The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	563122	574009	5451057		Escherichia_phage(87.5%)	9	NA	NA
WP_004179756.1|563122_566230_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|566284_567550_+	MFS transporter	NA	NA	NA	NA	NA
WP_004179755.1|567580_568669_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176262.1|568755_569016_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|569313_570174_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|570194_570956_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|571216_572119_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004179748.1|572130_573396_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_043906774.1|573388_574009_+	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	1.8e-114
>prophage 2
NZ_CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	972070	1040713	5451057	tail,head,tRNA,integrase,plate,portal,capsid	Enterobacteria_phage(52.94%)	77	977294:977315	1013500:1013521
WP_004179374.1|972070_972571_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|972687_973134_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|973117_973909_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|974010_975195_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004179371.1|975226_975919_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|976064_976574_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|976560_976917_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004179368.1|976906_977146_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
977294:977315	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|977410_977662_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_020324077.1|977705_978845_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_020324084.1|978999_980172_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_004216461.1|980171_980687_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|980732_981050_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|981049_981208_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_050885124.1|981194_984170_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	6.1e-221
WP_050885123.1|984185_984677_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.5	4.8e-54
WP_077265366.1|985269_988011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050885122.1|988521_989619_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	28.2	2.7e-09
WP_031593568.1|989603_989819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050885121.1|989815_992845_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023328061.1|992834_993758_-	hypothetical protein	NA	A0A0A7NPY5	Enterobacteria_phage	43.2	6.4e-52
WP_017898624.1|993759_994110_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
WP_050885120.1|994106_994694_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	56.5	5.7e-54
WP_050885119.1|994690_995326_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	4.6e-57
WP_023328065.1|995322_995790_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	5.4e-47
WP_158005144.1|995790_996126_-	peptidase	NA	B6SD31	Bacteriophage	34.4	3.3e-06
WP_050885118.1|996312_996858_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.6	9.7e-32
WP_032432781.1|996854_997139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|997129_997330_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_023328069.1|997329_997845_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	2.2e-41
WP_023328070.1|997957_998815_-	hypothetical protein	NA	A0A0A7NPX9	Enterobacteria_phage	60.9	8.3e-70
WP_023328071.1|998864_999899_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_050885117.1|999908_1000748_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	1.2e-94
WP_004213105.1|1000904_1002632_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
WP_050885116.1|1002625_1003687_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.0	9.1e-143
WP_050885115.1|1004293_1005154_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_050885114.1|1005150_1006398_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_020324116.1|1008646_1009582_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_031593599.1|1009814_1010381_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	1.2e-13
WP_020324115.1|1010377_1010602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|1010679_1010943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181449.1|1010958_1011336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|1011351_1011570_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|1011590_1011869_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|1011989_1012289_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_004216842.1|1012404_1013388_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004179366.1|1013652_1014666_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
1013500:1013521	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|1014723_1014825_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|1014824_1014899_+	protein YoaJ	NA	NA	NA	NA	NA
WP_032415974.1|1015016_1015139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|1015198_1015462_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|1015592_1016231_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|1016320_1017235_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004179363.1|1017896_1018940_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|1019242_1020451_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004179361.1|1020524_1022309_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	7.6e-17
WP_043906813.1|1022315_1023206_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|1023326_1024835_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|1025145_1025832_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153236426.1|1026282_1026471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|1026449_1027082_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|1027648_1027846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|1027961_1028972_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|1028968_1030375_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004179357.1|1030430_1031318_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|1031334_1031841_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|1031867_1032362_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|1032452_1032638_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|1033259_1034453_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|1034565_1034793_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004150797.1|1035242_1035566_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|1035558_1035951_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|1035947_1036661_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150800.1|1036933_1038184_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|1038424_1039075_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|1039091_1039550_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|1039606_1040713_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	1313887	1323350	5451057	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004179158.1|1313887_1315609_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|1315653_1316355_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1316708_1316927_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|1317046_1319326_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_043906825.1|1319356_1319674_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|1319999_1320221_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|1320297_1322238_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|1322234_1323350_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 4
NZ_CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	3013282	3084126	5451057	transposase,integrase,tRNA	Paramecium_bursaria_Chlorella_virus(13.33%)	60	3065816:3065832	3083634:3083650
WP_002882809.1|3013282_3013720_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_004146232.1|3013716_3014577_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_004151865.1|3014570_3015170_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_002882755.1|3015305_3017129_-	ribosome-dependent GTPase TypA	NA	NA	NA	NA	NA
WP_002882753.1|3017507_3018917_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004146229.1|3019105_3020155_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
WP_002882749.1|3020163_3021573_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004152951.1|3021683_3021794_+	YshB family small membrane protein	NA	NA	NA	NA	NA
WP_002882745.1|3021829_3023203_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_002882743.1|3023391_3023898_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_002882734.1|3024481_3025114_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_004195596.1|3025461_3028254_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	4.9e-71
WP_002882728.1|3028650_3029550_+	acyltransferase	NA	NA	NA	NA	NA
WP_004146224.1|3029598_3030222_-	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_004181610.1|3030249_3031236_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_002882612.1|3031311_3031581_-	YihD family protein	NA	NA	NA	NA	NA
WP_004181609.1|3031652_3032234_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_002882596.1|3032230_3032737_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_002882540.1|3038421_3039123_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002882539.1|3039135_3040533_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004187944.1|3040529_3041522_-	ribose operon transcriptional repressor RbsR	NA	NA	NA	NA	NA
WP_043906987.1|3041525_3042455_-	ribokinase	NA	NA	NA	NA	NA
WP_002882536.1|3042558_3043449_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
WP_043906872.1|3043476_3044442_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_004181605.1|3044447_3045953_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.1	4.4e-18
WP_002882527.1|3045963_3046383_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_002882520.1|3046568_3048437_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
WP_004151555.1|3048654_3050154_+	ATPase RavA	NA	NA	NA	NA	NA
WP_002882517.1|3050150_3051599_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_002882514.1|3051602_3052595_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
WP_002882510.1|3052746_3053205_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004181604.1|3053304_3053745_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_004144989.1|3054126_3056016_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004151554.1|3056131_3056755_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004144991.1|3057371_3057752_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004173838.1|3057759_3058575_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000429386.1|3058624_3058864_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004107293.1|3058914_3059385_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004144994.1|3059399_3059933_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004144995.1|3059945_3061487_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004144996.1|3061537_3062401_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004144997.1|3062427_3063810_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_001251971.1|3063830_3064250_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004181603.1|3064946_3066317_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
3065816:3065832	attL	GAAAATCGGCGCCGGCT	NA	NA	NA	NA
WP_004150309.1|3066500_3068330_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.4	1.9e-124
WP_001029679.1|3068489_3069311_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_043906873.1|3069297_3071406_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|3071402_3073070_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|3073072_3074599_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|3074599_3076216_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|3076446_3076824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|3077233_3077605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|3077665_3078163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704156.1|3078231_3078756_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|3078850_3079324_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000019473.1|3079952_3080933_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_153236428.1|3080990_3081392_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	36.1	4.5e-10
WP_000497519.1|3081506_3081833_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|3082020_3082260_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_004150308.1|3083085_3084126_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
3083634:3083650	attR	GAAAATCGGCGCCGGCT	NA	NA	NA	NA
>prophage 5
NZ_CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	3762636	3814152	5451057	terminase,tail,lysis,integrase,head,tRNA,portal,plate,capsid,transposase	Salmonella_phage(76.19%)	60	3763291:3763306	3822320:3822335
WP_004181365.1|3762636_3765879_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	4.3e-34
3763291:3763306	attL	GAGCTGGCGCTTGAGC	NA	NA	NA	NA
WP_004174237.1|3765883_3766498_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004181363.1|3766850_3767165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181362.1|3767233_3767506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439000.1|3768127_3769213_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.0	5.3e-122
WP_004144799.1|3769216_3769837_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	38.5	3.3e-36
WP_004144798.1|3769937_3770174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004174275.1|3770208_3770718_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	84.6	5.4e-77
WP_004205792.1|3770725_3770926_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	5.9e-19
WP_004144796.1|3770889_3771228_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_059689717.1|3771295_3771529_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.0e-30
WP_004144794.1|3771528_3771756_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	5.6e-34
WP_059689718.1|3771752_3772640_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	75.9	3.1e-120
WP_059689720.1|3772620_3775026_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	89.0	0.0e+00
WP_004144689.1|3775212_3775401_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
WP_059689856.1|3775414_3775648_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	84.4	3.5e-31
WP_023318927.1|3775724_3775982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059689722.1|3776276_3777086_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_142758158.1|3777105_3777768_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048300108.1|3777777_3778626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3778803_3779784_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_060618156.1|3779884_3780895_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.8	5.9e-168
WP_049594188.1|3780894_3782658_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.2	0.0e+00
WP_059689727.1|3782798_3783632_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	8.0e-102
WP_020324020.1|3783648_3784713_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
WP_059689728.1|3784716_3785367_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	85.2	5.3e-101
WP_059689730.1|3785463_3785928_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	6.0e-75
WP_002896155.1|3785927_3786131_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_004144702.1|3786134_3786350_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_059689731.1|3786330_3786840_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.6	2.5e-82
WP_049594185.1|3786844_3787228_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.9	9.5e-18
WP_059689733.1|3787224_3787653_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_059689735.1|3787748_3788171_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	3.1e-62
WP_059689737.1|3788163_3788616_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.5	3.1e-52
WP_059689738.1|3788651_3789269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059689740.1|3789375_3789948_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	1.6e-77
WP_059689742.1|3789944_3790307_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	2.2e-48
WP_059689744.1|3790293_3791202_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	69.5	1.2e-111
WP_059689745.1|3791194_3791803_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	55.6	8.8e-58
WP_059689747.1|3793934_3794675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059689749.1|3794694_3795774_+|tail	phage tail protein	tail	A0A2H4J931	uncultured_Caudovirales_phage	45.5	1.8e-29
WP_004185685.1|3795912_3797085_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	8.6e-211
WP_002896201.1|3797094_3797610_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_004144716.1|3797662_3797962_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
WP_002896220.1|3797976_3798096_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_059689751.1|3798088_3800716_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.4	5.0e-118
WP_004185683.1|3800712_3801198_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
WP_019704974.1|3801194_3802292_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.4	7.9e-174
WP_004174338.1|3802362_3802581_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004144517.1|3802593_3802971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917636.1|3803298_3803805_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|3803904_3805746_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|3805964_3807710_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|3807821_3808037_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004181358.1|3808274_3809288_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.1e-108
WP_004181356.1|3809332_3810940_-	allantoin permease	NA	NA	NA	NA	NA
WP_002916877.1|3811093_3811711_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_004195728.1|3811719_3812394_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_004181345.1|3812395_3812872_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000427623.1|3813147_3814152_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
3822320:3822335	attR	GAGCTGGCGCTTGAGC	NA	NA	NA	NA
>prophage 6
NZ_CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	4386940	4434108	5451057	tail,terminase,integrase,coat,holin	Salmonella_phage(25.53%)	62	4386796:4386810	4393040:4393054
4386796:4386810	attL	GACCAGCTTTCTCAA	NA	NA	NA	NA
WP_023301229.1|4386940_4388170_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.3e-238
WP_023301228.1|4388147_4388423_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
WP_071557557.1|4388460_4388700_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
WP_043906914.1|4388707_4389016_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	1.2e-23
WP_016160779.1|4389012_4389624_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.3	4.9e-40
WP_043906915.1|4389616_4389955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043906916.1|4389989_4391099_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.2	2.5e-183
WP_043906917.1|4391111_4394222_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	60.7	1.3e-293
4393040:4393054	attR	GACCAGCTTTCTCAA	NA	NA	NA	NA
WP_023282477.1|4394359_4394515_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_004179600.1|4394523_4394715_-	YebW family protein	NA	NA	NA	NA	NA
WP_040243782.1|4395201_4395405_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	1.4e-20
WP_043906918.1|4395453_4396260_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_040243778.1|4396256_4397105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040243776.1|4397275_4397671_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	73.3	3.1e-48
WP_040243773.1|4397775_4398009_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_043906919.1|4398011_4398548_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.4	3.6e-63
WP_071887734.1|4398635_4398824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906920.1|4398838_4399747_+	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_032417026.1|4399749_4400499_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_023286280.1|4400506_4400842_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
WP_043906921.1|4400834_4401626_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.2e-64
WP_043906922.1|4401618_4402236_+	ead/Ea22-like family protein	NA	A6N3G8	Burkholderia_virus	52.1	3.7e-19
WP_032429364.1|4402232_4402412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077264308.1|4402408_4402885_+	DUF551 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	56.3	7.7e-17
WP_040241897.1|4403043_4403271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|4403646_4403880_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_071557491.1|4403986_4404235_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_016946309.1|4404269_4404866_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_004892208.1|4405074_4405371_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
WP_043906923.1|4405367_4405724_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	2.0e-41
WP_023287514.1|4405839_4406661_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_017145563.1|4407349_4407745_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|4407731_4408013_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_023304728.1|4408012_4408642_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_043906925.1|4408649_4408925_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.9	1.6e-14
WP_043906926.1|4409160_4409445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304730.1|4409577_4409850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906927.1|4410163_4410409_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	50.6	4.5e-13
WP_043906928.1|4410477_4411473_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	42.9	6.5e-34
WP_043906929.1|4411450_4412755_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	2.2e-146
WP_043906930.1|4412759_4414184_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.1	7.5e-193
WP_043906931.1|4414167_4415280_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	53.2	1.8e-109
WP_043906932.1|4415456_4415696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906933.1|4415814_4416579_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	62.2	3.9e-79
WP_043906934.1|4416666_4417803_+|coat	coat protein	coat	G8C7P7	Escherichia_phage	74.6	2.6e-156
WP_043906935.1|4417852_4418137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906936.1|4418140_4418551_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	40.4	1.6e-10
WP_043906937.1|4418552_4418936_+	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	49.6	1.5e-23
WP_043906938.1|4418937_4419489_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	41.1	7.0e-30
WP_043906939.1|4419485_4419878_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_043906940.1|4419901_4421074_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.4e-22
WP_043906941.1|4421128_4421611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146193.1|4421748_4421946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906942.1|4422122_4422653_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	6.1e-63
WP_050486020.1|4422734_4423232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602982.1|4423277_4423640_+	membrane protein	NA	S4TR42	Salmonella_phage	72.4	2.3e-05
WP_043906943.1|4423735_4427302_+|tail	lambda family phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	30.7	4.2e-83
WP_032423794.1|4427301_4427766_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	6.1e-59
WP_043906944.1|4427946_4428429_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	92.5	3.8e-80
WP_004190616.1|4428438_4428819_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
WP_043906945.1|4428815_4431878_+	kinase	NA	A0A286S259	Klebsiella_phage	94.1	0.0e+00
WP_043906946.1|4431954_4434108_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	9.6e-83
>prophage 7
NZ_CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	4500350	4515072	5451057	tail,integrase	Morganella_phage(50.0%)	17	4500103:4500123	4520167:4520187
4500103:4500123	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
WP_004213157.1|4500350_4501604_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	3.2e-147
WP_004213158.1|4501699_4502707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213159.1|4502837_4503056_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004213160.1|4503055_4503490_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
WP_004213161.1|4503503_4504106_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
WP_004213162.1|4504105_4504285_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023302683.1|4504281_4505247_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
WP_004213165.1|4505243_4505747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213166.1|4505743_4505953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213167.1|4505949_4506576_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
WP_004213168.1|4506585_4506936_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
WP_004213169.1|4506928_4509691_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
WP_032424539.1|4510030_4510477_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_077252710.1|4510490_4510841_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213172.1|4510845_4511319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|4511672_4511999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213175.1|4512006_4515072_+|tail	phage tail length tape-measure protein 1	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
4520167:4520187	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 8
NZ_CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	4612449	4699792	5451057	terminase,tail,integrase,tRNA,head,portal,protease,capsid,transposase,holin	Klebsiella_phage(44.64%)	96	4635341:4635363	4677037:4677059
WP_004145598.1|4612449_4613868_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|4613919_4614312_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|4614315_4614669_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151096.1|4615173_4617345_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|4617393_4618596_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|4618942_4620184_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_002913419.1|4620241_4620601_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_004180796.1|4620731_4621724_-	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_004174935.1|4621904_4623566_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_002913377.1|4625061_4626027_+	glucokinase	NA	NA	NA	NA	NA
WP_043906998.1|4626080_4626818_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|4626829_4628527_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913372.1|4628909_4630124_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|4630194_4630266_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004180792.1|4630604_4631801_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004180790.1|4631797_4632256_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	1.9e-12
WP_004180788.1|4632388_4633297_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	1.5e-08
WP_004180785.1|4633306_4634188_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|4634556_4635039_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
4635341:4635363	attL	ATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_060618154.1|4635557_4636727_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.0	4.0e-200
WP_060618153.1|4636759_4637695_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	31.7	7.5e-08
WP_060618152.1|4637903_4638578_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	47.9	8.3e-41
WP_042936714.1|4638574_4638787_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	1.8e-10
WP_053067518.1|4638783_4639236_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_023328761.1|4639232_4639439_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	100.0	1.6e-32
WP_060618151.1|4639435_4639846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048270909.1|4639973_4640759_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	7.6e-62
WP_040149782.1|4640758_4641058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184745.1|4641145_4642069_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.8	4.5e-106
WP_032408726.1|4642826_4643474_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_016530206.1|4643578_4643776_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|4643801_4644263_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_071557781.1|4644500_4644713_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_060618150.1|4644669_4645584_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	57.3	2.4e-30
WP_040186313.1|4645580_4646390_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	2.0e-110
WP_000779146.1|4646399_4646777_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_060618149.1|4646789_4647770_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.9e-134
WP_032412066.1|4647783_4648362_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	9.9e-51
WP_071887732.1|4648674_4648932_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	3.7e-42
WP_031280381.1|4648837_4649284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304726.1|4649454_4650501_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_017145563.1|4650945_4651341_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|4651327_4651609_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_023304728.1|4651608_4652238_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_060618148.1|4652245_4652521_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.8	6.8e-10
WP_022065473.1|4653479_4653725_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
WP_071887731.1|4653796_4654003_+	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	100.0	2.7e-35
WP_060618147.1|4654074_4654365_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	96.9	1.2e-52
WP_044067371.1|4654377_4654587_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	65.2	3.4e-17
WP_004143905.1|4654709_4655144_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_060618146.1|4655153_4656686_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.8	1.1e-295
WP_017880221.1|4656688_4657966_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_004216821.1|4657971_4658652_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_017880222.1|4658663_4659827_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	1.0e-211
WP_044067369.1|4659863_4660106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042346263.1|4660053_4660380_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	97.2	3.7e-55
WP_060618145.1|4660440_4660638_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	95.4	5.4e-25
WP_060618144.1|4660639_4660972_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	7.6e-56
WP_060618143.1|4660964_4661504_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	1.0e-94
WP_060618142.1|4661500_4661866_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	91.7	3.3e-60
WP_040221233.1|4661922_4662414_+|tail	phage major tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	5.0e-88
WP_040174785.1|4662457_4662811_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	80.3	1.3e-48
WP_060618141.1|4662843_4663107_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	97.7	1.3e-42
WP_071887738.1|4663103_4663535_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	94.3	4.4e-64
WP_060618140.1|4663597_4666024_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	84.6	0.0e+00
WP_004899614.1|4666023_4666503_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_032412796.1|4666489_4666972_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.9	1.6e-83
WP_017880229.1|4666981_4667362_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_060618139.1|4667358_4670427_+	kinase	NA	A0A286S259	Klebsiella_phage	98.0	0.0e+00
WP_060618138.1|4670502_4672656_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	84.5	1.9e-54
WP_004899608.1|4672668_4673403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194558.1|4673414_4673744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194556.1|4673780_4674110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|4674814_4676299_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032447769.1|4676569_4676941_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	9.2e-26
WP_004149224.1|4677147_4678077_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
4677037:4677059	attR	ATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_002913362.1|4678366_4679128_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149222.1|4679189_4680518_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_004180782.1|4680885_4681170_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002913358.1|4681329_4682640_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_004180780.1|4682639_4684784_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913355.1|4684993_4685479_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002913348.1|4685499_4686051_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913346.1|4686218_4687151_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004180777.1|4687192_4688278_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	2.7e-89
WP_004174960.1|4688280_4689105_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913340.1|4689104_4689914_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_002913339.1|4689913_4690462_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913338.1|4690493_4690775_+	YfcL family protein	NA	NA	NA	NA	NA
WP_004180775.1|4690836_4692825_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913291.1|4692983_4694204_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_043906956.1|4694413_4695592_+	MFS transporter	NA	NA	NA	NA	NA
WP_004180772.1|4695678_4696656_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_002913228.1|4696766_4697903_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_002913227.1|4697966_4698980_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002913226.1|4698979_4699792_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	4897663	4904568	5451057	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|4897663_4898527_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|4898537_4899311_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|4899551_4900445_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|4900690_4902052_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|4902370_4903093_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|4903089_4904568_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 10
NZ_CP026751	Klebsiella pneumoniae strain AR_0066 chromosome, complete genome	5451057	5126167	5186078	5451057	terminase,head,integrase,tRNA,coat	Cronobacter_phage(17.54%)	80	5132563:5132585	5179886:5179908
WP_004151452.1|5126167_5127901_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_004180441.1|5128136_5128706_+	VOC family protein	NA	NA	NA	NA	NA
WP_004180440.1|5128782_5129526_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_004151451.1|5129607_5130612_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|5130608_5131352_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|5131391_5131787_-	membrane protein	NA	NA	NA	NA	NA
WP_043906717.1|5131839_5132619_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
5132563:5132585	attL	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_043906718.1|5132615_5133875_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	89.9	2.3e-225
WP_023283988.1|5133917_5134163_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.4e-35
WP_043906719.1|5134166_5134385_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.5	1.6e-09
WP_043906720.1|5134381_5135146_-	hypothetical protein	NA	R9VWB9	Serratia_phage	56.8	2.5e-70
WP_020805516.1|5135142_5135415_-	hypothetical protein	NA	Q716F1	Shigella_phage	64.7	2.8e-24
WP_060618136.1|5135411_5135636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043906973.1|5135632_5136160_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	8.4e-57
WP_043906721.1|5136188_5136812_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	4.0e-58
WP_008807812.1|5136808_5137555_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
WP_043906722.1|5137571_5137856_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_043906723.1|5137863_5138835_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	2.3e-39
WP_019704100.1|5138922_5139117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043906724.1|5139629_5140328_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_043906725.1|5140327_5140648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077264309.1|5140693_5141416_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.7	1.1e-75
WP_004194000.1|5141484_5141712_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_001548453.1|5141750_5141972_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_032453659.1|5142105_5142834_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.9	9.3e-38
WP_043906727.1|5142830_5143607_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	1.1e-94
WP_043906728.1|5143606_5143909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906729.1|5143905_5144295_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	44.3	4.1e-16
WP_032458656.1|5144291_5145200_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A140XFY9	Salmonella_phage	81.0	1.3e-145
WP_043906730.1|5145196_5145883_+	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	50.6	3.8e-33
WP_032428632.1|5146055_5146343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906731.1|5146342_5146600_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	76.6	6.4e-26
WP_043906732.1|5146695_5147292_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	3.6e-56
WP_043906975.1|5147297_5147468_+	NinE family protein	NA	G8C7V4	Escherichia_phage	69.6	6.3e-14
WP_043906733.1|5147460_5148099_+	bacteriophage Lambda NinG protein	NA	H6WRY9	Salmonella_phage	69.8	9.8e-76
WP_043906734.1|5148095_5148737_+	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	1.1e-34
WP_040218297.1|5148733_5148874_+	YlcG family protein	NA	NA	NA	NA	NA
WP_043906735.1|5148870_5149560_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	8.4e-57
WP_029884058.1|5150303_5150618_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	4.9e-44
WP_043906736.1|5150620_5151124_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	8.5e-75
WP_043906737.1|5151120_5151498_+	hypothetical protein	NA	M9NYX9	Enterobacteria_phage	51.2	2.1e-09
WP_043906738.1|5152029_5152632_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	4.9e-77
WP_043906739.1|5152631_5154104_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	9.0e-250
WP_043906740.1|5154116_5155580_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.6	1.1e-149
WP_061403453.1|5155512_5156514_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.0	1.2e-115
WP_023339708.1|5156506_5156707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043906742.1|5156784_5158140_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.3	1.3e-130
WP_016529582.1|5158139_5158601_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_040027496.1|5158597_5159653_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
WP_029884066.1|5159685_5159925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178849.1|5159927_5160308_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
WP_043906743.1|5160307_5160481_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	4.1e-13
WP_043906744.1|5160480_5160843_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	50.0	1.9e-20
WP_043906745.1|5160845_5161214_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	8.5e-48
WP_043906746.1|5161210_5161594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906747.1|5161596_5161818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906748.1|5161877_5162642_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.2	3.3e-38
WP_043906749.1|5162710_5163424_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	3.7e-63
WP_043906750.1|5163640_5164192_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	91.4	1.8e-86
WP_077264310.1|5164550_5164910_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	41.7	1.1e-15
WP_043906976.1|5165383_5165854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043906752.1|5165925_5169189_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	59.7	2.9e-232
WP_085820418.1|5169288_5169708_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	1.6e-29
WP_043906753.1|5169707_5170178_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	5.6e-28
WP_043906754.1|5170174_5170570_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	55.6	3.6e-36
WP_043906755.1|5170556_5173034_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.2	3.9e-197
WP_043906756.1|5173120_5175304_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.4	3.0e-92
WP_043906757.1|5175316_5176051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071887730.1|5176062_5176392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194556.1|5176428_5176758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|5177462_5178947_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_043906812.1|5179024_5179264_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	51.3	7.2e-16
WP_043906811.1|5179263_5179581_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.5	5.3e-22
WP_004145564.1|5179977_5180544_-	hydrolase	NA	NA	NA	NA	NA
5179886:5179908	attR	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_002911479.1|5180811_5182599_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_004180439.1|5182600_5183044_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002911459.1|5183071_5183812_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002911456.1|5183846_5184368_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_002911454.1|5184447_5185059_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004148860.1|5185067_5186078_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
>prophage 1
NZ_CP026752	Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence	211813	1686	47990	211813	transposase,integrase,protease	Escherichia_phage(25.0%)	38	9684:9697	19914:19927
WP_000427619.1|1686_2691_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_071527925.1|2988_3231_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|3561_3855_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|3953_4721_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|4721_5678_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|5674_6673_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|6669_7572_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|7616_9941_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
9684:9697	attL	CAGCTGTTGCAGGC	NA	NA	NA	NA
WP_004118237.1|10026_10980_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|10976_11498_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004118231.1|12600_12768_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|13052_14180_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|14176_14770_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|14766_15615_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|15614_16535_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|16547_18152_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|18196_19144_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|19151_20885_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
19914:19927	attR	CAGCTGTTGCAGGC	NA	NA	NA	NA
WP_000412211.1|22911_23571_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|23771_24149_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|24459_25464_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138064.1|25542_28509_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_001067855.1|28731_29436_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004153729.1|30291_31119_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|31115_31979_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|31987_32815_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|32823_33834_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|33827_34697_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|35905_36886_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|38087_38351_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|38365_38629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|38872_39154_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|39188_39758_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|39872_42668_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|42667_42865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|43102_43852_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|43838_44801_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|46643_47990_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP026752	Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence	211813	66160	129589	211813	transposase,integrase	Stx2-converting_phage(16.67%)	52	91471:91487	122532:122548
WP_000080200.1|66160_67774_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_072280712.1|67760_69047_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_001188930.1|69043_69724_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|69778_70708_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|70712_71093_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|71132_72029_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|72028_73846_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|74079_74529_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|74817_75555_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|75588_75786_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|75826_78274_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|78400_78841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|78927_82074_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004152079.1|82084_83377_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|83490_83844_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|83872_85258_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001572351.1|85447_86128_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|86120_87596_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|87846_88278_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003031976.1|88923_89328_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_000612626.1|89324_89672_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_004201219.1|89720_91259_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
91471:91487	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_085955172.1|92168_93375_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|94415_96413_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_004152070.1|96475_97753_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_071890189.1|98735_100190_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004197688.1|100791_101049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152067.1|101721_102645_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_071527918.1|102709_103021_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|103047_103995_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|105138_105879_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152063.1|106595_107606_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_000523813.1|108357_109524_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|109523_110495_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_004152715.1|113446_114718_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004178083.1|114717_115143_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152765.1|115548_117033_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152753.1|117266_117497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|118017_118443_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|118679_118934_+	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118473.1|118968_119286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178072.1|120067_120295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198570.1|120386_120617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178068.1|120668_122024_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_004152645.1|122071_122635_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
122532:122548	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
WP_043907040.1|123410_123953_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.8	4.3e-48
WP_004152643.1|124001_124250_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004152641.1|126422_126854_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152640.1|126850_127579_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004152639.1|127575_127902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152638.1|127957_128332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004220208.1|128509_129589_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP026753	Klebsiella pneumoniae strain AR_0066 plasmid tig00000084_pilon, complete sequence	70730	6275	47430	70730	transposase,integrase	Escherichia_phage(31.58%)	47	4472:4531	42372:42487
4472:4531	attL	CGTTAGATGCACTAAGCACATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTTT	NA	NA	NA	NA
WP_040204372.1|6275_6878_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	66.3	3.2e-76
WP_038988891.1|8764_9211_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004098817.1|9646_10861_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|10894_12328_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|12709_12916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|12920_13433_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|13457_14162_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|14167_14308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043907045.1|14793_15531_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|15527_15752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120891.1|15962_16502_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480972.1|16473_17310_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082320.1|17309_18113_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|18173_18989_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_157663659.1|19176_19392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|19392_20097_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_050558936.1|20179_20263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|20246_20483_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|20479_20845_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|20862_22548_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|22586_23012_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_043907009.1|23039_23315_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_004200999.1|23330_23696_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|23767_24223_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001776119.1|24482_25010_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001776120.1|25042_25474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001776122.1|25953_26919_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_004152765.1|27388_28873_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|29281_29713_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|29712_30984_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_012600007.1|31065_32043_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|32039_33245_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|33659_33929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|34285_35152_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|35919_36177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|36234_37011_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|37007_37751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|37801_38152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|38713_38944_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|38940_39357_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|39430_40141_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000027057.1|40956_41817_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000722315.1|42516_43341_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
42372:42487	attR	AAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGCATCTAACGTTCAAGGTGAGCGGACTCGCGCGGCTTTATGCGCGAGGTCCGCTCGAGCGCAGGGT	NA	NA	NA	NA
WP_001206315.1|43400_44189_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_063840280.1|44258_44813_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|45046_45604_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000608644.1|46167_47430_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
