The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	296470	303375	5309490	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|296470_297334_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|297344_298118_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|298358_299252_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|299497_300859_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|301177_301900_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_019705218.1|301896_303375_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
NZ_CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	557742	609204	5309490	plate,protease,transposase	Staphylococcus_phage(18.18%)	43	NA	NA
WP_015958643.1|557742_558486_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_014343226.1|558934_559792_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_050491795.1|559920_560934_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032441320.1|560926_561727_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_032441319.1|561764_561887_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_002910764.1|562504_563446_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_032441318.1|563539_564529_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004200322.1|564554_565886_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_029602072.1|565913_567122_+	propionate kinase	NA	NA	NA	NA	NA
WP_032441445.1|567150_569445_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.1e-158
WP_009484368.1|569875_570991_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|571100_572015_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032441317.1|572024_573311_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032441316.1|573307_574183_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|574179_574899_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|574904_575798_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004148802.1|576081_577725_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|577774_578251_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032441315.1|578351_579278_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032441314.1|579581_580877_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_019705158.1|580891_581698_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032441313.1|581672_582572_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|582681_583164_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_032435991.1|583354_584053_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|584078_584663_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_046181522.1|584732_585008_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001352368.1|585050_586259_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_015874926.1|586486_586732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441312.1|586969_588310_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004180407.1|588306_588960_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032441311.1|588963_590661_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016338361.1|591373_592297_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
WP_004180403.1|596976_597867_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.9	2.0e-10
WP_014907365.1|598050_598944_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	26.8	6.3e-12
WP_015874922.1|599119_600013_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	5.7e-13
WP_073971751.1|600196_600460_+	sulfatase modifying factor 1	NA	NA	NA	NA	NA
WP_020323962.1|600456_600696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441309.1|600884_601211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004180396.1|601440_601707_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004180395.1|601710_602868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441308.1|602851_606262_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032441307.1|606394_608158_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004180392.1|608157_609204_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	1246666	1257553	5309490		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|1246666_1249774_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|1249828_1251094_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|1251124_1252213_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|1252299_1252560_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|1252857_1253718_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|1253738_1254500_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|1254760_1255663_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|1255674_1256940_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|1256932_1257553_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	1485589	1643664	5309490	tail,holin,protease,terminase,transposase,integrase	Klebsiella_phage(24.3%)	182	1478128:1478145	1630156:1630173
1478128:1478145	attL	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
WP_004152576.1|1485589_1486456_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|1486455_1487229_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|1487225_1488422_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|1488421_1488775_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|1488776_1489430_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|1489483_1490050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|1490092_1490275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|1490324_1490666_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|1490665_1491688_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|1491690_1491993_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|1491993_1492593_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|1492592_1494596_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|1494585_1494738_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|1494773_1495199_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|1495202_1495643_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|1495653_1496799_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|1496802_1497243_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|1497337_1497724_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|1497723_1498230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|1498226_1498646_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|1498614_1498896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|1498935_1499877_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|1499888_1500383_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|1500386_1501589_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|1501640_1502189_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|1502244_1503696_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|1503933_1505334_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|1505284_1506037_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|1506138_1506459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|1506693_1507083_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|1507079_1507610_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|1507612_1507861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|1508266_1509049_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|1509045_1509522_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|1509518_1510481_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|1510482_1512141_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|1512717_1512939_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|1513036_1513705_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|1513875_1514190_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|1514182_1514371_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|1514540_1514906_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|1514898_1515153_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|1515124_1515343_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|1515339_1515765_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|1515761_1515956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|1515952_1516780_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|1516884_1517403_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|1517408_1518119_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|1518108_1518333_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|1518329_1518542_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|1518538_1519018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|1519196_1519439_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|1519419_1520601_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|1520797_1521346_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152145.1|1521544_1523077_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|1523293_1524055_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152143.1|1524163_1525078_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176439.1|1525378_1525567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152142.1|1525637_1525946_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152141.1|1526113_1526983_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004218007.1|1527061_1528264_-	MFS transporter	NA	NA	NA	NA	NA
WP_004152139.1|1528336_1529473_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004152138.1|1529645_1530530_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152137.1|1530654_1531488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152136.1|1531718_1532105_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004152135.1|1532272_1533889_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152134.1|1534074_1534782_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004152133.1|1534778_1535744_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152131.1|1535846_1536353_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_085666574.1|1536423_1537446_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901979.1|1537577_1539119_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_002901977.1|1539291_1540605_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_071531198.1|1540736_1541618_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152127.1|1541707_1542769_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002901917.1|1542765_1544163_-	YcjX family protein	NA	NA	NA	NA	NA
WP_002901915.1|1544265_1544484_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901913.1|1544512_1544872_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901911.1|1544871_1545096_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901908.1|1545151_1545820_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002901905.1|1545987_1546962_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901901.1|1546952_1548344_-	MFS transporter	NA	NA	NA	NA	NA
WP_002901900.1|1548369_1549539_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004152126.1|1549710_1552020_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004171423.1|1551998_1552829_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152124.1|1552939_1553845_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002901817.1|1554178_1555822_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_002901816.1|1555818_1556784_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002901815.1|1556988_1557660_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|1557846_1558674_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|1558749_1560015_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|1560016_1560436_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|1560515_1562000_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|1562897_1563320_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|1563912_1564617_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|1564793_1565558_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004152787.1|1565941_1566082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|1566064_1566565_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|1566692_1567532_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|1567525_1567873_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|1568036_1568828_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_015057121.1|1568973_1569933_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|1569823_1570528_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|1570712_1572656_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|1572897_1573497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|1573721_1574453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|1574456_1577411_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|1577487_1580556_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|1580552_1580933_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|1580942_1581425_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152649.1|1581605_1582070_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|1582384_1582720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217331.1|1582803_1585701_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|1585962_1586154_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|1586378_1586735_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|1586811_1587018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|1587155_1587638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|1587691_1588864_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|1588887_1589280_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|1589276_1589828_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|1589829_1590213_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|1590199_1590433_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|1590442_1590697_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|1590698_1591094_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_142689607.1|1591134_1591407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190653.1|1591415_1592369_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|1592379_1593165_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|1593695_1594808_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|1594791_1596192_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|1596191_1597499_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|1597476_1598481_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|1599343_1599589_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|1600547_1600823_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|1600819_1601164_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|1601160_1601700_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|1601696_1601996_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004232548.1|1602645_1603335_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|1603334_1603475_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|1603471_1604110_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|1604102_1604771_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|1604767_1604935_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|1604915_1605383_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|1605903_1606932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338361.1|1607335_1608259_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
WP_004218528.1|1608506_1608809_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|1608805_1609654_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_001548453.1|1610595_1610817_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|1610857_1611085_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|1611196_1611895_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|1611917_1612037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|1612182_1613259_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|1613340_1613544_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|1613972_1614167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|1614255_1614540_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|1614555_1615401_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|1615397_1615685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|1615686_1616367_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|1616363_1616792_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|1616788_1617451_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|1617658_1618846_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|1619022_1619913_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|1619912_1620905_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|1620906_1621716_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004176464.1|1621760_1623191_-	cytosine permease	NA	NA	NA	NA	NA
WP_004152967.1|1623387_1623930_+	HutD family protein	NA	NA	NA	NA	NA
WP_004140277.1|1624128_1624917_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004151905.1|1625107_1626265_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002901787.1|1626346_1628281_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_002901786.1|1628439_1628619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901785.1|1628690_1629440_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004151906.1|1629712_1629934_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901782.1|1630065_1630392_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
1630156:1630173	attR	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
WP_004151907.1|1630391_1631129_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901781.1|1631320_1632490_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_002901780.1|1632496_1632805_-	LapA family protein	NA	NA	NA	NA	NA
WP_002901779.1|1632940_1633708_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901778.1|1633871_1634474_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901777.1|1634520_1637193_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901776.1|1637581_1637749_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901772.1|1637994_1638969_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901763.1|1639314_1641912_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|1642318_1642570_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|1642617_1643664_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 5
NZ_CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	2002605	2095556	5309490	capsid,tail,tRNA,plate,protease,portal,terminase,head,integrase,lysis	Salmonella_phage(56.9%)	93	2058131:2058149	2095631:2095649
WP_002898139.1|2002605_2003898_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|2003988_2005332_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|2005340_2005952_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|2006074_2010328_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|2010463_2010958_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|2011463_2012459_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|2012573_2014340_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|2014340_2016062_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|2016106_2016808_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2017161_2017380_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2017500_2019780_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|2019810_2020128_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2020453_2020675_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|2020751_2022692_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|2022688_2023804_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|2023950_2025609_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|2026028_2026724_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|2026839_2027739_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|2027882_2029535_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|2029545_2030514_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|2030725_2031160_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|2031311_2033030_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|2033068_2034070_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|2034080_2035523_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|2035610_2036624_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|2036620_2037451_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|2037482_2038622_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|2039499_2040015_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|2040241_2040970_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|2040990_2041722_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|2041728_2042445_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|2042444_2043113_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|2043296_2044028_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|2044070_2045543_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|2045539_2046256_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|2046334_2047462_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|2047503_2047992_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|2048049_2048895_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|2048891_2049845_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|2049855_2050989_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|2051152_2052265_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|2052613_2053093_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|2053181_2054084_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|2054905_2055193_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|2055395_2055659_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|2055665_2056049_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|2056315_2058001_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
2058131:2058149	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|2058220_2058439_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|2058530_2059631_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|2059627_2060113_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|2060109_2062737_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|2062729_2062849_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|2062863_2063163_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|2063215_2063731_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|2063740_2064913_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|2065051_2066128_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|2066157_2066361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|2066357_2067089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|2067092_2070044_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|2070045_2070645_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|2070637_2071546_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|2071532_2071895_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|2071891_2072464_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|2072558_2073251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|2073247_2073694_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|2073686_2074118_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|2074213_2074642_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|2074638_2075022_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|2075026_2075536_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|2075516_2075732_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|2075735_2075939_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|2075938_2076403_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|2076498_2077149_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|2077152_2078211_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|2078227_2079061_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|2079203_2080970_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|2080969_2081995_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|2082056_2083799_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|2084074_2084752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2084866_2085100_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|2085110_2085299_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|2085452_2087867_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|2087863_2088721_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|2088717_2088945_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|2088944_2089178_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|2089245_2089587_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|2089550_2089751_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|2089758_2090268_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|2090300_2090522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|2090667_2091546_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|2091557_2092502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|2092600_2094085_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|2094503_2095556_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
2095631:2095649	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 6
NZ_CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	2767355	2779009	5309490	integrase	Enterobacteria_phage(70.0%)	13	2767805:2767819	2790862:2790876
WP_004144574.1|2767355_2768459_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
2767805:2767819	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|2768469_2769723_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|2770075_2771266_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|2771253_2772204_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|2772203_2772629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|2773197_2773764_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|2773781_2774027_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_046181549.1|2774023_2774761_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	61.1	1.4e-73
WP_002889915.1|2775302_2775569_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|2775565_2776123_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|2776119_2776347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|2776343_2776664_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|2776675_2779009_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
2790862:2790876	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 7
NZ_CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	4312599	4345857	5309490	capsid,tail,tRNA,protease,portal,terminase,head,integrase	uncultured_Caudovirales_phage(73.33%)	33	4330207:4330224	4346202:4346219
WP_002919147.1|4312599_4313547_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|4313561_4314071_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|4314199_4315324_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|4315295_4315769_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|4315794_4316337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|4316341_4316914_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|4316917_4317736_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|4317732_4317990_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|4317965_4318520_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|4324315_4324537_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|4324830_4327941_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|4327953_4329093_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|4329471_4330122_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
4330207:4330224	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|4330397_4331624_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|4331716_4332658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|4332839_4333124_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|4333134_4333914_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|4334365_4334635_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|4334627_4334816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|4334808_4335123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4335119_4335488_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|4335484_4335850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4335849_4337985_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|4338327_4338663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|4338711_4339224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|4339487_4340654_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|4340705_4341266_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|4341267_4342509_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|4342505_4342841_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|4342837_4343137_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|4343136_4343580_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|4343855_4344212_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|4344195_4345857_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
4346202:4346219	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 8
NZ_CP018883	Klebsiella pneumoniae subsp. pneumoniae strain BR7 chromosome, complete genome	5309490	5103245	5149479	5309490	capsid,coat,tail,tRNA,plate,portal,terminase,head,integrase,lysis	Salmonella_phage(83.33%)	59	5101539:5101585	5138105:5138151
5101539:5101585	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|5103245_5104271_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|5104273_5104903_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|5105025_5105268_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|5105300_5105810_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|5105817_5106018_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|5105981_5106320_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|5106387_5106621_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|5106620_5106848_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|5106844_5107696_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|5107692_5110077_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|5110239_5110428_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|5110439_5110673_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|5110768_5111452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|5111438_5112518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|5112517_5113519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|5114039_5114309_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|5114365_5115409_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|5115408_5117172_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|5117312_5118146_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|5118162_5119215_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|5119218_5119872_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|5119967_5120432_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|5120431_5120635_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|5120638_5120854_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|5120834_5121344_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|5121348_5121732_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|5121728_5122157_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|5122252_5122675_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|5122667_5123114_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|5123136_5124003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|5124097_5124670_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|5124666_5125029_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|5125015_5125924_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|5125916_5126588_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|5126589_5128539_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_065898403.1|5128548_5129667_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	2.0e-55
WP_004150988.1|5129718_5130792_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|5130940_5132113_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|5132122_5132638_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|5132690_5132990_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|5133004_5133124_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|5133116_5135747_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|5135743_5136229_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|5136225_5137320_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|5137386_5137605_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|5137632_5138010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|5138613_5139096_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
5138105:5138151	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|5139206_5139683_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|5139672_5139963_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|5140029_5140371_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|5140518_5142180_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|5142266_5143145_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|5143269_5143860_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|5143979_5145266_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|5145285_5146077_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|5146240_5147605_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|5147864_5148113_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|5148131_5148680_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|5148711_5149479_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP018884	Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence	121863	0	61284	121863	transposase,protease,integrase	Escherichia_phage(30.0%)	65	3633:3647	17187:17201
3633:3647	attL	GTGAAAAGCAGAAAA	NA	NA	NA	NA
WP_004152341.1|3698_4172_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|4263_4494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|5385_6168_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|6167_6500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|6506_6863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|6930_7260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|7287_7596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|7641_7848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261276.1|8510_8741_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048983057.1|8737_9154_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016338369.1|10730_12008_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016338368.1|11997_14106_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
WP_016338367.1|14105_14741_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_058650054.1|14848_15193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725036.1|15759_16008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065504.1|16004_16577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310053.1|16607_17102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065502.1|17145_17514_+	hypothetical protein	NA	NA	NA	NA	NA
17187:17201	attR	TTTTCTGCTTTTCAC	NA	NA	NA	NA
WP_019725040.1|17547_17751_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_019725034.1|17764_17995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725033.1|18038_18233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065592.1|18423_19956_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_019725650.1|20268_20592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725651.1|20664_21660_-	hypothetical protein	NA	A0A2H4UVR4	Bodo_saltans_virus	34.9	2.1e-32
WP_015065500.1|21956_22607_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.6	1.8e-77
WP_001695382.1|22653_22995_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	50.0	3.4e-19
WP_001067855.1|23107_23812_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000412211.1|23931_24591_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000971921.1|26073_27444_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000080861.1|27558_28695_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|28745_28991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|28996_29188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|29669_30212_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|30224_31085_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000027057.1|31266_32127_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|32309_32867_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|33430_34693_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|34948_35824_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|35870_36203_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|38524_39229_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000101710.1|40076_41237_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_019706045.1|41236_42058_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000646594.1|42131_42830_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001749958.1|43048_44089_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001749959.1|44104_44332_-	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_001749960.1|44339_45053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561149.1|45070_47671_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_000496058.1|47670_47988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|48038_48332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016338364.1|48341_48623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013279384.1|48631_49369_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_071562618.1|49432_49783_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_012561155.1|49798_50143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338363.1|50139_50454_+	KikA	NA	NA	NA	NA	NA
WP_013279382.1|50489_50801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338361.1|51158_52082_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
WP_045325216.1|52177_52564_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|52568_52775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338383.1|53156_54590_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.2	7.0e-106
WP_001067855.1|55172_55877_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016359293.1|56189_56369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|56645_57965_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|58214_59096_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|59482_60262_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|60258_61284_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
>prophage 2
NZ_CP018884	Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence	121863	66269	98070	121863	transposase,integrase	Escherichia_phage(20.0%)	32	57812:57829	93431:93448
57812:57829	attL	CCGCCGGCGCAAGTCGAT	NA	NA	NA	NA
WP_094387719.1|66269_66734_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	36.2	1.9e-20
WP_000091613.1|66906_67221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|67475_67832_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|67821_68223_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|68219_68510_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_012561143.1|68573_68972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|69661_70366_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004199413.1|71155_74173_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_061091600.1|74224_75199_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_014386481.1|75293_75938_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_004199413.1|76117_79135_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_003155746.1|79786_80695_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_006122485.1|80691_81909_+	TniQ family protein	NA	NA	NA	NA	NA
WP_003155741.1|81970_82594_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	3.7e-35
WP_064161975.1|82842_83175_-	quaternary ammonium compound efflux SMR transporter QacE	NA	NA	NA	NA	NA
WP_064141398.1|83358_83832_-	trimethoprim-resistant dihydrofolate reductase DfrA	NA	G3MBI7	Bacillus_virus	30.7	8.7e-13
WP_000845048.1|83990_85004_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_157669235.1|84990_85275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|85328_85748_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|85757_85979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|85978_86680_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_009309993.1|87116_87347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049193275.1|87407_88079_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_072207385.1|88081_89053_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152352.1|89284_89716_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152351.1|89715_90987_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152350.1|91387_92284_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152349.1|92605_93811_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
93431:93448	attR	CCGCCGGCGCAAGTCGAT	NA	NA	NA	NA
WP_004152348.1|93807_94782_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152347.1|95158_95491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227314.1|95715_95931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152345.1|96042_98070_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 3
NZ_CP018884	Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence	121863	102645	106503	121863	transposase,integrase	Burkholderia_virus(50.0%)	4	96287:96302	114832:114847
96287:96302	attL	ACAACACCTCTGAATA	NA	NA	NA	NA
WP_004152342.1|102645_103914_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|104033_104507_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|104598_104829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|105720_106503_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
114832:114847	attR	TATTCAGAGGTGTTGT	NA	NA	NA	NA
>prophage 4
NZ_CP018884	Klebsiella pneumoniae subsp. pneumoniae strain BR7 plasmid unnamed1, complete sequence	121863	112332	114441	121863		Bacillus_phage(100.0%)	1	NA	NA
WP_016338368.1|112332_114441_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
