The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	7192	55424	4987160	transposase,plate	Vibrio_phage(33.33%)	43	NA	NA
WP_094030473.1|7192_8188_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_094030472.1|8184_10068_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001276638.1|10083_10578_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_094030471.1|10574_11405_-	impE family protein	NA	NA	NA	NA	NA
WP_094030470.1|11391_12306_-	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_094030469.1|12637_15271_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	33.9	9.3e-80
WP_083575636.1|15283_15847_+	peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000144227.1|15849_16140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996814.1|16201_16747_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_089631413.1|16789_18286_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_021580507.1|18338_18824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094030468.1|18820_19192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119441.1|19304_19790_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_094030467.1|19857_20391_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_104888891.1|20394_21738_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_094030466.1|21734_23051_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_094030465.1|23142_23511_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_042106309.1|23512_23956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062864333.1|24283_28150_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_157908351.1|28242_28395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094030463.1|28396_29092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042106405.1|29088_29565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094030462.1|29753_30554_+	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_042106403.1|30706_31441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052431198.1|31437_31809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094030474.1|33036_33522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094030461.1|33518_33905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094030460.1|33929_36143_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_094030459.1|36167_36611_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_094030591.1|40756_41377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094030590.1|41466_41931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032170719.1|44700_45243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104888892.1|45631_46768_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001118041.1|46798_47569_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|47722_48196_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_094029784.1|48238_50683_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|50922_51501_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|51616_52384_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|52354_53095_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615978.1|53250_53529_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729709.1|53531_53792_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_122992241.1|53977_54751_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
WP_000006244.1|54926_55424_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	368109	449039	4987160	head,tail,tRNA,terminase,capsid,transposase,protease,lysis,integrase,portal	Enterobacteria_phage(47.54%)	90	378260:378306	426053:426099
WP_094030382.1|368109_369495_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_094030383.1|369530_370052_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|370159_370372_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|370373_371240_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_094030384.1|371711_372254_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988384.1|372472_373165_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_094030385.1|373195_375805_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691076.1|375817_376825_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255235.1|376835_377351_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|377353_377986_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
378260:378306	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|378319_379483_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000446905.1|379338_379710_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000490216.1|379681_379960_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.1e-47
WP_000002143.1|379937_380270_-	hypothetical protein	NA	A5VWB6	Enterobacteria_phage	93.6	6.5e-47
WP_000763362.1|380269_380491_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	91.8	1.3e-32
WP_077759207.1|380589_380871_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	94.6	1.1e-44
WP_000129285.1|380881_381439_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_077759208.1|381431_381593_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	98.0	1.6e-22
WP_069905188.1|381589_382270_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.2	1.9e-130
WP_000100847.1|382266_383052_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|383057_383354_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|383429_383636_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|384229_384919_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|385023_385254_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|385323_385863_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_032259736.1|385949_386879_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	7.3e-112
WP_104888895.1|386875_387598_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	9.0e-126
WP_021526100.1|387750_388416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023140625.1|388430_389390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211451.1|390021_390630_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	6.3e-32
WP_000990013.1|390865_391375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309322.1|391471_391573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061353478.1|391569_392025_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.2	1.7e-61
WP_000224914.1|392024_392195_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774488.1|392187_392478_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099700.1|392474_392837_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_000971055.1|392833_392974_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204777.1|393059_393437_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|393592_394117_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_032259732.1|394309_395269_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_158660470.1|395620_396352_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839582.1|396540_396756_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_032259797.1|396755_397253_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.3e-88
WP_001408742.1|397249_397708_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	80.3	6.2e-56
WP_000839225.1|397909_398407_+	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_024205918.1|398403_398661_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	98.8	1.1e-38
WP_000079508.1|398947_399358_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|399414_399648_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453587.1|400036_400582_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_039022778.1|400556_402482_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198153.1|402478_402685_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_032315153.1|402681_404283_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	4.9e-310
WP_001586766.1|404263_405595_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.2	2.2e-231
WP_000201478.1|405604_405937_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_104888897.1|405992_407018_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.3	1.6e-184
WP_000158882.1|407059_407455_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	3.1e-56
WP_000752965.1|407466_407820_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_001398561.1|407831_408410_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000683129.1|408406_408802_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_104888978.1|408809_409550_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	2.9e-132
WP_019842818.1|409565_409988_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.1	9.4e-59
WP_000459481.1|409969_410404_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
WP_104888898.1|410396_412943_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.0	0.0e+00
WP_000847355.1|412939_413269_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_001152538.1|413268_413967_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_104888899.1|413972_414716_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_071597487.1|414652_415285_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.3e-96
WP_104888900.1|415345_418744_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	91.6	0.0e+00
WP_096998850.1|418810_419410_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.1e-108
WP_104888901.1|419468_422957_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	65.8	1.3e-257
WP_077901659.1|423011_423131_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.9	3.2e-09
WP_000386784.1|423676_424426_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001201845.1|424675_425629_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177457.1|426141_426903_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
426053:426099	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_094030386.1|427085_427976_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_094030387.1|427976_430949_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383926.1|430935_433173_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_094030388.1|433322_434765_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.3e-11
WP_000770953.1|434754_435438_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_094030389.1|435594_436977_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709873.1|437000_437333_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_094030390.1|437348_438572_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_094030391.1|438583_441727_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.7e-59
WP_000786307.1|441828_443205_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153128.1|443272_444520_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000351480.1|444627_445281_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360954.1|445374_445743_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682518.1|445807_446056_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130634.1|446121_447240_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_087522250.1|447670_449039_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
>prophage 3
NZ_CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	759911	773189	4987160	head,terminase,capsid,protease,integrase	uncultured_Caudovirales_phage(28.57%)	15	759237:759251	764113:764127
759237:759251	attL	CGGGCTGGCATTTTG	NA	NA	NA	NA
WP_104888902.1|759911_761150_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.0	2.0e-125
WP_001206974.1|761569_761779_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	7.5e-17
WP_072106572.1|761789_762704_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001113141.1|762696_763017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021542342.1|763023_763323_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000710148.1|763319_765443_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.2	1.5e-173
764113:764127	attR	CGGGCTGGCATTTTG	NA	NA	NA	NA
WP_000646743.1|765821_766064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085960332.1|766060_766417_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228103.1|766702_767743_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.9	8.8e-66
WP_000190777.1|767752_768094_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001179423.1|768105_768489_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000835287.1|768690_769233_+|terminase	terminase	terminase	O64316	Escherichia_phage	47.5	3.2e-35
WP_021540210.1|769484_769775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|770561_770882_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|770912_773189_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 4
NZ_CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	1028673	1076033	4987160	head,tail,tRNA,terminase,capsid,lysis,holin,integrase,portal	Enterobacteria_phage(57.69%)	62	1033915:1033937	1081296:1081318
WP_094029791.1|1028673_1029780_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1029833_1030295_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_094029790.1|1030304_1030943_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000246191.1|1031275_1031611_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|1031610_1032060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000444487.1|1032640_1033891_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
1033915:1033937	attL	AACGGGCGTGTTATACGCCCGTT	NA	NA	NA	NA
WP_000741339.1|1034004_1035147_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000088653.1|1035136_1035373_-	excisionase	NA	NA	NA	NA	NA
WP_094030526.1|1035512_1035752_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	92.4	2.8e-36
WP_042099480.1|1035729_1036062_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	1.3e-47
WP_000763374.1|1036061_1036283_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_001360114.1|1036381_1036663_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548537.1|1036673_1036865_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_104888907.1|1036837_1037020_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	3.4e-26
WP_024230154.1|1037016_1037697_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	1.0e-131
WP_000100844.1|1037693_1038479_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_096946078.1|1038484_1038781_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.5e-47
WP_000233576.1|1038856_1039063_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000841195.1|1039543_1040050_-	hypothetical protein	NA	U5P455	Shigella_phage	34.0	4.1e-08
WP_000654526.1|1040071_1041094_-	hypothetical protein	NA	U5P4L0	Shigella_phage	52.3	3.3e-97
WP_000858971.1|1041216_1041906_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	6.2e-92
WP_001067458.1|1042010_1042241_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001546577.1|1042310_1042850_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	1.5e-61
WP_122992267.1|1042936_1043866_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	9.5e-112
WP_094030556.1|1043862_1044585_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	93.9	6.6e-121
WP_134688352.1|1044629_1044836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104888908.1|1044930_1046124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032236358.1|1046133_1047921_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_094030555.1|1048345_1048447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094030554.1|1048443_1048899_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	68.2	7.0e-60
WP_000224907.1|1048898_1049069_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_021540087.1|1049061_1049352_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	5.1e-48
WP_094030553.1|1049348_1049711_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	2.3e-58
WP_000971093.1|1049707_1049848_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_094030552.1|1049844_1050534_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	47.6	1.9e-56
WP_000544528.1|1050855_1051161_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_094030551.1|1051147_1051624_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	96.2	1.0e-85
WP_094030550.1|1051620_1052064_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	91.8	1.6e-69
WP_094030549.1|1052102_1052477_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	80.6	1.7e-48
WP_094030548.1|1053101_1053647_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	2.3e-94
WP_001027297.1|1053621_1055547_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|1055543_1055750_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_089630660.1|1055746_1057348_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	7.7e-311
WP_094030547.1|1057328_1058648_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	3.1e-233
WP_094030546.1|1058657_1058990_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_094030545.1|1059045_1060071_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	5.6e-190
WP_094030544.1|1060112_1060511_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.0e-58
WP_094030543.1|1060522_1060876_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	97.4	6.4e-61
WP_094030542.1|1060887_1061466_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.3e-79
WP_094030541.1|1061462_1061858_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.1e-69
WP_094030558.1|1061865_1062606_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	5.6e-131
WP_000479153.1|1062621_1063044_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459458.1|1063025_1063460_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_094030540.1|1063452_1066002_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	86.0	0.0e+00
WP_000847332.1|1065998_1066328_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_001152612.1|1066327_1067026_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1067031_1067775_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090885.1|1067711_1068344_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	3.8e-96
WP_104888909.1|1068404_1071803_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.0	0.0e+00
WP_104888910.1|1071869_1072469_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	5.7e-110
WP_104888979.1|1072533_1075449_+	hypothetical protein	NA	Q6H9S9	Enterobacteria_phage	99.1	5.0e-58
WP_039022689.1|1075448_1076033_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	2.8e-101
1081296:1081318	attR	AACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 5
NZ_CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	1269688	1323747	4987160	tail,tRNA,terminase,lysis,integrase	Escherichia_phage(51.06%)	55	1260007:1260023	1324021:1324037
1260007:1260023	attL	TAAAATCGATAACGCCT	NA	NA	NA	NA
WP_001361837.1|1269688_1270921_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1271175_1272159_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_094030107.1|1272636_1274010_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.5e-52
WP_001157407.1|1274138_1275074_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_023277532.1|1275125_1276361_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.0	2.5e-237
WP_000079604.1|1276362_1276578_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1276677_1276866_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_042038331.1|1276858_1277053_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.3	1.3e-31
WP_000166319.1|1277109_1277919_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_104888914.1|1277911_1280512_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	4.4e-247
WP_000632297.1|1280613_1280889_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1280963_1281134_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1281133_1281355_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1281796_1282285_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_089642810.1|1282281_1282437_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.6e-08
WP_000233320.1|1282869_1283289_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072343.1|1283368_1283623_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_104888916.1|1283619_1284042_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	96.4	5.3e-70
WP_089642808.1|1284054_1284912_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.9	7.0e-69
WP_104888917.1|1284918_1285665_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	8.4e-111
WP_122989587.1|1285687_1286449_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	1.0e-119
WP_001605354.1|1286464_1286887_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	6.7e-65
WP_001100703.1|1287982_1289134_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|1289101_1290091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|1290090_1291482_-	ATPase	NA	NA	NA	NA	NA
WP_000940314.1|1291981_1292581_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
WP_000228023.1|1292580_1292871_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	3.3e-47
WP_000640107.1|1292867_1293410_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_000839599.1|1294694_1294910_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_001135310.1|1294909_1295407_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228696.1|1295623_1295809_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001703139.1|1296005_1297463_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_016245936.1|1297600_1298395_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	7.5e-49
WP_001204033.1|1298387_1299320_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_000126788.1|1299297_1299507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089446.1|1299510_1300605_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
WP_000625347.1|1300585_1301887_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
WP_000763709.1|1301889_1303296_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	8.8e-186
WP_104888918.1|1303279_1304392_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	8.4e-115
WP_104888919.1|1304496_1305261_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	1.5e-86
WP_000918483.1|1305359_1306499_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	3.3e-159
WP_021552292.1|1306721_1307117_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	40.0	2.2e-09
WP_000524259.1|1307116_1307500_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	40.2	3.4e-15
WP_001029819.1|1307500_1307881_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_000144678.1|1307877_1308270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|1308296_1309259_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_143191554.1|1309409_1309769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033866456.1|1310240_1313474_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.6	5.1e-112
WP_000024051.1|1313466_1313805_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_104888921.1|1313804_1314503_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	94.8	7.1e-128
WP_104888922.1|1314507_1315251_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	7.3e-147
WP_139127658.1|1315187_1315820_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	88.1	2.3e-93
WP_104888923.1|1315880_1319279_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230388.1|1319345_1319945_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_104888924.1|1320003_1323747_+	hypothetical protein	NA	K7PGT9	Enterobacteria_phage	68.7	5.0e-305
1324021:1324037	attR	AGGCGTTATCGATTTTA	NA	NA	NA	NA
>prophage 6
NZ_CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	1509988	1562045	4987160	tail,terminase,protease,lysis,portal,integrase	Enterobacteria_phage(51.06%)	65	1537052:1537067	1566741:1566756
WP_120795384.1|1509988_1510102_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1510170_1510404_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1510720_1511311_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_072144121.1|1511408_1511528_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
WP_104888931.1|1511582_1514888_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	69.6	1.3e-283
WP_001230361.1|1514952_1515552_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	1.2e-110
WP_104888932.1|1515618_1519017_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
WP_001399694.1|1519076_1519724_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_097412353.1|1519621_1520365_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	1.2e-146
WP_001152409.1|1520370_1521069_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000447253.1|1521078_1521408_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_097454251.1|1521407_1524473_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.4	0.0e+00
WP_001161009.1|1524444_1524774_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_104888981.1|1524782_1525169_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.9	9.8e-63
WP_021560209.1|1525229_1525973_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_001079419.1|1525983_1526385_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_023140704.1|1526381_1526960_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|1526971_1527247_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_023140705.1|1527239_1527563_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
WP_077695248.1|1527649_1529677_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
WP_098027820.1|1529621_1531130_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.7e-288
WP_001072975.1|1531129_1531342_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023277784.1|1531338_1533438_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.4	0.0e+00
WP_000421823.1|1533446_1533986_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
WP_001031431.1|1534546_1534753_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035577.1|1535053_1535464_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019606.1|1535615_1535789_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1535960_1536116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|1536195_1536261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1536263_1536452_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1536462_1536675_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
1537052:1537067	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|1537533_1538067_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|1538063_1538375_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1538379_1538595_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1539348_1539564_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1539864_1540077_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1540131_1540221_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047131.1|1540498_1541251_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	1.4e-129
WP_001774470.1|1541264_1542314_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	5.7e-113
WP_001309521.1|1542315_1542594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980999.1|1542660_1542912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000884073.1|1543128_1543341_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_122083109.1|1543385_1543493_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001774471.1|1544085_1545420_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	2.0e-06
WP_001774502.1|1545657_1546080_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	3.4e-61
WP_000054501.1|1546120_1547086_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_000705346.1|1547066_1547588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1547571_1547802_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448563.1|1547885_1548293_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1548459_1548615_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344950.1|1548616_1549192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1549678_1549867_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296931.1|1549863_1550055_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_094029658.1|1550147_1552619_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|1552706_1552943_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001774504.1|1552977_1554258_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001360138.1|1554277_1554388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094029657.1|1554445_1555465_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	3.3e-17
WP_001295394.1|1555476_1556691_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001304355.1|1556896_1557223_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_000705207.1|1557357_1557699_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1557733_1558294_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_032142801.1|1558296_1559007_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1559114_1559420_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041646.1|1559618_1562045_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
1566741:1566756	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 7
NZ_CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	1945924	1985025	4987160	head,tail,terminase,capsid,protease,holin,portal,integrase	Escherichia_phage(40.48%)	50	1966884:1966898	1999192:1999206
WP_104888984.1|1945924_1946053_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.1	8.3e-11
WP_104888940.1|1946107_1949389_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	72.6	8.1e-307
WP_104888941.1|1949453_1950053_-	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	98.0	3.7e-109
WP_104888942.1|1950123_1953537_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
WP_000090917.1|1953597_1954230_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_001361264.1|1954166_1954910_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.1e-150
WP_021528581.1|1954915_1955614_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	4.7e-132
WP_040079256.1|1955613_1955970_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
WP_000224015.1|1955947_1959175_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.1	0.0e+00
WP_077630176.1|1959220_1959481_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	6.0e-40
WP_001312914.1|1959522_1959909_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_104888943.1|1959908_1960613_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	95.7	4.3e-117
WP_001209399.1|1960672_1961017_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_001312916.1|1961013_1961463_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
WP_001147820.1|1961459_1961798_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|1961806_1962112_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|1962123_1962312_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_104888944.1|1962363_1963569_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	7.7e-223
WP_001193631.1|1963583_1964234_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466247.1|1964211_1965453_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_000478567.1|1965452_1965635_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_001140902.1|1965646_1967404_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
1966884:1966898	attL	CTGACCATATTTTTG	NA	NA	NA	NA
WP_001317918.1|1967403_1967886_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_104888945.1|1968034_1968385_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	3.6e-64
WP_001228684.1|1968489_1968675_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.0	2.7e-18
WP_000992100.1|1968891_1969425_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001545374.1|1969488_1969839_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000839572.1|1969843_1970059_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001064900.1|1970855_1971545_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	5.8e-58
WP_001217424.1|1971541_1971901_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_024177899.1|1971913_1972963_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	4.7e-107
WP_024175747.1|1972964_1973243_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737634.1|1973539_1973932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|1974075_1974288_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000150294.1|1974467_1975133_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151165.1|1975307_1975733_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	4.8e-63
WP_000450998.1|1975748_1976519_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|1976540_1977287_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095673.1|1977293_1978256_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_000693888.1|1978278_1978704_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|1978687_1978969_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|1979069_1979489_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_104888985.1|1979754_1979910_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.0e-06
WP_001171946.1|1980069_1980288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134894981.1|1980304_1980442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|1980841_1981030_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_104888946.1|1981026_1981218_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_104888947.1|1981311_1983738_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.6	6.5e-112
WP_000096344.1|1983796_1984000_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|1983999_1985025_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
1999192:1999206	attR	CTGACCATATTTTTG	NA	NA	NA	NA
>prophage 8
NZ_CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	2169301	2177610	4987160		Enterobacteria_phage(83.33%)	9	NA	NA
WP_094029839.1|2169301_2171302_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001296231.1|2171426_2171888_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_094029838.1|2171928_2172399_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	98.7	1.1e-81
WP_001308766.1|2172445_2173165_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001334139.1|2173161_2174847_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001240405.1|2175068_2175800_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|2175859_2175967_+	protein YohO	NA	NA	NA	NA	NA
WP_032171571.1|2175947_2176679_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569360.1|2176683_2177610_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 9
NZ_CP026755	Escherichia coli strain AR_0077 chromosome, complete genome	4987160	2438473	2451395	4987160	integrase	Escherichia_phage(83.33%)	6	2443970:2443983	2452440:2452453
WP_000368131.1|2438473_2439406_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000100042.1|2439993_2440524_-	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	3.3e-85
WP_094029668.1|2440571_2448485_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	93.8	0.0e+00
2443970:2443983	attL	TATCAAAAATCAGG	NA	NA	NA	NA
WP_000243051.1|2448509_2449130_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.5	1.6e-118
WP_001181154.1|2449447_2450077_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
WP_001224626.1|2450825_2451395_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
2452440:2452453	attR	CCTGATTTTTGATA	NA	NA	NA	NA
