The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012673	Sorangium cellulosum strain So ce26 chromosome, complete genome	14557589	225827	288870	14557589	transposase,protease	Acidithiobacillus_phage(28.57%)	30	NA	NA
WP_104976866.1|225827_227510_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	48.9	1.5e-139
WP_104976867.1|227400_228159_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.9	1.4e-52
WP_104976868.1|228695_230024_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.9	1.4e-28
WP_159396523.1|230767_231196_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159396524.1|231203_231560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159396525.1|231667_232216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104976872.1|232464_233235_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.8	3.6e-32
WP_104976873.1|233218_234760_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	29.2	3.1e-27
WP_159398107.1|235579_236398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104986952.1|236295_237702_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.6	4.6e-33
WP_159396526.1|237918_239274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159396527.1|239810_243017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159396528.1|243391_244450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159396529.1|246950_248981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976880.1|249007_250198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976881.1|250194_251577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976882.1|251644_255388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976883.1|255460_256954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159396530.1|257055_259263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159396531.1|259276_260410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159396532.1|260484_266940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159396533.1|267466_273949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159396534.1|274147_280543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104986954.1|280756_280990_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_159396535.1|281541_281826_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_104976891.1|281714_283832_-	recombinase family protein	NA	NA	NA	NA	NA
WP_104976892.1|284304_285894_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_159396536.1|286399_286750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159396537.1|286782_286950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976895.1|287928_288870_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	29.6	4.6e-21
>prophage 2
NZ_CP012673	Sorangium cellulosum strain So ce26 chromosome, complete genome	14557589	7455598	7538201	14557589	transposase,integrase,protease	Liberibacter_phage(15.38%)	56	7447011:7447031	7476866:7476886
7447011:7447031	attL	TGCTCGCCGACCTCGCCGCGC	NA	NA	NA	NA
WP_104982550.1|7455598_7457020_-|protease	26S protease regulatory subunit	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	28.6	2.2e-19
WP_104982551.1|7458450_7458885_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_104982552.1|7459205_7459922_-	DUF1109 domain-containing protein	NA	NA	NA	NA	NA
WP_159397330.1|7459908_7460514_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_104982554.1|7460874_7461972_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A2K9V9Q5	Bandra_megavirus	39.8	1.8e-16
WP_104982555.1|7462089_7463121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159397331.1|7463035_7464424_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	28.4	2.0e-12
WP_104982557.1|7464586_7465735_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_104982558.1|7465860_7468452_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_104982559.1|7469632_7473553_+	Rhs family carbohydrate-binding protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	5.9e-14
WP_104982560.1|7473549_7474455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104987467.1|7474676_7476149_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJP8	Virus_Rctr16k	49.7	1.7e-83
WP_104982561.1|7476518_7477280_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.4	9.4e-33
7476866:7476886	attR	GCGCGGCGAGGTCGGCGAGCA	NA	NA	NA	NA
WP_104982562.1|7477276_7478764_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.1	3.6e-28
WP_104987468.1|7479613_7479973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159397332.1|7480830_7480977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104982563.1|7481460_7481901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104982564.1|7481897_7482683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104982565.1|7482679_7483249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159397333.1|7483269_7483422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159397334.1|7483497_7483914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159397335.1|7484392_7485316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104982568.1|7485333_7486899_-	protein kinase	NA	NA	NA	NA	NA
WP_104982569.1|7486892_7487849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104982570.1|7488362_7489070_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_104982571.1|7489066_7492318_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.1	1.6e-60
WP_159397336.1|7492314_7493436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104982573.1|7493617_7496026_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	37.1	8.6e-72
WP_104982574.1|7496644_7496875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104982576.1|7497411_7498335_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_104982577.1|7498348_7499050_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_159397337.1|7499423_7499741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159397338.1|7500033_7503969_-	AAA family ATPase	NA	A0A0U1YWE1	Anatid_alphaherpesvirus	33.7	3.2e-07
WP_104982579.1|7504196_7505462_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_104982580.1|7505464_7505911_-	response regulator	NA	NA	NA	NA	NA
WP_159397339.1|7505972_7510934_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_104982582.1|7511611_7513258_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	23.1	7.5e-19
WP_104982583.1|7513456_7514278_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_104982584.1|7514281_7516510_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_104982585.1|7517110_7517779_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_159397340.1|7517988_7518246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104982587.1|7518349_7518676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104982588.1|7518998_7519487_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_159397341.1|7519473_7519728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104982589.1|7519724_7521065_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_104982590.1|7521671_7522337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104982591.1|7522548_7522797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159397342.1|7523181_7528635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104982594.1|7528915_7529776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104982595.1|7529802_7530234_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_104982596.1|7530226_7530613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104982597.1|7531088_7533626_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	46.0	4.1e-16
WP_104982598.1|7533901_7534225_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_104987469.1|7534227_7536642_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.7	2.8e-163
WP_104987470.1|7536610_7536994_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_104987471.1|7537325_7538201_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP012673	Sorangium cellulosum strain So ce26 chromosome, complete genome	14557589	13023021	13057472	14557589	transposase,protease	Escherichia_phage(25.0%)	18	NA	NA
WP_104985985.1|13023021_13024563_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	29.2	3.1e-27
WP_104987859.1|13026641_13027763_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_159397961.1|13027827_13028724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104985987.1|13028752_13030303_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.6	2.1e-07
WP_159397962.1|13030579_13033054_+	PAS domain S-box protein	NA	A0A1B0VMK3	Pseudomonas_phage	33.3	1.5e-18
WP_104985989.1|13033260_13034106_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_104985990.1|13034190_13035696_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_104985991.1|13035812_13038380_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.1	1.2e-18
WP_104985992.1|13038452_13038809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104985993.1|13038899_13040276_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_104985994.1|13040536_13042174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159397963.1|13042401_13044450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104985996.1|13044517_13046974_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_159397964.1|13050613_13051783_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_104987860.1|13052444_13053437_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159397965.1|13055320_13055968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159397966.1|13055967_13056282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159397967.1|13056302_13057472_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP012673	Sorangium cellulosum strain So ce26 chromosome, complete genome	14557589	13492898	13586376	14557589	transposase,protease	Emiliania_huxleyi_virus(14.29%)	48	NA	NA
WP_104986284.1|13492898_13493720_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_159397997.1|13494492_13495320_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_104986286.1|13495440_13496262_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_159397998.1|13496318_13497146_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_104986288.1|13497292_13498114_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_159397999.1|13498148_13498970_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_159398000.1|13499371_13500199_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_159398001.1|13500452_13501280_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_104986292.1|13501385_13502207_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_104986293.1|13502378_13503200_+|protease	trypsin-like serine protease	protease	V5LP49	Emiliania_huxleyi_virus	27.4	4.0e-05
WP_104986294.1|13503704_13504307_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104986295.1|13504428_13506288_+	MFS transporter	NA	NA	NA	NA	NA
WP_104986296.1|13506456_13507836_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_104986297.1|13508006_13508681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104986298.1|13508931_13509444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104985559.1|13510747_13512172_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_104986299.1|13513465_13513897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104986300.1|13513928_13516448_-	DUF1308 domain-containing protein	NA	NA	NA	NA	NA
WP_104986301.1|13516675_13517044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104986302.1|13524415_13525672_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_104986303.1|13525715_13536305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104987887.1|13537041_13537983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104986304.1|13538025_13539264_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_104987888.1|13540612_13544206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104986305.1|13544273_13547666_+	protein kinase	NA	Q64993	Rous_sarcoma_virus	29.4	1.3e-17
WP_104986306.1|13549537_13550518_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_104986307.1|13551431_13560854_+	Rhs family carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_104986308.1|13560850_13561240_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_104986309.1|13561254_13561551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159398002.1|13561559_13562036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159398003.1|13562191_13563610_+	hypothetical protein	NA	S5VY91	Leptospira_phage	32.6	3.0e-08
WP_159398004.1|13563669_13564227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159398005.1|13564277_13565009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104986312.1|13565594_13566614_+	epimerase	NA	NA	NA	NA	NA
WP_104987889.1|13566710_13567397_-	superoxide dismutase family protein	NA	Q80LJ0	Adoxophyes_honmai_nucleopolyhedrovirus	44.0	2.9e-17
WP_159398006.1|13567593_13568574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104987890.1|13568757_13569888_-	adenylate/guanylate cyclase domain-containing response regulator	NA	A0A220YL79	Alteromonas_virus	33.9	1.6e-12
WP_104986315.1|13569922_13571587_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	31.4	5.4e-41
WP_104986316.1|13571782_13572979_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_104986317.1|13572975_13573776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104986318.1|13573784_13575491_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_104986319.1|13575589_13576795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104986320.1|13576913_13577102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104986321.1|13577425_13580599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104986322.1|13581060_13581444_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_104986323.1|13581742_13582993_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_104986324.1|13582989_13583325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104986325.1|13583637_13586376_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	37.2	1.4e-94
