The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	1547301	1555502	3871930		uncultured_Caudovirales_phage(71.43%)	10	NA	NA
WP_000213576.1|1547301_1547736_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.8	1.8e-41
WP_000373081.1|1547791_1548115_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.0	7.0e-22
WP_000670222.1|1548121_1548595_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.3	2.1e-35
WP_000068659.1|1548602_1549643_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_001052988.1|1549647_1550352_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	1.3e-92
WP_001191833.1|1550370_1551324_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	7.8e-61
WP_000080830.1|1551429_1552497_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	59.2	7.8e-94
WP_000835372.1|1552790_1553609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770669.1|1554016_1554289_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_000394712.1|1554278_1555502_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A222YXG1	Escherichia_phage	47.1	4.1e-22
>prophage 2
NZ_CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	2034720	2044829	3871930		Acinetobacter_phage(94.12%)	21	NA	NA
WP_000004579.1|2034720_2035443_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
WP_000147323.1|2035439_2035847_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000654848.1|2035847_2036099_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.7	1.1e-38
WP_000067520.1|2036100_2037060_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	93.7	1.5e-165
WP_002101466.1|2037074_2037842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181041.1|2037853_2038177_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	82.2	2.6e-45
WP_001101026.1|2038179_2038620_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	96.6	1.3e-74
WP_000862386.1|2038840_2039122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000212394.1|2039123_2039780_-	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	63.8	3.1e-69
WP_001077691.1|2039892_2040093_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	68.2	3.1e-20
WP_000041061.1|2040101_2040458_+	hypothetical protein	NA	J7I452	Acinetobacter_phage	97.5	2.5e-57
WP_001072908.1|2040507_2040792_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	85.7	5.4e-34
WP_001084145.1|2040788_2041085_+	hypothetical protein	NA	A0A0P0HSJ2	Acinetobacter_phage	98.0	6.8e-48
WP_001267983.1|2041081_2041444_+	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	98.3	5.4e-55
WP_000280079.1|2041436_2042366_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	99.4	1.1e-171
WP_000544511.1|2042358_2043108_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	99.6	2.1e-138
WP_000647823.1|2043104_2043443_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.0	6.6e-31
WP_000548556.1|2043435_2043642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377622.1|2043631_2043955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000100151.1|2043954_2044356_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	5.8e-66
WP_001277128.1|2044352_2044829_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 3
NZ_CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	2048135	2065358	3871930	capsid,coat	Acinetobacter_phage(91.67%)	28	NA	NA
WP_001136767.1|2048135_2048591_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.0	1.0e-82
WP_000378508.1|2048652_2049087_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	100.0	3.4e-80
WP_000435253.1|2049055_2049697_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	89.7	2.8e-115
WP_000212559.1|2049755_2050271_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	64.2	2.6e-55
WP_001132935.1|2050230_2051523_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	86.0	7.0e-214
WP_000301499.1|2051562_2052903_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	97.1	1.2e-248
WP_000146964.1|2052912_2054019_+|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	89.7	3.9e-189
WP_000004552.1|2054015_2054246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291453.1|2054261_2054414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589035.1|2054465_2054720_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.0	2.4e-09
WP_000056397.1|2054867_2055659_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	77.2	7.3e-89
WP_000502907.1|2055672_2056623_+|coat	coat protein	coat	A0A0P0HSG2	Acinetobacter_phage	98.7	1.7e-177
WP_000524490.1|2056667_2057003_+	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	99.1	8.0e-53
WP_000008466.1|2057006_2057387_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.1	5.3e-53
WP_000524233.1|2057386_2057755_+	hypothetical protein	NA	J7I467	Acinetobacter_phage	94.3	1.8e-61
WP_000043392.1|2057816_2058347_+	hypothetical protein	NA	A0A0D4DCP9	Acinetobacter_phage	100.0	3.4e-98
WP_000539744.1|2058388_2058757_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	99.2	5.0e-64
WP_002039534.1|2058713_2059157_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	88.4	3.9e-71
WP_001277691.1|2059158_2059377_+	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	95.8	1.5e-31
WP_000064573.1|2059473_2059824_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	90.6	3.7e-53
WP_001284998.1|2059823_2060921_+	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	41.2	3.2e-74
WP_000094281.1|2061015_2061933_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	98.7	4.9e-169
WP_001185611.1|2062002_2062518_+	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	93.8	1.9e-74
WP_002077557.1|2062843_2063026_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	98.3	1.6e-28
WP_000966687.1|2063121_2063526_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	90.3	1.6e-63
WP_000658554.1|2063766_2064600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064169.1|2064614_2065025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001983384.1|2065181_2065358_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	59.6	8.2e-09
>prophage 4
NZ_CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	2073868	2079596	3871930		Acinetobacter_phage(100.0%)	6	NA	NA
WP_000277446.1|2073868_2074267_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000368382.1|2074266_2074773_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	98.2	3.8e-91
WP_000835153.1|2074769_2075132_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	78.3	1.4e-50
WP_000598542.1|2075124_2078550_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	94.3	0.0e+00
WP_000433899.1|2078618_2079008_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	98.4	1.6e-65
WP_031978348.1|2079050_2079596_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	96.1	7.0e-99
>prophage 5
NZ_CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	2160114	2194085	3871930	transposase,tRNA	Escherichia_phage(28.57%)	30	NA	NA
WP_001067855.1|2160114_2160819_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040234282.1|2160890_2161082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002063889.1|2161663_2162206_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002063884.1|2162218_2163079_-	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_085947913.1|2163385_2164475_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_085947932.1|2165787_2166547_+|transposase	IS5-like element ISKpn12 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|2167492_2168197_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000459997.1|2168284_2169007_-	pirin family protein	NA	NA	NA	NA	NA
WP_000226459.1|2169517_2170480_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000600008.1|2170545_2171376_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_031984026.1|2171399_2172950_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002011768.1|2173349_2173547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729980.1|2173869_2175189_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_001077412.1|2175300_2176299_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001111768.1|2176341_2176899_-	cytochrome b	NA	NA	NA	NA	NA
WP_000735756.1|2177138_2177528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000495834.1|2177593_2178160_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	2.4e-25
WP_000906487.1|2178229_2178484_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_001185176.1|2178730_2180011_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000199449.1|2180076_2182713_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
WP_001188825.1|2182982_2184002_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000671274.1|2184174_2185263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155684.1|2185446_2186613_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000517792.1|2186677_2187997_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
WP_000776215.1|2188118_2188436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034598.1|2188552_2189332_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001159805.1|2189390_2190440_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_000203217.1|2190600_2191308_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_085940413.1|2191683_2192773_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_085940413.1|2192995_2194085_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	2248381	2326373	3871930	transposase,tRNA,capsid,integrase,plate,terminase	Escherichia_phage(29.73%)	75	2292837:2292896	2320926:2322109
WP_000790408.1|2248381_2249488_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	66.9	3.5e-145
WP_004713368.1|2249482_2250697_-	MFS transporter	NA	NA	NA	NA	NA
WP_000013831.1|2250808_2251255_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001210983.1|2251340_2251670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042785579.1|2252088_2252235_+	peptidoglycan-binding protein	NA	A0A0N7IRF5	Acinetobacter_phage	91.7	3.3e-19
WP_000644344.1|2252620_2253214_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_000248336.1|2253598_2254228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110645.1|2254714_2255068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001245792.1|2255076_2255268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034729.1|2255787_2256105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072985.1|2256594_2256873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001138417.1|2257141_2257600_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.6	2.0e-30
WP_001004672.1|2257907_2258252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113267.1|2258999_2259482_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	86.5	3.3e-68
WP_001086350.1|2259459_2260950_+|terminase	phage terminase large subunit	terminase	I3PGT7	Xanthomonas_phage	41.4	2.8e-89
WP_000852322.1|2260958_2262293_+	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	40.0	3.7e-85
WP_001273094.1|2262237_2263050_+|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	42.1	2.7e-54
WP_000032786.1|2263129_2263318_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001140766.1|2263358_2263991_+	hypothetical protein	NA	U5U717	Lactobacillus_phage	24.5	2.8e-06
WP_000653192.1|2264044_2265244_+	DUF2213 domain-containing protein	NA	A0A2I7R2U8	Vibrio_phage	28.5	2.0e-21
WP_000060043.1|2265262_2265733_+	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	41.8	8.1e-19
WP_002011756.1|2265736_2266228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002011919.1|2266224_2267223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001068512.1|2267283_2268270_-	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	31.7	5.7e-14
WP_000433906.1|2268420_2268810_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	96.9	1.1e-64
WP_001991976.1|2268928_2269702_+	DUF4882 family protein	NA	NA	NA	NA	NA
WP_000597964.1|2270463_2271054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001207208.1|2271122_2271587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000471735.1|2271830_2272559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001182286.1|2273952_2275374_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	6.6e-56
WP_001133554.1|2275587_2276565_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	1.9e-38
WP_000179337.1|2276568_2277108_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000381220.1|2277145_2277694_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000554244.1|2277677_2278226_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_001183458.1|2278225_2278972_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_000988402.1|2280709_2282851_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
WP_000003555.1|2282847_2284038_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000885988.1|2284129_2284729_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
WP_000132356.1|2284721_2285333_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
WP_001082436.1|2285488_2286331_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
WP_001186837.1|2286447_2287116_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	43.3	3.3e-26
WP_000232552.1|2287255_2287927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000144889.1|2288107_2288431_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_049081181.1|2288775_2289306_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001083257.1|2289370_2292016_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.4	1.3e-33
WP_001290075.1|2292290_2292758_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
2292837:2292896	attL	ATCTCTGTACACGACAAATTTCACAGAACCCTTATCCTATCAGGGTTCTGCCTTCTTAAA	NA	NA	NA	NA
WP_085940413.1|2292856_2293947_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_063840280.1|2294092_2294647_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|2294997_2295702_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427620.1|2295955_2296960_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_052784429.1|2297038_2300011_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
WP_001162012.1|2300013_2300571_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845054.1|2300876_2301890_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000442373.1|2302115_2302352_+	trimethoprim-resistant dihydrofolate reductase DfrB1	NA	A0A0H5ARK7	Pseudomonas_phage	68.1	1.6e-12
WP_048608579.1|2302465_2303311_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA11	NA	NA	NA	NA	NA
WP_000679427.1|2303427_2303775_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2303768_2304608_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|2304735_2305236_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000983249.1|2305411_2306197_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_044861639.1|2306183_2307695_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.5	3.8e-17
WP_001067855.1|2308469_2309174_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002210516.1|2309711_2310332_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_002210515.1|2310324_2311590_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
WP_002210514.1|2311601_2312504_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210513.1|2312764_2313526_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_011117369.1|2313546_2314407_-	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_001620096.1|2314704_2314965_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001067855.1|2315577_2316282_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557244.1|2317774_2318734_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_001072413.1|2318736_2319504_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000168112.1|2319520_2319784_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_085940413.1|2319874_2320964_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_002012279.1|2321192_2323874_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	1.3e-81
2320926:2322109	attR	TTTAAGAAGGCAGAACCCTGATAGGATAAGGGTTCTGTGAAATTTGTCGTGTACAGAGATCTTTTTTTCTTAAATGTTTAAGTTAAAAAGTTATGTGTACTAATTAAATGATCTTAAATGGTATTAGATTTTTTATTCAGATATAAGAAATCGAATAAATCATATTAATGATTGTAATGCTGGGTTATTTGTCGGATAAAGCTAAATTTTGGTAATATACGGGCATTATGATTTTAAGTATTAAATTATTTAAAAATATTGAGAGTAATGATGAGTAGTTTAAAAATTTTAATTACAAAACTTTCTACAGCTGCACGCACTGCTTTAGAAAAATCTGCTAATGCTTGTGTTCTTCAGCAAAACTACGAAATTGAAATTGAACATTTATTTTTAGAGTTACTTAATCAGTCTTTAGAAAACGATTTAAAAATTTTATTAAAAAAATATAAAATCTCAGCCGATGCTTTAGCAGATGATTTAAAAGAAACAATTTCTCAATTACCAAAAGGTAATACACGTACTCCAATTTTTGCTAAATCAATTGTTCGTTTATTTGAACAAGCTTGGTTATTGGCTTCAGCAGAACAAAATCCTGTCATTCGTAGTGGTCATTTACTGGTTGCATTATTAACTGCACCTGACCTCTATCAAATTGCAACGAGAGCTTCGAGTTTATTCGATCTTTTCCCGATAGACTCAATGAAACATAAGTTTCTCGAAATTTGTGAAAAAAGTGTAGAACAACAAGAAGAATCAAAAACATCTTCACAAGCAGATGAATTAGAACAAGCCGTGACTCCAACTGCAAAAACTCAAAAAACACCTGCTTTAGATCAATATACAATTAATTTAACTGAAAAAGCGAAGAATGGTGGGATTGACCCTGTTATTGGGCGTGAATATGAAATTCGTTTGATGCTCGATATTTTAATGCGTAGACGTCAGAACAACCCAATTTTAACTGGTGAGCCAGGTGTAGGTAAAACAGCTGTAGTTGAAGGGTTGGCTTTAAAAATTGCTCAAGGTTTAGTTCCTGAAGCATTAAAAAATGTTCATTTGCACGTTTTAGATATGGGGCTTTTGCAAGCTGGGGCAAGTGTTAAAGGTGAATTTGAAAACCGTTTAAAGCAAGTTATTCAAGAAGTCCAATCATCGGCTCATCCTATTATTTTATTTATTGATGA	NA	NA	NA	NA
WP_000020713.1|2323897_2324992_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000471450.1|2325008_2326373_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	3208972	3217221	3871930	tail	Escherichia_phage(40.0%)	10	NA	NA
WP_001272161.1|3208972_3210103_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	35.2	1.3e-22
WP_001243273.1|3210104_3210383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000996682.1|3210397_3211936_-|tail	phage tail protein	tail	E5EYU2	Acinetobacter_phage	41.7	1.8e-06
WP_004708321.1|3212011_3214003_-	hypothetical protein	NA	A0A077SK57	Escherichia_phage	54.9	3.6e-07
WP_000014219.1|3214022_3214535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130710.1|3214546_3214747_-	TraR/DksA C4-type zinc finger protein	NA	A0A0U4IIN4	Pseudomonas_phage	43.7	6.3e-05
WP_032013601.1|3214739_3215543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033917773.1|3215545_3216451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237354.1|3216523_3216751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039210549.1|3216762_3217221_-	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	3.0e-10
>prophage 8
NZ_CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	3236061	3254141	3871930	integrase	Acinetobacter_phage(91.3%)	25	3242841:3242856	3256511:3256526
WP_001136753.1|3236061_3236517_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
WP_000990950.1|3236972_3237506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994866.1|3237502_3238267_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	6.7e-63
WP_000124473.1|3238263_3239307_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_171249761.1|3239310_3239784_-	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	100.0	1.9e-39
WP_000571050.1|3239780_3241154_-	replicative DNA helicase	NA	A0A1B1P9I0	Acinetobacter_phage	46.5	4.5e-102
WP_032021269.1|3241150_3242041_-	hypothetical protein	NA	A0A1B1P9I2	Acinetobacter_phage	92.5	7.1e-141
WP_001109646.1|3242040_3242199_-	hypothetical protein	NA	A0A1B1P9H5	Acinetobacter_phage	98.1	7.9e-19
WP_000049346.1|3242255_3242618_-	hypothetical protein	NA	A0A0N7IRF8	Acinetobacter_phage	100.0	1.1e-58
WP_001077693.1|3242628_3242829_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	100.0	3.5e-32
3242841:3242856	attL	GATAATTTTTATTAAA	NA	NA	NA	NA
WP_000357168.1|3242930_3243605_+	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	100.0	6.6e-123
WP_000370477.1|3243625_3243841_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	100.0	2.5e-31
WP_000065151.1|3243973_3246241_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	100.0	0.0e+00
WP_001101029.1|3246436_3246877_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	99.3	6.8e-76
WP_000181048.1|3246879_3247203_+	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	98.1	5.7e-56
WP_032029696.1|3247214_3248336_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	1.3e-211
WP_020752379.1|3248332_3249409_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.4	6.0e-142
WP_000654849.1|3249410_3249656_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
WP_000459963.1|3249658_3250039_+	hypothetical protein	NA	A0A0D4DBH6	Acinetobacter_phage	91.2	1.4e-42
WP_000645577.1|3250025_3250250_+	hypothetical protein	NA	I2GUB4	Acinetobacter_phage	98.6	1.2e-39
WP_000993701.1|3250246_3250729_+	methyltransferase domain-containing protein	NA	A0A0N7IRF6	Acinetobacter_phage	71.7	1.3e-67
WP_000910239.1|3250729_3250999_+	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	98.9	7.8e-43
WP_000365984.1|3251136_3251748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001099514.1|3251784_3252867_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.6	1.2e-30
WP_000773627.1|3252878_3254141_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	99.3	1.6e-247
3256511:3256526	attR	GATAATTTTTATTAAA	NA	NA	NA	NA
>prophage 9
NZ_CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	3312536	3386476	3871930	tail,transposase,tRNA,coat,integrase,plate,head	Pseudomonas_phage(16.67%)	84	3317732:3317748	3398787:3398803
WP_000055760.1|3312536_3313556_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_104889693.1|3313546_3316006_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000739320.1|3316015_3316720_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750672.1|3316792_3317323_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
3317732:3317748	attL	TATTTTTAAGAATAATT	NA	NA	NA	NA
WP_031977293.1|3317883_3320490_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_000420544.1|3320808_3321066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162520241.1|3321287_3322379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000204857.1|3322412_3323240_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_001983672.1|3323361_3323727_-	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_000808301.1|3323764_3325477_-	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	40.0	1.3e-77
WP_000143191.1|3325707_3326880_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001098150.1|3327075_3328044_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000494374.1|3328040_3329231_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001269055.1|3329374_3330886_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_031977300.1|3331107_3332544_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_000122152.1|3332560_3333946_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_000774028.1|3333956_3334772_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_001098474.1|3334935_3335658_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000803936.1|3336142_3337870_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.5e-187
WP_000009660.1|3338038_3338548_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
WP_000221671.1|3338563_3339283_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000462394.1|3339290_3339521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000365036.1|3339659_3340313_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000242912.1|3340351_3341209_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001983665.1|3341340_3341859_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000070779.1|3341941_3342886_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_000129001.1|3342892_3344845_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	3.0e-83
WP_002049012.1|3344837_3345311_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_002014606.1|3345460_3346339_+	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_001232531.1|3346450_3346759_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_000637089.1|3346856_3347300_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000923642.1|3347292_3347997_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000351255.1|3348097_3348316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880860.1|3348569_3349022_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000890088.1|3349072_3349993_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104889694.1|3350220_3350925_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_000821010.1|3350994_3352266_-	hypothetical protein	NA	E5EYU2	Acinetobacter_phage	40.0	1.6e-05
WP_000142501.1|3352262_3352799_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_000331141.1|3352795_3353842_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	27.4	6.2e-27
WP_001273710.1|3353845_3354208_-	phage GP46 family protein	NA	NA	NA	NA	NA
WP_000973841.1|3354215_3354698_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	39.3	9.8e-12
WP_001153721.1|3354694_3355750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000539633.1|3355739_3356915_-	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	21.6	3.2e-16
WP_000016901.1|3356994_3359091_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	32.1	6.1e-42
WP_000974239.1|3359094_3359328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439578.1|3359357_3359669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001287672.1|3359671_3360049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002035663.1|3360177_3360987_-	hypothetical protein	NA	A0A2H4JFT7	uncultured_Caudovirales_phage	26.8	3.2e-15
WP_033107883.1|3360983_3363623_-	SGNH/GDSL hydrolase family protein	NA	A0A2H4J9C6	uncultured_Caudovirales_phage	33.8	1.3e-09
WP_002035655.1|3363633_3363981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609247.1|3363980_3364592_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_000271340.1|3364588_3365020_-	DUF1320 family protein	NA	A0A0M3LP98	Mannheimia_phage	37.3	7.4e-19
WP_000237121.1|3365031_3365964_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2P9JZJ2	Alteromonadaceae_phage	55.0	2.3e-89
WP_000221865.1|3365967_3366387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126669.1|3366383_3367469_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	32.6	3.2e-34
WP_001009380.1|3367557_3368061_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	31.9	7.4e-10
WP_001123585.1|3368057_3369308_-	hypothetical protein	NA	I6PBD2	Pseudomonas_phage	37.5	1.7e-71
WP_002035669.1|3369307_3370927_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	40.5	6.3e-103
WP_001191764.1|3371204_3371999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993473.1|3371995_3373636_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	47.5	1.2e-117
WP_001129796.1|3373632_3374202_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	36.4	1.4e-17
WP_000006499.1|3374217_3374511_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	53.6	6.0e-20
WP_001166711.1|3374513_3374816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000084784.1|3374815_3375160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361736.1|3375156_3375657_-	glycoside hydrolase family 108 protein	NA	Q775E1	Bordetella_phage	54.0	1.1e-42
WP_000030972.1|3375735_3376290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000794118.1|3376286_3376991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000583945.1|3377016_3377493_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000153331.1|3377585_3377813_+	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	44.3	1.7e-06
WP_002035674.1|3377857_3378019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108357.1|3378018_3378315_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000064357.1|3378327_3379215_+	hypothetical protein	NA	Q6QID9	Burkholderia_phage	30.4	2.5e-21
WP_000184213.1|3379217_3380969_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	36.3	5.4e-100
WP_000810198.1|3380978_3382256_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	47.3	2.7e-93
WP_000752927.1|3382444_3382663_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022455.1|3382659_3382890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000857165.1|3382879_3383551_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	48.0	9.5e-29
WP_000101705.1|3383550_3384054_+	host-nuclease inhibitor Gam family protein	NA	A0A2K9VGT9	Faecalibacterium_phage	33.5	5.8e-15
WP_000288872.1|3384076_3384244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043038.1|3384248_3384536_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	61.8	2.4e-21
WP_000063063.1|3384838_3385552_+	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	39.2	8.5e-28
WP_000855699.1|3385548_3385836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905312.1|3385829_3386042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000671216.1|3386038_3386476_+	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	43.2	5.0e-23
3398787:3398803	attR	TATTTTTAAGAATAATT	NA	NA	NA	NA
>prophage 10
NZ_CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	3635099	3649896	3871930		Acinetobacter_phage(100.0%)	10	NA	NA
WP_000566784.1|3635099_3635675_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
WP_004712864.1|3635770_3638470_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.7	0.0e+00
WP_000281155.1|3638548_3641281_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.6	0.0e+00
WP_002013283.1|3641637_3642687_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	99.7	3.7e-189
WP_000608308.1|3642696_3643503_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
WP_000066126.1|3643512_3644208_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164227.1|3644218_3645202_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	99.4	1.0e-188
WP_001076809.1|3645208_3647584_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.0	0.0e+00
WP_000893692.1|3647585_3649085_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	96.0	2.6e-276
WP_001187844.1|3649347_3649896_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
