WP_024095017.1|940361_940757_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	62.8	7.0e-40
939500:939513	attR	TTCCGCAGCTCATT	NA	NA	NA	NA
WP_104932538.1|940761_941775_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	30.6	1.3e-18
WP_023485255.1|941930_943409_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	25.4	5.0e-30
WP_024095013.1|944659_944881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485254.1|945914_947210_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_036655081.1|947216_947954_-	response regulator	NA	NA	NA	NA	NA
WP_023485252.1|948166_948727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932509.1|948797_948938_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_024095010.1|948962_949160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427924.1|949279_950677_+	radical SAM protein	NA	NA	NA	NA	NA
WP_023483236.1|950683_951907_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 5
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	958351	1021176	4288947	integrase,protease,transposase,coat	Staphylococcus_phage(33.33%)	54	965264:965278	991595:991609
WP_023482953.1|958351_958777_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_023482952.1|958905_959769_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_051428047.1|960110_961133_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_096761176.1|961371_961809_+	DUF2383 domain-containing protein	NA	NA	NA	NA	NA
WP_036655069.1|961914_962238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655066.1|963757_965227_+	hypothetical protein	NA	NA	NA	NA	NA
965264:965278	attL	TTTTATATATGCCAT	NA	NA	NA	NA
WP_023482947.1|965541_966204_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	1.4e-13
WP_096761175.1|966301_966637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484369.1|966654_967167_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051428046.1|967457_969128_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023485551.1|969224_970202_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023485550.1|970209_971220_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_023485549.1|971212_972241_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_096761125.1|972544_973589_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_104932539.1|973737_975216_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.2	7.4e-26
WP_023484148.1|975383_975842_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_152532853.1|976280_977141_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_023484150.1|977303_978521_-	cytochrome P450	NA	NA	NA	NA	NA
WP_023484151.1|979004_980885_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_042119509.1|980971_981241_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
WP_077585054.1|982379_983690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093853.1|984038_984188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484154.1|984421_984802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225764.1|984833_986999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655058.1|987275_987488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483467.1|988560_989235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655055.1|989376_989664_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_152532830.1|989702_990038_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158673677.1|990012_990366_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_144029584.1|990467_990581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052304433.1|991432_991675_-	hypothetical protein	NA	NA	NA	NA	NA
991595:991609	attR	TTTTATATATGCCAT	NA	NA	NA	NA
WP_155116265.1|992040_992190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655052.1|992794_994876_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_023482861.1|995030_996071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656994.1|996642_997395_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_023482859.1|997457_998150_-	LrgB family protein	NA	NA	NA	NA	NA
WP_023482858.1|998146_998506_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_152532829.1|998833_1000036_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_036655050.1|1000244_1001567_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155121091.1|1001852_1002014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482855.1|1002073_1003366_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_036656992.1|1003407_1004994_+	malate synthase A	NA	NA	NA	NA	NA
WP_023482853.1|1005129_1008255_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023482851.1|1009022_1009346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427922.1|1009463_1011245_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_036655049.1|1011410_1011689_-	DUF2653 family protein	NA	NA	NA	NA	NA
WP_023482849.1|1011688_1012120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655047.1|1012247_1012802_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_023482847.1|1012798_1013389_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_036655044.1|1013411_1013747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482845.1|1013853_1015374_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_046655122.1|1015963_1016923_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_023482840.1|1019546_1020509_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_023482839.1|1020606_1021176_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
>prophage 6
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1028404	1090516	4288947	transposase,integrase,coat,tRNA	Paenibacillus_phage(50.0%)	51	1048649:1048666	1079236:1079253
WP_023482834.1|1028404_1029367_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_023482833.1|1029444_1029684_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_023482832.1|1029830_1032263_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_104932613.1|1032473_1033121_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	48.8	1.6e-20
WP_024094596.1|1033171_1033558_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_023482830.1|1033747_1034449_+	YdcF family protein	NA	NA	NA	NA	NA
WP_023482829.1|1034490_1035492_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_024094593.1|1035618_1036608_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	45.5	3.4e-51
WP_023482827.1|1036645_1037923_+	GTPase HflX	NA	NA	NA	NA	NA
WP_024094591.1|1037965_1039216_+	aluminum resistance protein	NA	NA	NA	NA	NA
WP_023482825.1|1039386_1039794_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096761169.1|1039827_1041162_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_023483571.1|1043990_1044365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654912.1|1045186_1048543_+	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	37.6	1.4e-88
1048649:1048666	attL	AAAGAAATAGCTCCCCAA	NA	NA	NA	NA
WP_158673678.1|1048763_1049207_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077585047.1|1049259_1049580_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093300.1|1049624_1049951_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077585046.1|1050019_1050439_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2SXP1	Bacillus_phage	59.8	5.3e-38
WP_046655237.1|1050518_1050869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1052861_1054085_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_051427904.1|1054940_1056032_+	LCP family protein	NA	NA	NA	NA	NA
WP_042119086.1|1056132_1056363_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	47.9	7.5e-10
WP_024094581.1|1056859_1057126_+	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	72.7	1.9e-28
WP_023484142.1|1057271_1057889_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	6.5e-16
WP_036656935.1|1058166_1058412_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036654904.1|1058593_1058779_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_023484143.1|1058805_1059600_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023484144.1|1059705_1060248_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_023484145.1|1060524_1063965_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	5.1e-09
WP_023484146.1|1064139_1065096_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_104932540.1|1065219_1065937_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.4	3.2e-59
WP_158673679.1|1066594_1067308_-	ETX/MTX2 family pore-forming toxin	NA	A0A2I7SC07	Paenibacillus_phage	61.5	6.9e-62
WP_023483236.1|1067389_1068613_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023484631.1|1068605_1068956_-	hypothetical protein	NA	A0A2I7SC07	Paenibacillus_phage	61.2	2.9e-13
WP_144029596.1|1070512_1070821_+	hypothetical protein	NA	A0A0C5AFE4	Paenibacillus_phage	69.4	2.9e-25
WP_096761208.1|1072421_1073840_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_051428031.1|1074094_1075162_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	33.9	2.2e-48
WP_024094407.1|1075410_1075893_+	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.3	1.4e-26
WP_024094406.1|1076094_1076646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483534.1|1077455_1078205_-	DUF4065 domain-containing protein	NA	A0A0C5ABL3	Bacteriophage	67.5	5.1e-92
WP_046655328.1|1078207_1078903_-	hypothetical protein	NA	A0A0C5AN10	Bacteriophage	68.7	2.0e-82
WP_036654894.1|1079718_1081281_+	peptidase M4 family protein	NA	NA	NA	NA	NA
1079236:1079253	attR	AAAGAAATAGCTCCCCAA	NA	NA	NA	NA
WP_023483236.1|1081692_1082916_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036654891.1|1083366_1083681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654889.1|1084275_1084914_+	ribonuclease H	NA	NA	NA	NA	NA
WP_077585044.1|1085081_1086545_+	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_036654887.1|1086923_1087910_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_023483255.1|1088287_1088512_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
WP_036654885.1|1088648_1089632_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_155116366.1|1089773_1089929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483257.1|1090036_1090516_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 7
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1168081	1307629	4288947	portal,capsid,transposase,bacteriocin,tail,terminase,protease,head,holin,integrase,tRNA	Paenibacillus_phage(76.77%)	157	1205323:1205338	1269431:1270819
WP_096761125.1|1168081_1169127_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_036654854.1|1169270_1169870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483329.1|1170142_1171063_+	glycosyl hydrolase lipoprotein-like protein	NA	NA	NA	NA	NA
WP_104932542.1|1171164_1172457_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_023483331.1|1172775_1174215_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_023483332.1|1174218_1175013_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023483333.1|1175078_1175558_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_036654848.1|1175660_1176344_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.8	2.2e-121
WP_104932543.1|1176364_1177234_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
WP_042119178.1|1177551_1178154_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023482876.1|1178707_1179490_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_023482877.1|1179829_1180996_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_036654846.1|1181138_1181477_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_036654844.1|1181604_1185012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152532822.1|1184903_1189433_+|tail	WIAG-tail domain	tail	NA	NA	NA	NA
WP_023482881.1|1189687_1190410_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	40.9	3.2e-46
WP_023482882.1|1190406_1191597_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_036654842.1|1191571_1192708_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_023482884.1|1192707_1193079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427894.1|1193352_1194813_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_023482886.1|1194809_1195904_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	44.4	1.9e-87
WP_023482887.1|1195893_1196880_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.7	4.2e-41
WP_024094822.1|1196876_1197707_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023482889.1|1197703_1198609_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A291LAD7	Escherichia_phage	25.7	1.2e-15
WP_023482890.1|1198616_1199336_+	glycosyltransferase	NA	K7Z8A5	Megavirus	23.6	1.2e-10
WP_036654840.1|1199417_1200338_-	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	31.2	7.4e-32
WP_036656899.1|1200506_1201283_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_023482893.1|1201287_1202304_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_023482894.1|1202290_1203127_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024094817.1|1203210_1204077_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_024094816.1|1204492_1205194_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_036654839.1|1205174_1206107_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
1205323:1205338	attL	AACCCCGCTGCGGGAA	NA	NA	NA	NA
WP_023482898.1|1206246_1207557_+	purine/pyrimidine permease-like protein	NA	NA	NA	NA	NA
1205323:1205338	attL	AACCCCGCTGCGGGAA	NA	NA	NA	NA
WP_024094813.1|1207697_1207922_+	response regulator transcription factor	NA	A0A290GJH9	Caldibacillus_phage	70.5	3.7e-14
WP_023482516.1|1209765_1210404_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_036656232.1|1211067_1211346_-	HU family DNA-binding protein	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
WP_023483458.1|1211446_1211653_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_036656234.1|1212062_1212968_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	55.5	3.5e-87
WP_104932544.1|1213322_1213682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1213746_1214970_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_104932545.1|1214976_1216488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585036.1|1216557_1218153_-	hypothetical protein	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	26.4	2.5e-35
WP_052304415.1|1218223_1218418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585035.1|1218763_1218982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051428005.1|1219483_1219942_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_023483236.1|1220680_1221904_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036657613.1|1222153_1223098_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_023484957.1|1223602_1224337_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023484956.1|1224346_1225330_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
1224808:1224823	attR	AACCCCGCTGCGGGAA	NA	NA	NA	NA
WP_104932546.1|1225581_1226823_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	100.0	5.9e-242
1224808:1224823	attR	AACCCCGCTGCGGGAA	NA	NA	NA	NA
WP_046655220.1|1226877_1227357_-	hypothetical protein	NA	A0A0K2CZC9	Paenibacillus_phage	100.0	4.4e-89
WP_051428006.1|1227362_1228046_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	99.6	7.9e-124
WP_036656239.1|1228156_1228393_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	100.0	7.4e-37
WP_023484953.1|1228618_1229443_+	hypothetical protein	NA	A0A0K2CZE3	Paenibacillus_phage	100.0	4.6e-150
WP_023484952.1|1229462_1229852_+	hypothetical protein	NA	A0A0K2CZ66	Paenibacillus_phage	100.0	1.2e-68
WP_023483804.1|1229848_1230613_+	DNA-binding anti-repressor-like protein	NA	A0A0K2CZD5	Paenibacillus_phage	100.0	7.5e-131
WP_036656242.1|1230609_1230903_+	helix-turn-helix domain-containing protein	NA	A0A0K2CZS5	Paenibacillus_phage	100.0	4.4e-47
WP_051428007.1|1230918_1231557_+	hypothetical protein	NA	A0A0K2CZL5	Paenibacillus_phage	100.0	1.3e-128
WP_036656244.1|1231579_1231795_+	hypothetical protein	NA	A0A0K2CZE8	Paenibacillus_phage	100.0	1.6e-30
WP_104932547.1|1232133_1232328_+	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	100.0	6.9e-33
WP_051428008.1|1232311_1232584_+	hypothetical protein	NA	A0A0K2CZL9	Paenibacillus_phage	100.0	2.2e-45
WP_036656248.1|1232606_1232825_+	hypothetical protein	NA	A0A0K2CZF4	Paenibacillus_phage	100.0	7.0e-34
WP_040931267.1|1232859_1233093_+	hypothetical protein	NA	A0A0K2CZ76	Paenibacillus_phage	100.0	2.8e-36
WP_036656252.1|1233085_1233274_+	hypothetical protein	NA	A0A0K2CZE4	Paenibacillus_phage	100.0	5.3e-30
WP_036656254.1|1233289_1233679_+	hypothetical protein	NA	A0A0K2CZT2	Paenibacillus_phage	100.0	3.0e-67
WP_036656256.1|1233684_1233924_+	hypothetical protein	NA	A0A0K2CZM3	Paenibacillus_phage	100.0	8.2e-36
WP_155116251.1|1233938_1234097_+	hypothetical protein	NA	A0A0K2CZG0	Paenibacillus_phage	100.0	5.1e-18
WP_036656257.1|1234379_1234595_+	hypothetical protein	NA	A0A0K2CZE9	Paenibacillus_phage	98.6	2.7e-30
WP_023484470.1|1234601_1235300_+	DNA cytosine methyltransferase	NA	A0A0K2CZT5	Paenibacillus_phage	100.0	8.1e-124
WP_036657628.1|1235308_1235530_+	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	100.0	3.8e-35
WP_036656259.1|1235548_1235899_+	hypothetical protein	NA	A0A0K2CZG5	Paenibacillus_phage	100.0	1.6e-48
WP_040931270.1|1235895_1236180_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	100.0	2.0e-49
WP_036658310.1|1236212_1236584_+	hypothetical protein	NA	A0A0K2CZF3	Paenibacillus_phage	100.0	5.7e-60
WP_036658312.1|1236620_1237331_+	hypothetical protein	NA	A0A0K2CZT8	Paenibacillus_phage	100.0	3.6e-127
WP_040931273.1|1237396_1238707_+	AAA family ATPase	NA	A0A0K2CZN2	Paenibacillus_phage	100.0	2.1e-181
WP_023483362.1|1238709_1239786_+	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	100.0	5.1e-210
WP_036658315.1|1239810_1240317_+	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	100.0	1.8e-93
WP_036658317.1|1240326_1241907_+	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	100.0	4.7e-305
WP_077584865.1|1241942_1242113_+	DUF3797 domain-containing protein	NA	A0A0K2CZU3	Paenibacillus_phage	100.0	6.9e-29
WP_036658319.1|1242120_1244373_+	AAA family ATPase	NA	A0A0K2CZ75	Paenibacillus_phage	100.0	0.0e+00
WP_036658320.1|1244659_1244938_+	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	100.0	4.9e-48
WP_036658322.1|1244927_1245323_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CZ96	Paenibacillus_phage	100.0	2.0e-71
WP_036658324.1|1245326_1245548_+	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	100.0	9.9e-36
WP_158673680.1|1245564_1246650_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	99.7	1.2e-209
WP_036658328.1|1246683_1246878_+	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	100.0	3.2e-30
WP_036658330.1|1246874_1247303_+	RinA family phage transcriptional regulator	NA	A0A0K2CZI2	Paenibacillus_phage	100.0	1.9e-75
WP_104932548.1|1247434_1247638_+	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	100.0	4.0e-31
WP_036656288.1|1247701_1247926_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0K2CZG8	Paenibacillus_phage	100.0	1.0e-35
WP_036657636.1|1247972_1248326_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	100.0	4.4e-62
WP_036656290.1|1248374_1248647_+	hypothetical protein	NA	A0A0K2CZP5	Paenibacillus_phage	100.0	5.9e-46
WP_023484460.1|1248880_1249231_+	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	100.0	9.5e-65
WP_036656294.1|1249242_1249587_+	HNH endonuclease	NA	A0A0K2CZA0	Paenibacillus_phage	100.0	4.3e-62
WP_023484127.1|1249690_1250005_+|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZ94	Paenibacillus_phage	100.0	1.6e-50
WP_077584887.1|1249985_1251710_+|terminase	terminase large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	100.0	0.0e+00
WP_036656297.1|1251724_1252960_+|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	99.8	3.5e-239
WP_046655269.1|1252949_1253666_+|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	100.0	1.1e-131
WP_104932549.1|1253662_1254805_+|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	100.0	3.5e-209
WP_036656301.1|1254930_1255194_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0K2CZI4	Paenibacillus_phage	100.0	4.2e-41
WP_023484581.1|1255190_1255511_+|head	phage head closure protein	head	A0A0K2CZB5	Paenibacillus_phage	100.0	3.0e-57
WP_036656302.1|1255507_1255900_+	hypothetical protein	NA	A0A0K2CZ33	Paenibacillus_phage	100.0	4.3e-66
WP_036656304.1|1255896_1256226_+	hypothetical protein	NA	A0A0K2CZA4	Paenibacillus_phage	100.0	4.4e-56
WP_046655268.1|1256261_1256858_+	hypothetical protein	NA	A0A0K2CZP8	Paenibacillus_phage	100.0	3.9e-111
WP_023484578.1|1256929_1257301_+	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	100.0	2.9e-64
WP_104932550.1|1257534_1261239_+|tail	phage tail tape measure protein	tail	A0A0K2CZ38	Paenibacillus_phage	100.0	0.0e+00
WP_023484576.1|1261239_1262106_+|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	100.0	4.0e-165
WP_023484575.1|1262108_1263227_+	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	100.0	2.0e-212
WP_051428011.1|1263232_1264306_+	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	99.7	7.1e-212
WP_036656307.1|1264315_1264657_+	hypothetical protein	NA	A0A0K2CZC5	Paenibacillus_phage	100.0	9.9e-59
WP_036656310.1|1264795_1265026_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A0K2CZB4	Paenibacillus_phage	100.0	2.0e-34
WP_077585248.1|1265025_1265694_+	hypothetical protein	NA	A0A0K2CZQ6	Paenibacillus_phage	100.0	2.4e-133
WP_036656312.1|1266189_1266429_+	hypothetical protein	NA	A0A0K2CZD0	Paenibacillus_phage	100.0	1.0e-33
WP_036656314.1|1266572_1266752_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	98.3	7.1e-24
WP_036656316.1|1266834_1267107_-	hypothetical protein	NA	A0A0K2CZB9	Paenibacillus_phage	100.0	4.3e-49
WP_036656319.1|1267120_1267393_-	hypothetical protein	NA	A0A0K2CZR1	Paenibacillus_phage	100.0	3.3e-41
WP_158225779.1|1267471_1267645_-	hypothetical protein	NA	A0A0K2CZV9	Paenibacillus_phage	100.0	5.6e-26
WP_036656321.1|1267622_1267841_-	hypothetical protein	NA	A0A0K2CZK3	Paenibacillus_phage	100.0	6.8e-37
WP_023483236.1|1268146_1269370_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_077585034.1|1269651_1269804_+	Arc family DNA-binding protein	NA	A0A0K2CZC4	Paenibacillus_phage	100.0	5.8e-19
WP_077584997.1|1269962_1270049_+|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_104932551.1|1270372_1270852_-	stress protein	NA	A0A0K2CZD8	Paenibacillus_phage	100.0	2.6e-81
WP_023485250.1|1271231_1271813_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023485249.1|1271880_1272222_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_023485248.1|1272221_1272536_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_155116279.1|1272758_1272926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152659182.1|1273261_1274245_+	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	75.9	7.1e-49
WP_158225777.1|1275993_1276170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932612.1|1276192_1277238_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_077585033.1|1277354_1277966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585246.1|1278285_1279032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484983.1|1279045_1279318_+	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
WP_077585032.1|1279450_1279588_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SC34	Paenibacillus_phage	90.9	7.0e-16
WP_036656340.1|1279689_1280163_-	hypothetical protein	NA	A0A0C5AER4	Bacteriophage	69.1	9.6e-36
WP_036656341.1|1280911_1281094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484303.1|1281324_1282134_-	MFS transporter	NA	NA	NA	NA	NA
WP_036656345.1|1282245_1282761_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.6	8.5e-38
WP_023484301.1|1282997_1284029_+	germination protein	NA	NA	NA	NA	NA
WP_023484300.1|1284364_1285120_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_023484299.1|1285106_1285739_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_023484298.1|1285806_1287651_-	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	24.7	9.9e-28
WP_024094796.1|1287939_1288293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656348.1|1288458_1288935_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_024094794.1|1288927_1290442_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_024094793.1|1290496_1290610_+	DUF4023 family protein	NA	NA	NA	NA	NA
WP_023484294.1|1290836_1292057_+	CapA family protein	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	33.9	4.8e-55
WP_046655164.1|1292187_1293090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484292.1|1293268_1294570_+	trigger factor	NA	NA	NA	NA	NA
WP_036656352.1|1294734_1295325_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.1	1.2e-56
WP_023484290.1|1295340_1296600_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	4.5e-149
WP_023484289.1|1296704_1297826_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_052304436.1|1297876_1298584_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_046655163.1|1298799_1300518_+|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	25.1	3.6e-16
WP_024094787.1|1300667_1303001_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.5	4.3e-169
WP_023484285.1|1303019_1303634_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_023484284.1|1304024_1304612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656356.1|1304984_1305368_+	adenosylmethionine decarboxylase	NA	A0A0E3FA82	Synechococcus_phage	36.4	1.1e-18
WP_023484282.1|1305523_1306057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094783.1|1306228_1307629_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1492832	1546359	4288947	portal,capsid,bacteriocin,protease,terminase,plate,integrase,tRNA	Paenibacillus_phage(37.74%)	74	1486378:1486392	1517575:1517589
1486378:1486392	attL	ATTCCGTTTATTTTT	NA	NA	NA	NA
WP_023483874.1|1492832_1495277_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	70.7	0.0e+00
WP_036656457.1|1495280_1496108_-	late competence protein ComER	NA	NA	NA	NA	NA
WP_077585014.1|1496237_1496810_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036656460.1|1496908_1498201_+	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	27.8	8.5e-18
WP_023483878.1|1498226_1498739_+	dCMP deaminase family protein	NA	A0A222YXY3	Mycobacterium_phage	44.9	3.5e-23
WP_051428029.1|1498796_1500710_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_023483880.1|1500721_1501954_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	75.1	4.8e-180
WP_023483881.1|1502021_1502747_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	42.2	1.5e-11
WP_158225787.1|1503021_1503126_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077585243.1|1503126_1503231_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077585012.1|1503370_1504195_+	phage antirepressor Ant	NA	A0A0C5AFE7	Paenibacillus_phage	94.7	1.1e-130
WP_077585011.1|1504127_1504388_+	helix-turn-helix domain-containing protein	NA	A0A0K2CZS5	Paenibacillus_phage	85.9	1.5e-35
WP_024093542.1|1504403_1504664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656462.1|1504640_1504898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042118685.1|1504997_1505375_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	89.6	3.8e-59
WP_036656465.1|1505371_1505593_+	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	90.4	1.6e-30
WP_023485299.1|1505730_1505964_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	49.3	5.8e-18
WP_155116273.1|1505993_1506158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093547.1|1506186_1506942_+	antirepressor	NA	A0A0C5AEJ9	Bacteriophage	76.5	1.5e-107
WP_023485301.1|1506938_1507247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093548.1|1507282_1507471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656467.1|1507467_1508151_+	antirepressor	NA	A0A2I7SCV5	Paenibacillus_phage	73.8	1.6e-55
WP_036656470.1|1508316_1508508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093551.1|1508544_1508808_+	hypothetical protein	NA	A0A0K2CZE9	Paenibacillus_phage	56.3	2.2e-13
WP_023485303.1|1508815_1509247_+	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	53.7	1.9e-06
WP_024093553.1|1509243_1509822_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	41.2	1.2e-24
WP_104932556.1|1509891_1511520_+	hypothetical protein	NA	R9TQJ2	Paenibacillus_phage	76.2	5.5e-224
WP_023485306.1|1511523_1512348_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.8	1.9e-87
WP_023485307.1|1512328_1513141_+	hypothetical protein	NA	R9TMF6	Paenibacillus_phage	68.5	2.0e-110
WP_024093556.1|1513156_1513489_+	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	98.2	5.3e-57
WP_024093557.1|1513537_1514425_+	DnaD domain protein	NA	A0A0K2CY85	Paenibacillus_phage	100.0	8.1e-153
WP_036656473.1|1515255_1515465_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	86.8	5.0e-29
WP_036656474.1|1515466_1515841_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	66.9	2.6e-44
WP_024093562.1|1516031_1516397_+	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	86.0	1.5e-57
WP_023485190.1|1516411_1516933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585242.1|1517007_1517673_+	site-specific DNA-methyltransferase	NA	A0A1D8KTH4	Synechococcus_phage	52.0	3.2e-61
1517575:1517589	attR	AAAAATAAACGGAAT	NA	NA	NA	NA
WP_023485192.1|1517766_1518075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155116272.1|1518537_1518708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080548007.1|1518694_1519228_+	RNA polymerase subunit sigma-24	NA	A0A0K2CNQ1	Brevibacillus_phage	59.6	1.4e-46
WP_024093566.1|1519349_1519553_+	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	89.6	2.9e-26
WP_158673683.1|1519824_1519992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485194.1|1520050_1520791_+|terminase	phage-related terminase-like protein small subunit	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	47.5	1.4e-44
WP_023485195.1|1520783_1522055_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	65.7	9.5e-163
WP_023485196.1|1522070_1523534_+|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	59.3	8.1e-166
WP_023485197.1|1523530_1524550_+|capsid	minor capsid protein	capsid	S5MTV5	Brevibacillus_phage	57.6	1.3e-109
WP_036656478.1|1524587_1525211_+	hypothetical protein	NA	A0A0K2CP96	Brevibacillus_phage	59.8	1.0e-61
WP_036656480.1|1525225_1525582_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.3	1.8e-42
WP_023485200.1|1525597_1526644_+	hypothetical protein	NA	A0A0K2CP76	Brevibacillus_phage	87.2	5.4e-172
WP_024094434.1|1526655_1526889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656482.1|1526875_1527244_+	hypothetical protein	NA	S5MP25	Brevibacillus_phage	55.8	2.1e-30
WP_023485201.1|1527245_1527605_+	hypothetical protein	NA	S5M673	Brevibacillus_phage	54.7	6.4e-32
WP_023485202.1|1527604_1528015_+	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	56.6	1.8e-38
WP_023485203.1|1528011_1528422_+	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	46.8	7.8e-26
WP_036656485.1|1528414_1528597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485204.1|1528597_1529929_+	hypothetical protein	NA	A0A0A7RTT5	Clostridium_phage	48.4	4.2e-113
WP_023485206.1|1530420_1530846_+	hypothetical protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_036656487.1|1531069_1533178_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	42.5	2.1e-143
WP_023485208.1|1533174_1533813_+	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	49.1	6.4e-51
WP_023485209.1|1533817_1534801_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	56.2	9.7e-107
WP_023485210.1|1534800_1535043_+	DUF2577 domain-containing protein	NA	A0A0A8WJ65	Clostridium_phage	42.7	1.4e-11
WP_023485211.1|1535045_1535456_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	45.5	2.7e-26
WP_036656489.1|1535448_1536525_+|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	51.8	6.0e-102
WP_023484987.1|1536535_1537099_+	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	46.9	1.8e-36
WP_024094419.1|1537095_1537374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094418.1|1537377_1538781_+	kelch-like protein	NA	S5MNY5	Brevibacillus_phage	37.5	5.4e-10
WP_024094417.1|1538793_1539189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155116215.1|1539181_1539340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656495.1|1539374_1539614_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.7	1.1e-35
WP_024094413.1|1540297_1540762_+	hypothetical protein	NA	A0A0K2CZJ8	Paenibacillus_phage	71.4	6.9e-63
WP_024094412.1|1540779_1541058_+	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	80.6	4.2e-39
WP_036656497.1|1541070_1541313_+	hypothetical protein	NA	A0A0K2CZD0	Paenibacillus_phage	97.4	4.3e-32
WP_023484264.1|1541625_1542738_+	AAA family ATPase	NA	A0A1S5V1G7	Saudi_moumouvirus	28.8	1.5e-15
WP_023484263.1|1542757_1545037_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_051428031.1|1545291_1546359_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	33.9	2.2e-48
>prophage 9
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1718911	1730708	4288947	transposase	Paenibacillus_phage(61.54%)	14	NA	NA
WP_024094470.1|1718911_1719328_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
WP_024094469.1|1719359_1719770_-	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	38.8	6.6e-09
WP_104932612.1|1720302_1721348_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_036654758.1|1721941_1722442_+	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	7.1e-05
WP_036654757.1|1722778_1723327_+	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	81.4	1.3e-73
WP_104932563.1|1723663_1723876_-	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	77.3	7.1e-23
WP_036654728.1|1723879_1724149_-	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	97.7	7.6e-38
WP_024094464.1|1724145_1724337_-	hypothetical protein	NA	A0A2I7SC20	Paenibacillus_phage	98.4	1.6e-29
WP_024094463.1|1724833_1725055_+	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
WP_023484815.1|1725940_1726585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094459.1|1727209_1727413_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	88.1	5.0e-26
WP_023484756.1|1727602_1727992_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	49.3	6.5e-06
WP_144029544.1|1728207_1728474_+	hypothetical protein	NA	A0A2I7SCG0	Paenibacillus_phage	88.5	2.7e-19
WP_051427883.1|1729334_1730708_+	family 10 glycosylhydrolase	NA	A0A2I7SC76	Paenibacillus_phage	88.5	3.7e-27
>prophage 10
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1768139	1775584	4288947	holin,transposase	Paenibacillus_phage(80.0%)	11	NA	NA
WP_036658348.1|1768139_1769351_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.0	1.8e-224
WP_036654730.1|1769396_1769876_+	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_036654728.1|1770443_1770713_-	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	97.7	7.6e-38
WP_024094464.1|1770709_1770901_-	hypothetical protein	NA	A0A2I7SC20	Paenibacillus_phage	98.4	1.6e-29
WP_036654725.1|1771355_1771571_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	98.6	4.5e-33
WP_077584997.1|1771725_1771812_+|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_036654721.1|1772032_1772488_-	hypothetical protein	NA	A0A0C5AER4	Bacteriophage	40.2	1.9e-20
WP_144029498.1|1773093_1773429_+	hypothetical protein	NA	A0A0K2CYM6	Paenibacillus_phage	44.6	1.2e-13
WP_036654716.1|1773379_1773901_+	hypothetical protein	NA	A0A0K2CZ30	Paenibacillus_phage	40.5	6.2e-20
WP_104932612.1|1773942_1774988_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_023483042.1|1775197_1775584_+	LytTR family transcriptional regulator	NA	A0A0K2CYP4	Paenibacillus_phage	50.0	3.6e-25
>prophage 11
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1784371	1838132	4288947	tail,transposase,portal,holin	Paenibacillus_phage(97.06%)	74	NA	NA
WP_023483051.1|1784371_1785025_-	helix-turn-helix domain-containing protein	NA	A0A2I7SCV6	Paenibacillus_phage	66.0	1.7e-70
WP_036654705.1|1785193_1785406_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	61.7	1.1e-12
WP_036654702.1|1785452_1785743_+	helix-turn-helix domain-containing protein	NA	A0A2I7SC15	Paenibacillus_phage	81.1	5.3e-37
WP_023483052.1|1786191_1786818_+	hypothetical protein	NA	A0A0K2CZL5	Paenibacillus_phage	72.6	1.9e-87
WP_155116299.1|1786839_1787016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155116298.1|1787012_1787180_+	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	90.6	8.3e-19
WP_036656824.1|1787199_1787586_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFE9	Paenibacillus_phage	63.5	9.0e-32
WP_036654698.1|1787824_1788196_+	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	39.8	1.2e-17
WP_051427878.1|1788253_1788631_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	70.9	4.3e-39
WP_051427877.1|1788590_1788983_+	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	90.8	6.7e-59
WP_023483053.1|1788999_1789842_+	DUF3102 domain-containing protein	NA	A0A0N9RZE9	Paenibacillus_phage	62.0	8.4e-83
WP_036654695.1|1789979_1790507_+	hypothetical protein	NA	A0A0N9SJU7	Paenibacillus_phage	83.4	3.3e-77
WP_036654693.1|1790517_1790784_+	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	95.5	2.7e-43
WP_023483054.1|1790791_1791562_+	hypothetical protein	NA	A0A0N7GFF0	Paenibacillus_phage	95.3	6.6e-143
WP_023483055.1|1791558_1792935_+	AAA family ATPase	NA	A0A0N9SIP5	Paenibacillus_phage	96.9	1.1e-254
WP_051427876.1|1792947_1793898_+	hypothetical protein	NA	A0A0N9S7Y2	Paenibacillus_phage	88.9	4.9e-164
WP_051427875.1|1793950_1794514_+	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	96.8	2.2e-87
WP_036654689.1|1794576_1795101_+	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	69.5	7.1e-56
WP_023483057.1|1795194_1795932_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	95.5	8.2e-135
WP_036654686.1|1796104_1796320_+	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	80.6	1.0e-24
WP_036654684.1|1796464_1796878_+	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	96.4	6.6e-73
WP_023483058.1|1797083_1797893_+	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	76.9	6.5e-109
WP_036654678.1|1799691_1800024_+	hypothetical protein	NA	A0A0N9SGL0	Paenibacillus_phage	86.4	6.7e-52
WP_051427874.1|1800007_1801180_+	DNA polymerase	NA	A0A0N9RTM8	Paenibacillus_phage	91.0	6.8e-208
WP_036654676.1|1801180_1801378_+	hypothetical protein	NA	A0A0N7GFF2	Paenibacillus_phage	100.0	6.6e-31
WP_023483062.1|1801374_1801989_+	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	95.1	4.1e-103
WP_051427873.1|1801973_1802993_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	94.1	1.1e-156
WP_040931725.1|1803270_1803501_+	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	100.0	1.6e-36
WP_077585238.1|1803636_1804077_+	hypothetical protein	NA	A0A0N9SJY5	Paenibacillus_phage	99.1	7.8e-56
WP_155116291.1|1804106_1804268_+	hypothetical protein	NA	A0A0N9RRE2	Paenibacillus_phage	100.0	1.0e-26
WP_036654670.1|1804318_1804540_+	hypothetical protein	NA	A0A0N9SIR4	Paenibacillus_phage	100.0	8.4e-35
WP_051427871.1|1804554_1804944_+	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	100.0	3.1e-72
WP_036654668.1|1804945_1805263_+	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	100.0	1.3e-57
WP_036654666.1|1805256_1805721_+	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	100.0	1.3e-88
WP_023485387.1|1805724_1806600_+	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	100.0	2.0e-167
WP_036654664.1|1806583_1807144_+	AAA family ATPase	NA	A0A0N9SJZ0	Paenibacillus_phage	100.0	1.8e-105
WP_036654663.1|1807100_1807484_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	99.2	3.9e-72
WP_023485386.1|1807610_1808777_+	SAM-dependent DNA methyltransferase	NA	A0A0N9ST12	Paenibacillus_phage	100.0	1.5e-234
WP_023485385.1|1808790_1810068_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX25	Bacillus_phage	39.7	1.5e-75
WP_051427870.1|1810055_1810463_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	84.4	8.5e-57
WP_051427869.1|1810452_1810905_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	75.3	1.4e-60
WP_036654658.1|1812101_1812494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|1812790_1814014_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036654652.1|1814194_1814413_+	hypothetical protein	NA	A0A0N9SGN2	Paenibacillus_phage	94.4	6.8e-29
WP_158225710.1|1814402_1814570_+	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	76.4	6.6e-16
WP_023484125.1|1814571_1814991_+	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	95.7	3.9e-73
WP_023484124.1|1814980_1815370_+	helix-turn-helix domain-containing protein	NA	A0A0N7GFF5	Paenibacillus_phage	100.0	1.5e-66
WP_036654649.1|1816261_1816513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656796.1|1818590_1820087_+|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	93.9	4.9e-251
WP_023484120.1|1820083_1820947_+	hypothetical protein	NA	A0A0N9SJR1	Paenibacillus_phage	83.6	3.8e-131
WP_023484119.1|1821034_1821688_+	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	81.0	4.1e-61
WP_023484118.1|1821743_1822679_+	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	79.4	2.7e-143
WP_036654646.1|1822693_1823077_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	94.5	2.2e-62
WP_023484117.1|1823077_1823410_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	99.1	4.1e-57
WP_036654643.1|1823406_1823832_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	90.8	2.9e-68
WP_036654641.1|1823828_1824203_+	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	95.2	1.6e-62
WP_036654638.1|1824215_1824785_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	70.5	3.7e-66
WP_036654636.1|1824851_1825109_+	hypothetical protein	NA	A0A0K2CZ43	Paenibacillus_phage	51.9	8.1e-13
WP_036654634.1|1825111_1825489_+	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	92.8	6.6e-56
WP_036654632.1|1825461_1825839_+	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	72.0	5.3e-21
WP_051427868.1|1825866_1826466_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	97.0	1.3e-82
WP_036654630.1|1826466_1828761_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	45.6	1.3e-149
WP_023484113.1|1828762_1830220_+|tail	phage tail family protein	tail	A0A0N9RRA9	Paenibacillus_phage	96.3	5.8e-281
WP_023484112.1|1830222_1832544_+	hypothetical protein	NA	A0A0N9SIL8	Paenibacillus_phage	97.5	0.0e+00
WP_158225709.1|1832540_1832978_+	hypothetical protein	NA	A0A0N9S7V6	Paenibacillus_phage	98.6	8.8e-76
WP_036654628.1|1832965_1833382_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	100.0	1.8e-70
WP_051427866.1|1833374_1833629_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	100.0	5.3e-41
WP_158225708.1|1833540_1834179_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	96.4	9.1e-106
WP_036654626.1|1834401_1834677_-	hypothetical protein	NA	A0A0K2CZR1	Paenibacillus_phage	60.9	1.2e-19
WP_023484108.1|1834695_1835709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046655200.1|1835848_1836094_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036654623.1|1836509_1836860_-	hypothetical protein	NA	A0A2I7SCF2	Paenibacillus_phage	84.5	2.5e-49
WP_023484106.1|1836906_1837332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051427864.1|1837505_1838132_-	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	59.5	2.0e-36
>prophage 12
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2224868	2301300	4288947	transposase,integrase,protease	Tupanvirus(15.38%)	55	2221533:2221571	2225865:2225903
2221533:2221571	attL	GGGGTATCGCCAACCAAATGACATAAAACCCACGCTAAG	NA	NA	NA	NA
WP_023482513.1|2224868_2225567_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	43.2	1.7e-44
WP_155116260.1|2225596_2225764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482514.1|2225879_2226818_+	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	74.7	5.0e-137
2225865:2225903	attR	CTTAGCGTGGGTTTTATGTCATTTGGTTGGCGATACCCC	NA	NA	NA	NA
WP_036654242.1|2227025_2227952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932572.1|2228469_2229515_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_077584934.1|2229867_2230101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484393.1|2231167_2232067_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	2.1e-07
WP_036654237.1|2232167_2232593_+	VOC family protein	NA	NA	NA	NA	NA
WP_036654235.1|2233685_2234885_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_023484390.1|2234915_2246219_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.8	3.5e-107
WP_077584933.1|2246323_2247007_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	97.8	1.5e-119
WP_023485480.1|2248121_2250731_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	1.2e-42
WP_036654231.1|2250926_2251235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152532808.1|2251730_2252618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654223.1|2252748_2253399_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	3.4e-31
WP_023484572.1|2253411_2254215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484571.1|2254211_2255018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484570.1|2255004_2255817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484569.1|2255884_2256352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484568.1|2256653_2257373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160297883.1|2258124_2258232_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_023484567.1|2258348_2259056_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036654219.1|2259086_2260496_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.7	1.2e-57
WP_023484565.1|2260809_2261394_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036654217.1|2261566_2262148_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023484563.1|2262170_2263373_+	MFS transporter	NA	NA	NA	NA	NA
WP_023484562.1|2263531_2264914_-	amino acid permease	NA	NA	NA	NA	NA
WP_023484561.1|2265554_2265929_-	YxeA family protein	NA	NA	NA	NA	NA
WP_023484560.1|2266282_2267914_-	2-hydroxyglutaryl-CoA dehydratase activator-like protein	NA	NA	NA	NA	NA
WP_023484559.1|2267946_2271417_-	2-hydroxyglutaryl-CoA dehydratase activator	NA	NA	NA	NA	NA
WP_144029559.1|2271482_2271917_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_077585232.1|2273081_2273717_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036654212.1|2273976_2274741_-	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	35.2	7.5e-30
WP_023484555.1|2275823_2276642_-	MFS transporter	NA	NA	NA	NA	NA
WP_077584930.1|2276712_2276874_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_023484554.1|2278441_2279053_-	hypothetical protein	NA	A0A2K9L5M2	Tupanvirus	35.4	1.2e-22
WP_036654209.1|2279064_2279949_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_152532807.1|2280817_2282116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158225720.1|2282043_2282586_-|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	40.2	2.0e-08
WP_036654204.1|2283267_2283531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484548.1|2284849_2285608_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_036656631.1|2285786_2286518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654202.1|2286546_2288013_+	antitoxin	NA	NA	NA	NA	NA
WP_036656629.1|2288096_2288660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094102.1|2288784_2289681_-	cation transporter	NA	NA	NA	NA	NA
WP_024094104.1|2290663_2291032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094105.1|2291222_2291957_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023484542.1|2292012_2292798_-	delta-lactam-biosynthetic de-N-acetylase	NA	NA	NA	NA	NA
WP_023484541.1|2292911_2294429_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_096761187.1|2294507_2295524_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_023484539.1|2296097_2296370_-	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
WP_023484538.1|2296390_2296810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484536.1|2297333_2298764_-	MBL fold metallo-hydrolase	NA	A0A2N9QVZ6	Dishui_lake_phycodnavirus	36.6	1.3e-06
WP_036654194.1|2298838_2300038_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036654192.1|2300244_2301300_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	29.6	2.5e-15
>prophage 13
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2325353	2333194	4288947	transposase,bacteriocin	Paenibacillus_phage(66.67%)	7	NA	NA
WP_104932616.1|2325353_2326399_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_036654169.1|2326480_2326987_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	33.3	8.5e-06
WP_036654167.1|2328179_2329538_-	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	34.7	2.0e-73
WP_051427819.1|2329811_2330357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427818.1|2330654_2330897_-	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	91.2	2.6e-29
WP_036654163.1|2331544_2331817_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	94.7	1.6e-30
WP_023483236.1|2331970_2333194_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 14
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2494323	2501198	4288947	transposase	Clostridioides_phage(50.0%)	6	NA	NA
WP_096761125.1|2494323_2495368_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_036654074.1|2495372_2496413_-	hypothetical protein	NA	A0A1V0E017	Clostridioides_phage	26.2	1.9e-07
WP_104932576.1|2496743_2497592_-	ricin-type beta-trefoil lectin domain protein	NA	A0A0K2CYN4	Paenibacillus_phage	30.5	9.5e-10
WP_023483236.1|2497726_2498950_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_104932577.1|2498956_2500093_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	32.1	5.3e-40
WP_051427804.1|2500190_2501198_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	35.9	3.1e-39
>prophage 15
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2602187	2664928	4288947	portal,capsid,tail,protease,head,terminase,holin,tRNA	Paenibacillus_phage(95.89%)	87	NA	NA
WP_036653995.1|2602187_2603582_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	2.9e-40
WP_036653992.1|2603751_2604294_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_023484648.1|2604472_2605801_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_023484649.1|2605813_2607904_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
WP_023484651.1|2609264_2610200_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_023484652.1|2610256_2611417_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_024094298.1|2611804_2612065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094299.1|2612096_2612492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932581.1|2612625_2613675_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_036653988.1|2613796_2614132_+	transcriptional regulator	NA	A0A0K2CYN0	Paenibacillus_phage	100.0	1.1e-54
WP_152532805.1|2614171_2614459_-	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	98.7	8.4e-35
WP_036653981.1|2614694_2615051_-	dipeptidyl aminopeptidase/acylaminoacyl-peptidase	NA	A0A0K2CYP4	Paenibacillus_phage	100.0	1.0e-61
WP_036653979.1|2615182_2615698_-	hypothetical protein	NA	A0A0K2CZ30	Paenibacillus_phage	100.0	1.8e-88
WP_036653977.1|2615690_2616359_-	hypothetical protein	NA	A0A0K2CYM6	Paenibacillus_phage	100.0	3.5e-108
WP_036653975.1|2616582_2617134_+	DUF4352 domain-containing protein	NA	A0A0K2CYG1	Paenibacillus_phage	100.0	3.4e-69
WP_077584891.1|2617344_2617503_-|holin	putative holin-like toxin	holin	A0A0K2CYN9	Paenibacillus_phage	100.0	8.4e-21
WP_036653973.1|2617603_2617831_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	100.0	8.6e-35
WP_036653970.1|2618299_2618485_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	100.0	8.3e-28
WP_036653966.1|2618570_2618834_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	100.0	3.8e-42
WP_023484754.1|2619145_2622073_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	100.0	0.0e+00
WP_036658895.1|2622925_2623369_-	hypothetical protein	NA	A0A0K2CYV0	Paenibacillus_phage	100.0	5.8e-75
WP_036658891.1|2623352_2623706_-	hypothetical protein	NA	R9W0N7	Paenibacillus_phage	100.0	4.8e-64
WP_023484752.1|2623725_2624694_-	hypothetical protein	NA	A0A0K2CYL7	Paenibacillus_phage	100.0	1.6e-178
WP_051428122.1|2624880_2625135_-	hypothetical protein	NA	R9W000	Paenibacillus_phage	100.0	2.7e-37
WP_077585230.1|2625419_2626094_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	R9VY83	Paenibacillus_phage	100.0	1.8e-136
WP_024094415.1|2626093_2626333_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
WP_036656307.1|2626471_2626813_-	hypothetical protein	NA	A0A0K2CZC5	Paenibacillus_phage	100.0	9.9e-59
WP_051428011.1|2626822_2627896_-	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	99.7	7.1e-212
WP_023484575.1|2627901_2629020_-	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	100.0	2.0e-212
WP_023484576.1|2629022_2629889_-|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	100.0	4.0e-165
WP_036656306.1|2629889_2633594_-|tail	phage tail tape measure protein	tail	A0A0K2CYK9	Paenibacillus_phage	100.0	0.0e+00
WP_023484578.1|2633827_2634199_-	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	100.0	2.9e-64
WP_046655268.1|2634270_2634867_-	hypothetical protein	NA	A0A0K2CZP8	Paenibacillus_phage	100.0	3.9e-111
WP_036656304.1|2634902_2635232_-	hypothetical protein	NA	A0A0K2CZA4	Paenibacillus_phage	100.0	4.4e-56
WP_036656302.1|2635228_2635621_-	hypothetical protein	NA	A0A0K2CZ33	Paenibacillus_phage	100.0	4.3e-66
WP_023484581.1|2635617_2635938_-|head	phage head closure protein	head	A0A0K2CZB5	Paenibacillus_phage	100.0	3.0e-57
WP_036656301.1|2635934_2636198_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0K2CZI4	Paenibacillus_phage	100.0	4.2e-41
WP_023484582.1|2636323_2637466_-|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	99.5	6.6e-208
WP_046655269.1|2637462_2638179_-|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	100.0	1.1e-131
WP_036656297.1|2638168_2639404_-|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	99.8	3.5e-239
WP_077584887.1|2639418_2641143_-|terminase	terminase large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	100.0	0.0e+00
WP_023484127.1|2641123_2641438_-|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZ94	Paenibacillus_phage	100.0	1.6e-50
WP_036658631.1|2641575_2641917_-	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	100.0	1.8e-60
WP_023484126.1|2641903_2642218_-	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	100.0	1.9e-48
WP_036658634.1|2642397_2642601_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0K2CYR6	Paenibacillus_phage	100.0	1.5e-33
WP_023484796.1|2642631_2643048_+	HicB family protein	NA	A0A0K2CYJ8	Paenibacillus_phage	100.0	9.2e-75
WP_036658635.1|2643102_2643447_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	100.0	4.5e-59
WP_077584885.1|2643652_2644090_-	transcriptional regulator	NA	A0A0K2CYZ6	Paenibacillus_phage	100.0	3.7e-74
WP_155116353.1|2644218_2644362_-	hypothetical protein	NA	A0A0K2CZ63	Paenibacillus_phage	100.0	3.0e-17
WP_036658638.1|2644358_2644604_-	hypothetical protein	NA	A0A0K2CYR3	Paenibacillus_phage	100.0	1.6e-39
WP_036658640.1|2644596_2644830_-	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	100.0	4.3e-37
WP_036658642.1|2644881_2645064_-	hypothetical protein	NA	A0A0K2CYS1	Paenibacillus_phage	100.0	7.7e-26
WP_023483250.1|2645047_2645830_-	DNA-methyltransferase-like protein	NA	A0A0K2CYZ1	Paenibacillus_phage	100.0	7.4e-158
WP_036658643.1|2645846_2646212_-	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	100.0	4.7e-67
WP_036658646.1|2646393_2646768_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	100.0	1.4e-66
WP_036658649.1|2646760_2646979_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	100.0	3.7e-35
WP_104932619.1|2647097_2647910_-	ATP-binding protein	NA	A0A0K2CYY7	Paenibacillus_phage	99.5	7.5e-121
WP_023483153.1|2647809_2648592_-	DnaD domain protein	NA	A0A0K2CZ53	Paenibacillus_phage	100.0	1.9e-137
WP_036658651.1|2648671_2649004_-	hypothetical protein	NA	A0A0K2CYQ2	Paenibacillus_phage	100.0	2.8e-58
WP_036658652.1|2649000_2649390_-	hypothetical protein	NA	A0A0K2CYI4	Paenibacillus_phage	100.0	1.5e-66
WP_036658655.1|2649398_2649803_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	100.0	7.8e-71
WP_023485215.1|2649792_2650431_-	hypothetical protein	NA	A0A0K2CYY2	Paenibacillus_phage	100.0	5.9e-113
WP_023485214.1|2650433_2650982_-	hypothetical protein	NA	A0A0K2CZ48	Paenibacillus_phage	100.0	4.3e-96
WP_036658656.1|2650978_2651242_-	hypothetical protein	NA	A0A0K2CYP7	Paenibacillus_phage	100.0	2.6e-43
WP_155116354.1|2651341_2651482_-	hypothetical protein	NA	A0A0K2CYI0	Paenibacillus_phage	100.0	3.1e-19
WP_036658659.1|2651459_2651804_-	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	100.0	3.8e-58
WP_036658661.1|2651890_2652403_+	hypothetical protein	NA	A0A0K2CYX7	Paenibacillus_phage	100.0	2.9e-94
WP_036658663.1|2652392_2652650_-	hypothetical protein	NA	A0A0K2CZ43	Paenibacillus_phage	100.0	1.7e-42
WP_036658665.1|2652642_2653218_-	hypothetical protein	NA	A0A0K2CYP2	Paenibacillus_phage	100.0	1.1e-102
WP_023483806.1|2653214_2653967_-	hypothetical protein	NA	A0A0K2CY14	Paenibacillus_phage	100.0	3.9e-140
WP_155116304.1|2653971_2654145_-	hypothetical protein	NA	R9VY98	Paenibacillus_phage	100.0	6.0e-28
WP_036658666.1|2654128_2654359_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	100.0	1.0e-35
WP_036658668.1|2654355_2654733_-	hypothetical protein	NA	R9VW30	Paenibacillus_phage	100.0	1.2e-65
WP_036658670.1|2654739_2654943_-	hypothetical protein	NA	R9W009	Paenibacillus_phage	100.0	2.2e-34
WP_036658672.1|2654963_2655233_-	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	100.0	8.4e-45
WP_144029586.1|2655247_2655439_-	hypothetical protein	NA	A0A0K2CYD7	Paenibacillus_phage	100.0	5.0e-28
WP_046655112.1|2655561_2655783_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CYW6	Paenibacillus_phage	100.0	1.7e-35
WP_036658676.1|2655877_2656216_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZ35	Paenibacillus_phage	100.0	9.2e-57
WP_023484366.1|2656217_2657900_+	recombinase family protein	NA	A0A0K2CYN0	Paenibacillus_phage	100.0	0.0e+00
WP_023484364.1|2658419_2658824_-	YraN family protein	NA	NA	NA	NA	NA
WP_023484363.1|2658833_2659166_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_023484362.1|2659162_2660974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484361.1|2661028_2661712_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.7	5.7e-21
WP_036658681.1|2662004_2662886_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_023484359.1|2662977_2663580_-	signal peptidase I	NA	NA	NA	NA	NA
WP_023484358.1|2663691_2664033_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_023484357.1|2664175_2664928_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2693556	2698023	4288947	integrase	Paenibacillus_phage(50.0%)	8	2685187:2685202	2698351:2698366
2685187:2685202	attL	TTATTTTGCACAAAAA	NA	NA	NA	NA
WP_036658701.1|2693556_2693907_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.0	1.4e-28
WP_077584875.1|2694163_2694490_-	hypothetical protein	NA	A0A0C5AFG5	Paenibacillus_phage	82.2	1.6e-45
WP_040930346.1|2694601_2695117_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_042119037.1|2695199_2695403_-	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	40.0	6.8e-07
WP_024094338.1|2695998_2696223_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051428114.1|2696369_2696921_+	helix-turn-helix domain-containing protein	NA	R9VW28	Paenibacillus_phage	33.3	3.6e-18
WP_024094340.1|2697086_2697422_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	43.2	6.8e-12
WP_077584874.1|2697405_2698023_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	53.0	5.1e-37
2698351:2698366	attR	TTATTTTGCACAAAAA	NA	NA	NA	NA
>prophage 17
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2796370	2841087	4288947	portal,capsid,transposase,tail,terminase,holin,integrase	Paenibacillus_phage(61.36%)	54	2788419:2788435	2842942:2842958
2788419:2788435	attL	TCATAGCTGATCTTTTT	NA	NA	NA	NA
WP_023483236.1|2796370_2797594_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_077584868.1|2797931_2799215_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_077584997.1|2799433_2799520_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_036658346.1|2799807_2801370_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_023484128.1|2802210_2803779_+	spore germination protein	NA	NA	NA	NA	NA
WP_096761240.1|2803867_2805017_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.1	2.3e-35
WP_104932584.1|2805501_2805849_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	99.1	1.5e-57
WP_036658597.1|2807099_2807342_-	hypothetical protein	NA	A0A0C5AN23	Paenibacillus_phage	92.5	1.6e-31
WP_051428102.1|2807986_2808427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585228.1|2808690_2809359_-	hypothetical protein	NA	A0A0C5AEW3	Paenibacillus_phage	94.6	1.3e-126
WP_023484982.1|2809460_2809868_-|holin	phage holin family protein	holin	D0R7H7	Paenibacillus_phage	52.9	3.2e-32
WP_155116252.1|2809902_2810070_-	hypothetical protein	NA	A0A0C5ABK5	Bacteriophage	87.0	2.3e-16
WP_036658339.1|2810195_2810396_-	hypothetical protein	NA	A0A0C5AE97	Paenibacillus_phage	62.5	3.9e-15
WP_023484981.1|2810407_2811172_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	80.9	1.5e-70
WP_158673688.1|2811171_2812593_-	lysin	NA	A0A1B2APX2	Phage_Wrath	54.4	1.6e-110
WP_036658337.1|2812649_2813348_-	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	41.8	2.4e-43
WP_023484978.1|2813350_2816551_-	tape measure protein	NA	M1IEW1	Bacillus_virus	43.2	6.7e-56
WP_077585227.1|2816571_2816871_-	phenylalanine racemase	NA	A0A097PAX1	Streptococcus_pyogenes_phage	45.8	5.3e-16
WP_036658588.1|2816996_2817299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484977.1|2817301_2817826_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	72.8	1.6e-52
WP_023484976.1|2817839_2818250_-	DUF5072 family protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	44.9	3.9e-33
WP_036658585.1|2818254_2818590_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	37.2	2.4e-09
WP_023484975.1|2818595_2818901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484974.1|2818897_2819221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484973.1|2819223_2820120_-	hypothetical protein	NA	A7J297	Streptococcus_phage	52.1	4.3e-69
WP_023484972.1|2820132_2820729_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_036658335.1|2820809_2821703_-|capsid	minor capsid protein	capsid	S5MTV5	Brevibacillus_phage	32.9	1.4e-35
WP_023484970.1|2821611_2823021_-|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	50.7	2.4e-114
WP_052304419.1|2823021_2824329_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1L2JY46	Aeribacillus_phage	58.5	3.0e-140
WP_023484968.1|2824300_2825080_-|terminase	phage-related terminase-like protein small subunit	terminase	A0A1L2JY44	Aeribacillus_phage	52.3	6.4e-53
WP_046655181.1|2825655_2825898_-	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	85.5	1.3e-28
WP_036658332.1|2825953_2826160_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	93.9	2.2e-29
WP_036658330.1|2826292_2826721_-	RinA family phage transcriptional regulator	NA	A0A0K2CZI2	Paenibacillus_phage	100.0	1.9e-75
WP_036658328.1|2826717_2826912_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	100.0	3.2e-30
WP_158673680.1|2826945_2828031_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	99.7	1.2e-209
WP_036658324.1|2828047_2828269_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	100.0	9.9e-36
WP_036658322.1|2828272_2828668_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CZ96	Paenibacillus_phage	100.0	2.0e-71
WP_036658320.1|2828657_2828936_-	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	100.0	4.9e-48
WP_036658319.1|2829222_2831475_-	AAA family ATPase	NA	A0A0K2CZ75	Paenibacillus_phage	100.0	0.0e+00
WP_077584865.1|2831482_2831653_-	DUF3797 domain-containing protein	NA	A0A0K2CZU3	Paenibacillus_phage	100.0	6.9e-29
WP_036658317.1|2831688_2833269_-	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	100.0	4.7e-305
WP_036658315.1|2833278_2833785_-	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	100.0	1.8e-93
WP_023483362.1|2833809_2834886_-	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	100.0	5.1e-210
WP_036658314.1|2834888_2836199_-	AAA family ATPase	NA	A0A0K2CZN2	Paenibacillus_phage	99.8	1.4e-180
WP_036658312.1|2836264_2836975_-	hypothetical protein	NA	A0A0K2CZT8	Paenibacillus_phage	100.0	3.6e-127
WP_036658310.1|2837011_2837383_-	hypothetical protein	NA	A0A0K2CZF3	Paenibacillus_phage	100.0	5.7e-60
WP_036658308.1|2837415_2837700_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	95.7	2.1e-46
WP_036658306.1|2837696_2837927_-	hypothetical protein	NA	A0A2I7SC43	Paenibacillus_phage	88.2	1.8e-32
WP_036658305.1|2837942_2838194_-	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	46.9	2.8e-10
WP_046655182.1|2838210_2838459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658301.1|2838428_2838611_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036658575.1|2839087_2839396_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	33.5	1.9e-16
WP_036658299.1|2839403_2839868_+	hypothetical protein	NA	A0A2I7SC21	Paenibacillus_phage	58.8	1.1e-49
WP_051428101.1|2839947_2841087_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	39.7	2.2e-62
2842942:2842958	attR	TCATAGCTGATCTTTTT	NA	NA	NA	NA
>prophage 18
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2923270	2992938	4288947	protease,transposase	Paenibacillus_phage(33.33%)	59	NA	NA
WP_023484433.1|2923270_2923816_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.4	7.0e-22
WP_023484432.1|2924249_2924954_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_036658232.1|2925510_2927394_+	lantibiotic dehydratase family protein	NA	A0A2H4PQG8	Staphylococcus_phage	26.2	4.7e-49
WP_023484430.1|2927430_2929749_+	MutC-like protein	NA	NA	NA	NA	NA
WP_077584855.1|2929715_2930075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484429.1|2930363_2931680_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_023484428.1|2931967_2932951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077584854.1|2933292_2935278_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_036658223.1|2935360_2935639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932586.1|2936411_2937209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484424.1|2937426_2938884_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_158225733.1|2939069_2940098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042119234.1|2940514_2940790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484422.1|2940765_2941518_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023484421.1|2941614_2942808_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_036658210.1|2942833_2944393_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_024094951.1|2945158_2945407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658206.1|2945413_2945677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094953.1|2945860_2946802_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023484418.1|2946983_2947598_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_036658526.1|2947820_2949011_-	MFS transporter	NA	NA	NA	NA	NA
WP_023484416.1|2949046_2949736_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024095072.1|2949935_2950226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155116244.1|2950241_2950385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484415.1|2950692_2951121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658524.1|2951115_2951880_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_023483236.1|2952131_2953355_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023484161.1|2953692_2954433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484162.1|2954937_2955552_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_144029546.1|2956041_2956326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051428096.1|2956778_2957114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658199.1|2957750_2959121_+	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_051428095.1|2959098_2959686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658196.1|2959657_2960944_+	MFS transporter	NA	NA	NA	NA	NA
WP_152532860.1|2961177_2961627_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	47.1	2.7e-24
WP_023483434.1|2963514_2963847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658190.1|2964165_2964435_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023483433.1|2964467_2964761_+	ppGpp-regulated growth inhibitor	NA	NA	NA	NA	NA
WP_023483432.1|2965012_2965303_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023483431.1|2965299_2967810_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036658187.1|2967915_2968212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484751.1|2970420_2970702_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_023484750.1|2970709_2971720_-	type I-B CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_023484749.1|2971739_2972234_-	Dna2/Cas4 domain-containing protein	NA	NA	NA	NA	NA
WP_036658181.1|2972230_2974909_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_023484747.1|2975022_2975823_-	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_036658179.1|2975859_2976822_-	CRISPR-associated protein	NA	NA	NA	NA	NA
WP_036658176.1|2976814_2978722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484744.1|2978742_2979447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096761161.1|2980389_2980512_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051428093.1|2983350_2983617_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036658172.1|2983679_2983931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482939.1|2984288_2985302_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_104932587.1|2985305_2986351_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	6.0e-06
WP_158225752.1|2986489_2987785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658167.1|2987969_2989136_+	amidohydrolase	NA	NA	NA	NA	NA
WP_023484372.1|2989207_2990395_+	MFS transporter	NA	NA	NA	NA	NA
WP_036656001.1|2991842_2992160_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024095239.1|2992374_2992938_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	2.6e-24
>prophage 19
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3437950	3444707	4288947		Staphylococcus_phage(57.14%)	7	NA	NA
WP_036658393.1|3437950_3438592_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
WP_036657869.1|3438560_3439343_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.2	9.7e-09
WP_023482604.1|3439773_3440244_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	1.1e-42
WP_040931955.1|3440279_3441509_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.0	8.1e-111
WP_023482602.1|3441543_3442209_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
WP_036658391.1|3442212_3443325_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.2e-52
WP_023482600.1|3444269_3444707_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
>prophage 20
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3449714	3524005	4288947	transposase,integrase,coat	Paenibacillus_phage(59.09%)	82	3465066:3465088	3525413:3525426
WP_077585202.1|3449714_3449915_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036657864.1|3450361_3451060_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_036658387.1|3451074_3451731_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_024093711.1|3456902_3457184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657862.1|3457551_3457992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657861.1|3458442_3458637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657859.1|3458831_3459587_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0A0RV91	Bacillus_phage	54.1	8.6e-63
WP_024093708.1|3459598_3460054_-	anti-sigma F factor	NA	NA	NA	NA	NA
WP_036657858.1|3460050_3460404_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_023482588.1|3460525_3461704_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_023482587.1|3461860_3462430_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_036657856.1|3462404_3463223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036657854.1|3463206_3464100_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	39.8	2.0e-26
WP_023482584.1|3464096_3464780_+	ABC transporter permease	NA	NA	NA	NA	NA
3465066:3465088	attL	TCTACCTAAAGGGGATAATATCA	NA	NA	NA	NA
WP_036657851.1|3465125_3465503_-	hypothetical protein	NA	NA	NA	NA	NA
3465066:3465088	attL	TCTACCTAAAGGGGATAATATCA	NA	NA	NA	NA
WP_023482581.1|3465752_3466610_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	38.1	8.3e-54
WP_077585293.1|3466626_3467448_-	purine-nucleoside phosphorylase	NA	Q5YFI9	Singapore_grouper_iridovirus	43.8	2.7e-62
WP_023482579.1|3467519_3468695_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_023482578.1|3468856_3469753_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	32.1	1.0e-38
WP_024093702.1|3469849_3470083_-	DUF4227 family protein	NA	NA	NA	NA	NA
WP_023482577.1|3470148_3471270_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_023482576.1|3471576_3472062_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_023482575.1|3472161_3472806_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_096761168.1|3473038_3474223_-	TIGR00375 family protein	NA	NA	NA	NA	NA
WP_077585201.1|3474234_3474900_-	NUDIX hydrolase	NA	A0A1S6L1P8	Vibrio_phage	24.8	4.2e-05
WP_155116342.1|3474904_3475081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482572.1|3475100_3476087_-	LCP family protein	NA	NA	NA	NA	NA
WP_036654254.1|3478570_3479071_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_077584935.1|3479188_3479785_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046655380.1|3480139_3480466_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036657849.1|3481377_3481632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051428068.1|3481658_3482168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657847.1|3484339_3484729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657846.1|3484966_3485461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158673690.1|3485659_3485869_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	53.7	5.9e-14
WP_077585197.1|3485903_3486113_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_036657844.1|3488091_3488289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158225767.1|3489235_3489370_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_023484389.1|3489492_3490398_-	hypothetical protein	NA	NA	NA	NA	NA
3489427:3489449	attR	TCTACCTAAAGGGGATAATATCA	NA	NA	NA	NA
WP_036657842.1|3490627_3490924_-	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	70.6	3.5e-12
3489427:3489449	attR	TCTACCTAAAGGGGATAATATCA	NA	NA	NA	NA
WP_040932682.1|3491316_3491886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093310.1|3491927_3492194_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_077585196.1|3492466_3492679_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_036656200.1|3492859_3493543_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	99.1	9.7e-122
WP_104932592.1|3493563_3494433_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	97.9	1.1e-133
WP_023484383.1|3494592_3495963_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_077585292.1|3496015_3497119_-	radical SAM/CxCxxxxC motif protein YfkAB	NA	NA	NA	NA	NA
WP_023484381.1|3497507_3498359_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_104932593.1|3498503_3499919_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_036656198.1|3500355_3501072_-	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_036656196.1|3501264_3501597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484377.1|3501675_3502722_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_023484376.1|3502916_3503312_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_158225766.1|3503545_3503644_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_036656192.1|3503716_3503980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093303.1|3503999_3505043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093302.1|3505126_3505393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093300.1|3505803_3506130_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096761311.1|3506516_3507589_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	98.9	2.8e-152
WP_036656190.1|3507824_3508229_-	hypothetical protein	NA	A0A2I7SDE8	Paenibacillus_phage	100.0	8.7e-70
WP_040931737.1|3508492_3509473_-	hypothetical protein	NA	A0A2I7SDE4	Paenibacillus_phage	81.6	1.4e-68
WP_155116292.1|3509600_3509771_-	hypothetical protein	NA	A0A2I7SCU7	Paenibacillus_phage	86.0	2.9e-19
WP_036656186.1|3509781_3510081_-	SH3 domain-containing protein	NA	A0A0K2CXS6	Paenibacillus_phage	93.9	1.1e-45
WP_036656185.1|3510680_3510947_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	76.1	7.5e-30
WP_023483236.1|3512500_3513724_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_144029696.1|3513716_3514085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046655151.1|3514421_3515417_-	amidinotransferase	NA	NA	NA	NA	NA
WP_023483374.1|3515869_3516172_-	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	45.0	9.8e-10
WP_158442223.1|3516284_3516953_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_036655055.1|3517051_3517339_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024093295.1|3517987_3518230_-	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	90.0	6.2e-31
WP_077585291.1|3518343_3518979_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CXQ8	Paenibacillus_phage	97.2	4.3e-124
WP_024093293.1|3518978_3519218_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	96.2	4.1e-35
WP_024093292.1|3519477_3519708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093291.1|3519683_3520346_-	hypothetical protein	NA	A0A2I7SC02	Paenibacillus_phage	46.7	5.1e-11
WP_023485348.1|3520621_3521023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585193.1|3521053_3521401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485349.1|3521385_3521988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051428002.1|3522231_3522966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656178.1|3522981_3523164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052337377.1|3523482_3523782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093285.1|3523813_3524005_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3525413:3525426	attR	ATATCGTTGAAATC	NA	NA	NA	NA
>prophage 21
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3620143	3659224	4288947	transposase,protease,holin,integrase,tRNA	Streptococcus_phage(14.29%)	37	3610345:3610359	3662596:3662610
3610345:3610359	attL	CCAGCATTTTGTACA	NA	NA	NA	NA
WP_023483754.1|3620143_3621190_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036656029.1|3621205_3621574_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	43.5	1.7e-19
WP_023483752.1|3621635_3622568_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_036656027.1|3622564_3623134_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_023483750.1|3623149_3624766_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_023483749.1|3624785_3625862_-	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_023483748.1|3625894_3626698_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_023483747.1|3626679_3627675_-	cobalamin biosynthesis protein CobD	NA	NA	NA	NA	NA
WP_096761274.1|3627677_3628253_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_042119334.1|3628385_3629432_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_036656025.1|3629489_3630287_-	heme ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.3e-16
WP_023483743.1|3630279_3631320_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_036657504.1|3631342_3632323_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024095222.1|3633529_3633793_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_042119337.1|3633877_3635083_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X6WGT4	Pacmanvirus	24.4	1.8e-06
WP_023483739.1|3635098_3635590_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024095225.1|3635853_3636135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483738.1|3636362_3637694_-	MFS transporter	NA	NA	NA	NA	NA
WP_036656022.1|3637720_3638404_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023483736.1|3638382_3638907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656020.1|3638938_3639433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483734.1|3639565_3639985_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_036656018.1|3640084_3640756_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_104932595.1|3640868_3643232_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	37.9	1.8e-13
WP_023483731.1|3643555_3643924_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_036656016.1|3644165_3644528_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_023483729.1|3644608_3645148_-	CvpA family protein	NA	NA	NA	NA	NA
WP_036656013.1|3645153_3648054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483727.1|3648160_3650611_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_023483726.1|3650634_3651663_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.9	1.7e-29
WP_023483724.1|3652764_3653280_-	signal peptidase I	NA	NA	NA	NA	NA
WP_023483723.1|3653447_3654371_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_024095237.1|3654477_3654774_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144083344.1|3655629_3655818_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_104932597.1|3655718_3656150_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.9	6.5e-23
WP_104932598.1|3656128_3656281_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_023484938.1|3658318_3659224_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	57.0	1.4e-91
3662596:3662610	attR	CCAGCATTTTGTACA	NA	NA	NA	NA
>prophage 22
NZ_CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3828026	3883560	4288947	integrase,bacteriocin,transposase,tRNA	Paenibacillus_phage(22.22%)	50	3869390:3869403	3887472:3887485
WP_036655898.1|3828026_3828353_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_036655897.1|3829474_3830143_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036655895.1|3831212_3832118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484479.1|3832120_3833794_-	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_023484478.1|3833793_3834726_-	type III-B CRISPR module RAMP protein Cmr1	NA	NA	NA	NA	NA
WP_023484477.1|3834748_3835630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093104.1|3835783_3836050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051427976.1|3837596_3838373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655893.1|3838799_3839123_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144029592.1|3839298_3839928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655890.1|3841041_3841896_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_023483984.1|3841892_3842852_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.0	5.1e-76
WP_023483983.1|3842848_3843406_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.6	7.1e-38
WP_023483981.1|3844866_3845682_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWP2	uncultured_phage	53.5	5.3e-42
WP_036657415.1|3845913_3846564_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_023483979.1|3846873_3847170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483977.1|3848932_3849748_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036655885.1|3849857_3851720_-	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_024093087.1|3851777_3853226_-	amino acid permease	NA	NA	NA	NA	NA
WP_023483974.1|3854351_3855053_-	protein rep	NA	NA	NA	NA	NA
WP_036657413.1|3855084_3856347_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.2e-87
WP_023483972.1|3856896_3858285_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_024093084.1|3858355_3860224_-	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_036655882.1|3860235_3861687_-	amino acid permease	NA	NA	NA	NA	NA
WP_036655880.1|3862444_3862687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155116268.1|3862733_3862910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427973.1|3863382_3863802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655878.1|3864094_3864304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051427972.1|3864503_3864761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427970.1|3865290_3865533_-	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	93.8	1.2e-31
WP_162544274.1|3865559_3865712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152532836.1|3865669_3865921_-	hypothetical protein	NA	A0A2I7QIN4	Bacillus_phage	52.0	2.1e-10
WP_155116269.1|3865904_3866069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655875.1|3866070_3866295_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A0C5AEG8	Bacteriophage	85.7	2.1e-25
WP_036655873.1|3866662_3867886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655871.1|3868023_3871050_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	37.6	1.7e-88
3869390:3869403	attL	ATCTTTTTATCTGT	NA	NA	NA	NA
WP_024093080.1|3871121_3872372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036657409.1|3873171_3874695_+	spore germination protein	NA	NA	NA	NA	NA
WP_036655869.1|3874691_3875795_+	endospore germination permease	NA	NA	NA	NA	NA
WP_024093077.1|3875791_3876286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585280.1|3876555_3877224_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CXQ8	Paenibacillus_phage	96.4	2.8e-129
WP_023483965.1|3877465_3879241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144029688.1|3880225_3880483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144029687.1|3880511_3880880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655866.1|3881372_3881765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655864.1|3882343_3882628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585279.1|3882876_3883029_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077585170.1|3883035_3883269_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_036655862.1|3883164_3883377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585169.1|3883347_3883560_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
3887472:3887485	attR	ATCTTTTTATCTGT	NA	NA	NA	NA
