The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	1638	59551	5368065	integrase,holin,terminase,tail	Salmonella_phage(35.38%)	73	14911:14970	56248:56454
WP_071182193.1|1638_1944_-	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	1.7e-14
WP_071182194.1|2028_2967_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	61.8	6.1e-42
WP_157772047.1|2963_3134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|4119_4764_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_032441402.1|4760_4952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071182197.1|4935_5346_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.6	7.3e-16
WP_071182195.1|5538_5883_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.3e-53
WP_032418532.1|6002_6788_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_023285446.1|6784_7552_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|7551_7761_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_023285447.1|7907_8141_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
WP_060617723.1|8295_8877_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.8e-64
WP_104925665.1|9251_9551_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	51.5	1.3e-17
WP_104925666.1|9547_10369_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	82.4	2.0e-134
WP_060596280.1|10365_11247_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.9	7.1e-133
WP_009485476.1|11295_11544_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	70.7	1.0e-28
WP_071182196.1|11653_11947_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	3.0e-32
WP_032439437.1|11939_12098_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	4.3e-17
WP_060617727.1|12094_12688_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	9.6e-110
WP_060617728.1|12684_13455_+	hypothetical protein	NA	D5LH17	Escherichia_phage	52.0	2.7e-64
WP_004200579.1|13451_13643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060617729.1|13659_14910_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	3.1e-206
14911:14970	attL	ATTTCACCCGTGATGCATCATTTTTTCTGACGGTACGAGAGTATACCGTAATGGTAATAC	NA	NA	NA	NA
WP_085838890.1|15227_15710_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	77.5	4.8e-59
WP_085838889.1|15706_16336_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.9	1.6e-91
WP_023339240.1|16325_16631_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_085838888.1|16617_17022_-	hypothetical protein	NA	T1SA79	Salmonella_phage	83.3	6.0e-55
WP_032441389.1|17131_17470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104925675.1|20118_20415_+	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_032422374.1|20700_20997_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	92.7	4.4e-47
WP_085838886.1|21195_23670_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	87.0	0.0e+00
WP_085838885.1|23673_25476_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	76.6	1.4e-249
WP_060617786.1|25472_28286_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	92.6	0.0e+00
WP_032447858.1|28296_28836_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_060617785.1|28835_29300_-	hypothetical protein	NA	Q858G2	Salmonella_phage	80.5	5.8e-70
WP_060617784.1|29299_31777_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.2	0.0e+00
WP_060617783.1|31776_32382_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	1.1e-87
WP_060617782.1|32381_32705_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	3.1e-46
WP_004152442.1|32755_33097_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_020953461.1|33107_33545_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_023301604.1|33598_34585_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	3.3e-179
WP_032441397.1|34599_35280_-	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004152446.1|35282_35579_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441398.1|35575_37258_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
WP_004141368.1|37272_37479_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_071182167.1|38214_39690_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.5	1.3e-280
WP_032457429.1|39686_40271_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
WP_071182168.1|40328_40658_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	5.1e-28
WP_004152765.1|41063_42548_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_071182192.1|42644_42983_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	1.9e-49
WP_071182193.1|42975_43281_-	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	1.7e-14
WP_071182194.1|43365_44304_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	61.8	6.1e-42
WP_157772047.1|44300_44471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|45456_46101_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_032441402.1|46097_46289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071182197.1|46272_46683_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.6	7.3e-16
WP_071182195.1|46875_47220_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.3e-53
WP_032418532.1|47339_48125_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_023285446.1|48121_48889_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|48888_49098_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_023285447.1|49244_49478_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
WP_060617723.1|49632_50214_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.8e-64
WP_104925665.1|50588_50888_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	51.5	1.3e-17
WP_104925666.1|50884_51706_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	82.4	2.0e-134
WP_060596280.1|51702_52584_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.9	7.1e-133
WP_009485476.1|52632_52881_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	70.7	1.0e-28
WP_071182196.1|52990_53284_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	3.0e-32
WP_032439437.1|53276_53435_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	4.3e-17
WP_060617727.1|53431_54025_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	9.6e-110
WP_060617728.1|54021_54792_+	hypothetical protein	NA	D5LH17	Escherichia_phage	52.0	2.7e-64
WP_004200579.1|54788_54980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060617729.1|54996_56247_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	3.1e-206
WP_004151979.1|56439_58017_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
56248:56454	attR	ATTTCACCCGTGATGCATCATTTTTTCTGACGGTACGAGAGTATACCGTAATGGTAATACCGTCAGGTATACCGTCAAAAAATGTGAGATAGAGTGAATAGTGTTGAAGTGATATAAAGAAAAACCCCCTGTAAAAACAGAGGGTTAAATTTCAATTTGAGTAGATATGATTAGCTATAGGGTAGCCGTTAATCATTCCCACTCAAT	NA	NA	NA	NA
WP_004151980.1|58084_59551_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
>prophage 2
NZ_CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	130901	210500	5368065	integrase,plate,tail,tRNA,terminase,portal,lysis,head,capsid,coat	Salmonella_phage(71.43%)	85	175596:175642	212161:212207
WP_002914079.1|130901_131639_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|131770_133102_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|133147_133531_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|133844_134534_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|134591_135677_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|135880_136306_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|136375_137074_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|137108_139760_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|139880_141236_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|141277_141601_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|141604_142903_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|148868_151442_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|151571_152303_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|152299_153280_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|153411_154149_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|154419_154755_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|154861_154909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|155009_156170_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|156166_157039_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|157101_158223_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|158232_159303_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|159645_160155_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|160147_161371_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|161384_161867_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|161875_163246_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|163302_163761_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|163880_164228_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|164267_165035_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|165066_165615_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|165633_165882_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|166141_167506_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|167669_168461_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|168480_169767_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|169886_170477_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|170601_171480_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|171566_173228_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|173375_173717_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|173783_174074_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|174063_174540_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|174650_175133_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
175596:175642	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|175736_176114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|176141_176360_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|176426_177521_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|177517_178003_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|177999_180630_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|180622_180742_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|180756_181056_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|181108_181624_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|181633_182806_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|182954_184028_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_065898403.1|184079_185198_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	2.0e-55
WP_004150990.1|185207_187157_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|187158_187830_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|187822_188731_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|188717_189080_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|189076_189649_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|189743_190610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|190632_191079_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|191071_191494_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150998.1|191589_192018_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|192014_192398_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|192402_192912_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|192892_193108_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|193111_193315_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|193314_193779_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|193874_194528_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|194531_195584_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|195600_196434_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|196574_198338_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|198337_199381_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|199437_199707_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|200227_201229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|201228_202308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|203072_203306_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|203317_203506_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|203668_206053_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|206049_206901_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|206897_207125_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|207124_207358_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|207425_207764_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|207727_207928_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|207935_208445_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|208477_208720_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|208842_209472_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|209474_210500_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
212161:212207	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 3
NZ_CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	929650	978491	5368065	tail,protease,tRNA,terminase,portal,head,capsid	uncultured_Caudovirales_phage(66.67%)	53	NA	NA
WP_002918465.1|929650_930145_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|930148_930787_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|930756_931041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|931098_931491_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|931506_931935_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|932200_933328_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|933518_933917_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|934090_935458_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|935545_936604_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|936740_937679_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|938093_938564_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|938939_939203_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|939301_939568_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918632.1|939972_941940_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|941945_942878_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|942885_943089_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|943220_944150_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|944185_945631_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918644.1|949553_951023_-	ribonuclease G	NA	NA	NA	NA	NA
WP_032441426.1|951025_951607_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|951614_952103_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|952102_953095_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|953165_954209_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|954514_956455_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|956534_956726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|956954_957956_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|957955_958564_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|958787_959240_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|959262_959730_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|959740_961090_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|961200_961443_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|961432_962884_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|962895_963777_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|964134_965100_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|965124_965421_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|965574_965766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|965768_967430_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|967413_967770_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|968045_968489_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|968488_968788_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|968784_969120_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|969116_970358_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|970359_970920_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|970971_972138_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|972401_972914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|972962_973298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|973640_975776_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|975775_976141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|976137_976506_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|976502_976817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|976809_976998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|976990_977260_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|977711_978491_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 4
NZ_CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	2542220	2553874	5368065	integrase	Enterobacteria_phage(70.0%)	13	2530354:2530368	2553411:2553425
2530354:2530368	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|2542220_2544554_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|2544565_2544886_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|2544882_2545110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|2545106_2545664_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|2545660_2545927_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_046181549.1|2546468_2547206_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	61.1	1.4e-73
WP_002889919.1|2547202_2547448_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|2547465_2548032_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|2548600_2549026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|2549025_2549976_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|2549963_2551154_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|2551506_2552760_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|2552770_2553874_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
2553411:2553425	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 5
NZ_CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3225673	3263009	5368065	integrase,plate,tail,terminase,portal,lysis,head,capsid	Salmonella_phage(84.62%)	46	3225581:3225599	3263081:3263099
3225581:3225599	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|3225673_3226726_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_004152765.1|3227144_3228629_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|3228727_3229672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3229683_3230562_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|3230707_3230929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|3230961_3231471_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|3231478_3231679_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|3231642_3231984_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|3232051_3232285_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|3232284_3232512_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|3232508_3233366_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|3233362_3235777_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|3235930_3236119_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|3236129_3236363_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|3236477_3237155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|3237430_3239173_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|3239234_3240260_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|3240259_3242026_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|3242168_3243002_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|3243018_3244077_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|3244080_3244731_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|3244826_3245291_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|3245290_3245494_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|3245497_3245713_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|3245693_3246203_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|3246207_3246591_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|3246587_3247016_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|3247111_3247543_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|3247535_3247982_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|3247978_3248671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|3248765_3249338_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_032441567.1|3249334_3249697_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896182.1|3249683_3250592_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|3250584_3251184_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|3251185_3254137_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|3254140_3254872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|3254868_3255072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|3255101_3256178_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|3256316_3257489_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|3257498_3258014_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|3258066_3258366_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|3258380_3258500_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|3258492_3261120_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|3261116_3261602_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|3261598_3262699_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|3262790_3263009_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
3263081:3263099	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 6
NZ_CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3297425	3306889	5368065	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|3297425_3298541_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|3298537_3300478_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|3300554_3300776_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3301101_3301419_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3301449_3303729_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3303849_3304068_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|3304421_3305123_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|3305167_3306889_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 7
NZ_CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	3676786	3834925	5368065	integrase,tail,holin,protease,terminase,transposase	Klebsiella_phage(24.3%)	182	3760951:3760968	3818125:3818142
WP_002901758.1|3676786_3677833_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|3677880_3678132_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|3678538_3681136_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|3681481_3682456_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|3682701_3682869_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901777.1|3683257_3685930_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|3685976_3686579_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|3686742_3687510_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|3687645_3687954_+	LapA family protein	NA	NA	NA	NA	NA
WP_002901781.1|3687960_3689130_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|3689321_3690059_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|3690058_3690385_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_004151906.1|3690516_3690738_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|3691010_3691760_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|3691831_3692011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|3692169_3694104_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_004151905.1|3694185_3695343_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004140277.1|3695533_3696322_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004152967.1|3696520_3697063_-	HutD family protein	NA	NA	NA	NA	NA
WP_004176464.1|3697259_3698690_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|3698734_3699544_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|3699545_3700538_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|3700537_3701428_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004153574.1|3701604_3702792_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151899.1|3702999_3703662_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|3703658_3704087_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|3704083_3704764_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|3704765_3705053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|3705049_3705895_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|3705910_3706195_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|3706283_3706478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|3706906_3707110_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|3707191_3708268_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_019405077.1|3708413_3708533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201113.1|3708555_3709254_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|3709365_3709593_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|3709633_3709855_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201117.1|3709940_3710801_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_004201118.1|3710797_3711646_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004218528.1|3711642_3711945_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016338361.1|3712192_3713116_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
WP_004218530.1|3713519_3714548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218531.1|3715068_3715536_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243010.1|3715516_3715684_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218532.1|3715680_3716349_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004218533.1|3716341_3716980_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218534.1|3716976_3717117_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004232548.1|3717116_3717806_+	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_024940884.1|3718455_3718755_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004218565.1|3718751_3719291_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|3719287_3719632_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|3719628_3719904_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004218558.1|3720862_3721108_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004218556.1|3721970_3722975_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190663.1|3722952_3724260_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218551.1|3724259_3725660_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_019405022.1|3725643_3726756_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004217351.1|3727286_3728072_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004190653.1|3728082_3729036_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_142689607.1|3729044_3729317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217348.1|3729357_3729753_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004217346.1|3729754_3730009_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004190646.1|3730018_3730252_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|3730238_3730622_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004217343.1|3730623_3731175_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004190640.1|3731171_3731564_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217341.1|3731587_3732760_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004226994.1|3732813_3733296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831940.1|3733433_3733640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|3733716_3734073_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_099119318.1|3734297_3734489_+	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217331.1|3734750_3737648_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_004152648.1|3737731_3738067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152649.1|3738381_3738846_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152650.1|3739026_3739509_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152651.1|3739518_3739899_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152652.1|3739895_3742964_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_022644627.1|3743040_3745995_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152700.1|3745998_3746730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152702.1|3746954_3747554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152703.1|3747795_3749739_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_001067855.1|3749987_3750692_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015057121.1|3750582_3751542_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001261740.1|3751687_3752479_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|3752642_3752990_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3752983_3753823_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|3753950_3754451_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152787.1|3754433_3754574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|3754957_3755722_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|3755898_3756603_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152776.1|3757195_3757618_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004152765.1|3758515_3760000_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|3760079_3760499_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|3760500_3761766_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
3760951:3760968	attL	GCGGCGAAACAGTGGCAG	NA	NA	NA	NA
WP_071531199.1|3761841_3762669_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|3762855_3763527_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_002901816.1|3763731_3764697_-	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002901817.1|3764693_3766337_-	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_004152124.1|3766670_3767576_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004171423.1|3767686_3768517_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152126.1|3768495_3770805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002901900.1|3770976_3772146_+	amidohydrolase	NA	NA	NA	NA	NA
WP_002901901.1|3772171_3773563_+	MFS transporter	NA	NA	NA	NA	NA
WP_002901905.1|3773553_3774528_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901908.1|3774695_3775364_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002901911.1|3775419_3775644_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901913.1|3775643_3776003_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901915.1|3776031_3776250_+	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901917.1|3776352_3777750_+	YcjX family protein	NA	NA	NA	NA	NA
WP_004152127.1|3777746_3778808_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_071531198.1|3778897_3779779_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901977.1|3779910_3781224_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002901979.1|3781396_3782938_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_085666574.1|3783069_3784092_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152131.1|3784162_3784669_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_004152133.1|3784771_3785737_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152134.1|3785733_3786441_-	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004152135.1|3786626_3788243_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152136.1|3788410_3788797_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004152137.1|3789027_3789861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152138.1|3789985_3790870_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152139.1|3791042_3792179_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004218007.1|3792251_3793454_+	MFS transporter	NA	NA	NA	NA	NA
WP_004152141.1|3793532_3794402_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004152142.1|3794569_3794878_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004176439.1|3794948_3795137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152143.1|3795437_3796352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152144.1|3796460_3797222_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|3797438_3798971_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|3799169_3799718_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|3799914_3801096_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|3801076_3801319_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|3801497_3801977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|3801973_3802186_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|3802182_3802407_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|3802396_3803107_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|3803112_3803631_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004152154.1|3803735_3804563_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|3804559_3804754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|3804750_3805176_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|3805172_3805391_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|3805362_3805617_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|3805609_3805975_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|3806144_3806333_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|3806325_3806640_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|3806810_3807479_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|3807576_3807798_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|3808374_3810033_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|3810034_3810997_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|3810993_3811470_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|3811466_3812249_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|3812654_3812903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|3812905_3813436_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|3813432_3813822_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|3814056_3814377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|3814478_3815231_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|3815181_3816582_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|3816819_3818271_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
3818125:3818142	attR	GCGGCGAAACAGTGGCAG	NA	NA	NA	NA
WP_004152174.1|3818326_3818875_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|3818926_3820129_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|3820132_3820627_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|3820638_3821580_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|3821619_3821901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3821869_3822289_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|3822285_3822792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|3822791_3823178_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|3823272_3823713_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|3823716_3824862_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|3824872_3825313_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|3825316_3825742_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|3825777_3825930_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|3825919_3827923_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|3827922_3828522_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|3828522_3828825_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152570.1|3829848_3830190_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|3830239_3830422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|3830464_3831031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|3831084_3831738_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|3831739_3832093_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|3832092_3833289_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|3833285_3834059_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|3834058_3834925_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 8
NZ_CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4062959	4073846	5368065		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|4062959_4063580_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|4063572_4064838_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|4064849_4065752_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|4066012_4066774_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|4066794_4067655_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|4067952_4068213_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|4068299_4069388_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|4069418_4070684_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|4070738_4073846_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 9
NZ_CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	4697806	4761706	5368065	protease,transposase,plate,tRNA	Staphylococcus_phage(18.18%)	56	NA	NA
WP_002910404.1|4697806_4699063_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|4699333_4699945_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004175551.1|4699941_4700793_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|4700976_4701924_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004189412.1|4702048_4703728_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_032441304.1|4703728_4704775_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|4704997_4705273_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|4705545_4706130_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|4706247_4707339_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_032441305.1|4707418_4707748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910453.1|4707831_4708746_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032441306.1|4708877_4710329_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|4710348_4710792_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_021314026.1|4710794_4711337_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004180392.1|4711311_4712358_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032441307.1|4712357_4714121_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032441308.1|4714253_4717664_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004180395.1|4717647_4718805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004180396.1|4718808_4719075_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032441309.1|4719304_4719631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073971751.1|4720056_4720320_-	sulfatase modifying factor 1	NA	NA	NA	NA	NA
WP_014907365.1|4721571_4722465_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	26.8	6.3e-12
WP_004180403.1|4722648_4723539_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.9	2.0e-10
WP_004175515.1|4723560_4723872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046181677.1|4725839_4728326_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032441311.1|4728787_4730485_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004180407.1|4730488_4731142_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032441312.1|4731138_4732479_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_015874926.1|4732716_4732962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|4733189_4734398_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_046181522.1|4734440_4734716_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899028.1|4734785_4735370_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_032435991.1|4735395_4736094_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|4736284_4736767_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_032441313.1|4736876_4737776_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019705158.1|4737750_4738557_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032441314.1|4738571_4739867_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_032441315.1|4740170_4741097_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|4741197_4741674_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004148802.1|4741723_4743367_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|4743650_4744544_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175491.1|4744549_4745269_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_032441316.1|4745265_4746141_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_032441317.1|4746137_4747424_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004175489.1|4747433_4748348_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_009484368.1|4748457_4749573_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032441445.1|4750003_4752298_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.1e-158
WP_029602072.1|4752326_4753535_-	propionate kinase	NA	NA	NA	NA	NA
WP_004200322.1|4753562_4754894_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_032441318.1|4754919_4755909_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_002910764.1|4756002_4756944_-	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_032441319.1|4757561_4757684_+	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_032441320.1|4757721_4758522_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_050491795.1|4758514_4759528_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_014343226.1|4759656_4760514_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_015958643.1|4760962_4761706_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP018885	Klebsiella pneumoniae subsp. pneumoniae strain BR21 chromosome, complete genome	5368065	5015296	5022201	5368065	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_019705218.1|5015296_5016775_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|5016771_5017494_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|5017812_5019174_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|5019419_5020313_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004899467.1|5020553_5021327_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004180551.1|5021337_5022201_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 1
NZ_CP018886	Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence	217456	10223	68428	217456	protease,integrase,transposase	uncultured_Caudovirales_phage(29.41%)	53	1966:1980	21993:22007
1966:1980	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_001515717.1|10223_10964_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|12107_13055_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|13081_13393_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|13457_14381_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|15053_15311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|15912_17367_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|18349_19627_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|19689_21687_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_065883986.1|23945_24914_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	4.7e-13
21993:22007	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_077255487.1|24923_25100_-|transposase	transposase	transposase	Q76S41	Shigella_phage	63.5	3.9e-11
WP_004178091.1|26528_26960_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|27210_28686_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|28678_29359_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|29548_30934_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|30962_31316_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|31429_32722_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|32732_35879_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|35965_36406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|36532_38980_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|39020_39218_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|39251_39989_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|40277_40727_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|40960_42778_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|42777_43674_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|43713_44094_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|44098_45028_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|45082_45763_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|45759_47160_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|47376_47811_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|48042_48222_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|49964_50474_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|50523_51021_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|51352_51679_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|51678_52389_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|52397_52943_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|53018_53381_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|55277_55814_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|55846_56272_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|56284_57574_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|57621_59373_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|59390_59753_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|59802_60153_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|60510_60780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|60767_61343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|61373_61868_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|61911_62280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|62313_62517_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|62565_62823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|62898_63153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|63328_63595_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|63582_64065_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|64276_65623_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|67465_68428_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP018886	Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence	217456	73915	144564	217456	integrase,transposase,bacteriocin	Escherichia_phage(26.32%)	53	88240:88256	139506:139522
WP_004118209.1|73915_74179_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|75380_76361_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|77569_78439_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|78432_79443_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|79451_80279_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|80287_81151_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|81147_81975_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|82830_83535_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044117068.1|84838_85507_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000018329.1|85696_86512_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067834.1|86662_87367_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000219391.1|87488_88394_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
88240:88256	attL	ATGAAGCGGCCGGTGGC	NA	NA	NA	NA
WP_000004159.1|88390_89629_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|89628_90213_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|90705_91470_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|91696_92002_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|92012_93218_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|93373_93577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|93704_94544_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|94537_94885_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_004199413.1|95292_98310_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_020956879.1|98439_98826_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004152557.1|98822_99170_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_004118832.1|102992_104726_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|104733_105681_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_046181586.1|105725_107330_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|107342_108263_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152279.1|108262_109111_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|109107_109701_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|109697_110825_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|111109_111277_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118235.1|112379_112901_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004152280.1|114713_117038_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|117082_117985_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|117981_118980_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004152281.1|118976_119933_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|119933_120701_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|120799_121093_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|121423_121666_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|121963_122968_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004152284.1|123371_124382_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004152286.1|124842_125925_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152287.1|126046_129121_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|129172_130426_+	lactose permease	NA	NA	NA	NA	NA
WP_004152290.1|132131_134441_+	ATPase	NA	NA	NA	NA	NA
WP_004152291.1|134444_135761_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000093087.1|135757_137953_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152292.1|139399_140257_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
139506:139522	attR	ATGAAGCGGCCGGTGGC	NA	NA	NA	NA
WP_004171457.1|140249_140327_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|140543_140822_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004152294.1|141142_141694_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
WP_004152296.1|141962_142241_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004178051.1|142242_144564_-|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP018887	Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncN, complete sequence	123208	12072	103045	123208	transposase,integrase,protease	Escherichia_phage(29.63%)	89	19623:19682	110735:110750
WP_001452808.1|12072_12864_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_016359298.1|12878_13220_-	regulatory DNA-binding protein repressor	NA	NA	NA	NA	NA
WP_013263795.1|13779_14499_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	30.0	1.3e-20
WP_020324153.1|16459_17935_+	hypothetical protein	NA	NA	NA	NA	NA
19623:19682	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|19674_20379_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
19623:19682	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_019725033.1|21468_21663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725034.1|21706_21937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725040.1|21950_22154_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_015065502.1|22187_22556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310053.1|22599_23094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065504.1|23124_23697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725036.1|23693_23942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058650054.1|24508_24853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338367.1|24960_25596_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016338368.1|25595_27704_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
WP_016338369.1|27693_28971_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_048983057.1|30547_30964_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261276.1|30960_31191_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004153649.1|31853_32060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|32105_32414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|32441_32771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|32838_33195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|33201_33534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|33533_34316_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|35207_35438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152341.1|35529_36003_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152342.1|36122_37391_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152343.1|37395_40653_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_004152344.1|40653_41970_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_004152345.1|41966_43994_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|44105_44321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|44545_44878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|45254_46229_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|46225_47431_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|47752_48649_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|49049_50321_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|50320_50752_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_072207385.1|50983_51955_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_049193275.1|51957_52629_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_009309993.1|52689_52920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|53356_54058_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568042.1|54057_54279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|54288_54708_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_157669235.1|54761_55046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|55032_56046_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_064141398.1|56204_56678_+	trimethoprim-resistant dihydrofolate reductase DfrA	NA	G3MBI7	Bacillus_virus	30.7	8.7e-13
WP_064161975.1|56861_57194_+	quaternary ammonium compound efflux SMR transporter QacE	NA	NA	NA	NA	NA
WP_003155741.1|57442_58066_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	3.7e-35
WP_001067855.1|58125_58830_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|60451_60694_+	hypothetical protein	NA	NA	NA	NA	NA
58074:58894	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCA	NA	NA	NA	NA
WP_000164043.1|60725_61376_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
58074:58894	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCA	NA	NA	NA	NA
WP_000804064.1|61481_62681_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|62712_63597_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|63734_64127_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000509965.1|64903_65509_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_004199413.1|66681_69699_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_003155746.1|70350_71259_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_006122485.1|71255_72473_+	TniQ family protein	NA	NA	NA	NA	NA
WP_001067855.1|72598_73303_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|73934_74765_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|74895_75450_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|75593_76298_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016338383.1|77440_78874_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.2	7.0e-106
WP_001749967.1|79255_79462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045325216.1|79466_79853_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_016338361.1|79948_80872_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
WP_013279382.1|81228_81540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016338363.1|81575_81890_-	KikA	NA	NA	NA	NA	NA
WP_012561155.1|81886_82231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071562618.1|82246_82597_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_013279384.1|82660_83398_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_016338364.1|83406_83688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|83697_83991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496058.1|84041_84359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561149.1|84358_86959_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_001749960.1|86976_87690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749959.1|87697_87925_+	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_001749958.1|87940_88981_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000646594.1|89199_89898_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_019706045.1|89971_90793_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000101710.1|90792_91953_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_012561144.1|91994_92990_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_016359293.1|92989_93169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|93445_94765_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|95014_95896_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|96282_97062_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|97058_98084_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|98190_101220_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|101329_103045_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
110735:110750	attR	TCGCGCAGTGGGCCAA	NA	NA	NA	NA
