The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025509	Rhizobium leguminosarum bv. viciae strain UPM791 chromosome, complete genome	4760731	1403173	1413883	4760731	protease	Bacillus_phage(16.67%)	7	NA	NA
WP_032980139.1|1403173_1404427_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.1	1.0e-12
WP_003547334.1|1404803_1405433_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.2	9.4e-63
WP_017963839.1|1405736_1407014_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.7e-132
WP_017959927.1|1407416_1409834_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	49.4	2.5e-204
WP_003558438.1|1410040_1410316_+	HU family DNA-binding protein	NA	A0A172Q061	Acinetobacter_phage	34.1	7.1e-07
WP_026188360.1|1410689_1411589_+	DMT family transporter	NA	NA	NA	NA	NA
WP_032983574.1|1411684_1413883_+	esterase-like activity of phytase family protein	NA	M4SLV1	Cyanophage	37.3	1.6e-61
>prophage 2
NZ_CP025509	Rhizobium leguminosarum bv. viciae strain UPM791 chromosome, complete genome	4760731	1687223	1700605	4760731	tRNA	uncultured_Mediterranean_phage(90.91%)	13	NA	NA
WP_026188370.1|1687223_1688237_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	1.6e-24
WP_018241794.1|1688255_1689113_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	38.5	3.3e-34
WP_018241795.1|1689109_1689826_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.0	2.6e-40
WP_003538990.1|1690009_1690201_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	72.1	8.9e-09
WP_018241796.1|1690252_1690864_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_018241797.1|1690860_1691688_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.5	5.2e-53
WP_018241798.1|1691887_1693171_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.3	1.8e-97
WP_018241799.1|1693175_1693949_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.2	2.4e-23
WP_018241800.1|1693945_1694599_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.1	1.5e-15
WP_026188371.1|1694839_1696444_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	29.2	5.1e-12
WP_018241802.1|1696592_1697465_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003558894.1|1697671_1698019_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	39.1	2.4e-12
WP_018241803.1|1698064_1700605_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.2	8.2e-57
>prophage 3
NZ_CP025509	Rhizobium leguminosarum bv. viciae strain UPM791 chromosome, complete genome	4760731	1930666	1940932	4760731		uncultured_Mediterranean_phage(83.33%)	8	NA	NA
WP_018242012.1|1930666_1933588_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.1	0.0e+00
WP_018242013.1|1933871_1934381_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	72.9	1.6e-44
WP_018242015.1|1934481_1935129_-	MarC family protein	NA	NA	NA	NA	NA
WP_018242016.1|1935365_1938203_+	DNA gyrase subunit A	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	42.2	2.0e-75
WP_018242017.1|1938855_1939131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018242018.1|1939267_1939762_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.2	6.1e-25
WP_003586475.1|1939820_1940393_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	52.0	3.7e-42
WP_003559389.1|1940422_1940932_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	4.2e-45
>prophage 4
NZ_CP025509	Rhizobium leguminosarum bv. viciae strain UPM791 chromosome, complete genome	4760731	2923460	2937263	4760731		Vibrio_phage(25.0%)	9	NA	NA
WP_011652885.1|2923460_2925518_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.6	1.7e-36
WP_018242977.1|2926446_2927484_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	66.7	9.2e-15
WP_018242978.1|2927746_2928934_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.3	2.6e-37
WP_018242979.1|2929098_2929827_-	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	42.0	1.2e-48
WP_018242980.1|2929875_2931756_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	34.6	3.9e-72
WP_018242981.1|2931755_2933765_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	4.9e-89
WP_018242982.1|2934434_2935325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018242983.1|2935328_2935784_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.7	6.9e-15
WP_026230698.1|2936057_2937263_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.2	1.1e-40
>prophage 5
NZ_CP025509	Rhizobium leguminosarum bv. viciae strain UPM791 chromosome, complete genome	4760731	3791623	3801556	4760731		Mycobacterium_phage(25.0%)	9	NA	NA
WP_018243693.1|3791623_3792334_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2P1JXV3	Rhodococcus_phage	48.7	2.3e-49
WP_026188535.1|3792333_3792690_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_018243695.1|3792686_3793415_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	37.6	2.9e-39
WP_018243696.1|3793419_3794640_-	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	29.7	5.4e-14
WP_026188536.1|3794744_3795719_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	75.1	7.3e-139
WP_018243698.1|3795806_3798011_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	51.4	5.6e-211
WP_018243699.1|3797989_3798394_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.1	6.5e-17
WP_018243700.1|3798408_3798630_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	52.1	7.9e-17
WP_018243701.1|3799282_3801556_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.1	7.4e-126
>prophage 1
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	0	4989	405209		Ochrobactrum_phage(33.33%)	4	NA	NA
WP_018516710.1|1220_2258_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	33.9	1.8e-34
WP_018516709.1|2448_3663_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	29.0	2.2e-20
WP_018516708.1|3893_4628_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_018516707.1|4782_4989_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	3.0e-10
>prophage 2
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	19358	22100	405209		Hokovirus(100.0%)	1	NA	NA
WP_026242317.1|19358_22100_-	UvrD-helicase domain-containing protein	NA	A0A1V0SG90	Hokovirus	26.0	2.3e-12
>prophage 3
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	28991	30047	405209		Enterobacteria_phage(100.0%)	1	NA	NA
WP_080646132.1|28991_30047_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	34.6	5.5e-15
>prophage 4
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	36383	38654	405209		Burkholderia_phage(100.0%)	1	NA	NA
WP_158672596.1|36383_38654_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	34.9	2.9e-13
>prophage 5
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	44641	46197	405209		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_018516682.1|44641_45412_+	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	26.2	3.9e-18
WP_050566325.1|45408_46197_-	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	38.1	4.4e-41
>prophage 6
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	50065	53332	405209		Streptomyces_phage(100.0%)	1	NA	NA
WP_018516677.1|50065_53332_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8T6	Streptomyces_phage	27.0	1.2e-87
>prophage 7
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	57345	58329	405209		Acidianus_tailed_spindle_virus(100.0%)	1	NA	NA
WP_018516674.1|57345_58329_-	ATP-binding protein	NA	A0A125SJ49	Acidianus_tailed_spindle_virus	31.5	1.3e-15
>prophage 8
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	62634	63636	405209		Vibrio_phage(100.0%)	1	NA	NA
WP_018516670.1|62634_63636_-	DUF1353 domain-containing protein	NA	A0A2I7QXN9	Vibrio_phage	41.0	5.2e-07
>prophage 9
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	79959	84933	405209	transposase	Bacillus_virus(50.0%)	6	NA	NA
WP_018516656.1|79959_81192_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	7.1e-30
WP_011654140.1|81214_82096_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_018481131.1|82160_83033_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011654142.1|83101_83392_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_018516654.1|83441_83786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018516653.1|83952_84933_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.2	1.7e-55
>prophage 10
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	96094	98543	405209		Staphylococcus_phage(66.67%)	3	NA	NA
WP_018516644.1|96094_96844_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	1.7e-10
WP_018516643.1|96836_97541_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	4.5e-13
WP_018516642.1|97658_98543_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	39.6	4.8e-12
>prophage 11
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	102886	109295	405209		Leptospira_phage(66.67%)	6	NA	NA
WP_063828064.1|102886_104083_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	30.5	7.1e-35
WP_026242310.1|104869_105319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104891185.1|105704_105893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018516631.1|106228_106810_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_018516630.1|106806_107892_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	36.3	1.9e-47
WP_018516629.1|107888_109295_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	23.1	1.2e-25
>prophage 12
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	115342	117252	405209		Salmonella_phage(50.0%)	2	NA	NA
WP_018517623.1|115342_116296_+	hypothetical protein	NA	A0A1S6KZY1	Salmonella_phage	43.0	7.9e-29
WP_018517622.1|116517_117252_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.1	9.7e-11
>prophage 13
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	120778	122293	405209		Hepacivirus(100.0%)	1	NA	NA
WP_018517617.1|120778_122293_+	malonyl-CoA synthase	NA	Q75ZG1	Hepacivirus	28.0	6.0e-39
>prophage 14
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	132191	142111	405209	transposase	Stx2-converting_phage(33.33%)	10	NA	NA
WP_018517605.1|132191_132968_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	9.3e-12
WP_018517604.1|132964_133678_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	5.0e-12
WP_032990445.1|133974_135345_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_018241645.1|136370_138026_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.5	3.0e-100
WP_018241646.1|138071_138419_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.6	9.8e-38
WP_018241647.1|138415_138826_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_080646163.1|139134_140760_-	AAA family ATPase	NA	V9QJA7	Oenococcus_phage	26.2	1.1e-35
WP_018517742.1|140978_141224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104891186.1|141244_141373_-	YHYH domain-containing protein	NA	NA	NA	NA	NA
WP_018517743.1|141871_142111_-	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	57.1	1.8e-06
>prophage 15
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	151966	164057	405209	transposase	Leptospira_phage(33.33%)	10	NA	NA
WP_018517779.1|151966_152896_+	cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	36.3	8.7e-49
WP_080646167.1|153031_153547_-	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_018517780.1|153911_154337_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_018517781.1|154708_155020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018517782.1|155410_156193_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	30.5	1.1e-09
WP_104891200.1|156758_157846_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.8	9.6e-47
WP_080646166.1|159002_159752_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_026242470.1|160343_161432_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.4	3.2e-18
WP_018517771.1|161424_162120_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	5.9e-34
WP_104891200.1|162970_164057_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.8	9.6e-47
>prophage 16
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	178589	180875	405209		uncultured_virus(100.0%)	1	NA	NA
WP_018516586.1|178589_180875_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.8	2.1e-80
>prophage 17
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	196005	197280	405209		Klosneuvirus(100.0%)	1	NA	NA
WP_050566347.1|196005_197280_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.3	2.2e-26
>prophage 18
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	209469	210591	405209		Mycoplasma_phage(100.0%)	1	NA	NA
WP_018517588.1|209469_210591_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.4	4.3e-26
>prophage 19
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	223607	233755	405209	transposase	Stx2-converting_phage(33.33%)	9	NA	NA
WP_018517598.1|223607_225203_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	1.6e-21
WP_018241645.1|225481_227137_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.5	3.0e-100
WP_018241646.1|227182_227530_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.6	9.8e-38
WP_018241647.1|227526_227937_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_018517534.1|228202_228715_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_018517533.1|228857_230261_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.9e-15
WP_018517532.1|230428_231838_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_018517531.1|231987_232623_+	hypothetical protein	NA	A0A2H4J137	uncultured_Caudovirales_phage	51.2	2.7e-57
WP_018517530.1|232615_233755_+	hypothetical protein	NA	A0A2H4J138	uncultured_Caudovirales_phage	52.4	8.9e-104
>prophage 20
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	236968	238039	405209		Bacillus_virus(100.0%)	1	NA	NA
WP_018517526.1|236968_238039_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.3	2.8e-30
>prophage 21
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	243940	246470	405209		Catovirus(50.0%)	2	NA	NA
WP_018517521.1|243940_245488_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.2	8.6e-17
WP_018517520.1|245603_246470_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.4	2.7e-28
>prophage 22
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	275805	278152	405209		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_026242371.1|275805_276840_-	nodulation factor ABC transporter ATP-binding protein NodI	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	38.1	2.0e-25
WP_018517098.1|276877_278152_-	chitooligosaccharide synthase NodC	NA	M1HH03	Paramecium_bursaria_Chlorella_virus	24.5	5.8e-11
>prophage 23
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	284263	286090	405209		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_018517090.1|284263_286090_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HQK2	Paramecium_bursaria_Chlorella_virus	38.7	9.6e-108
>prophage 24
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	289816	290599	405209		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_018517087.1|289816_290599_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.2	2.9e-13
>prophage 25
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	294103	295018	405209		Bacillus_virus(100.0%)	1	NA	NA
WP_018517083.1|294103_295018_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.0	1.5e-13
>prophage 26
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	300799	301459	405209	tail	Bordetella_phage(100.0%)	1	NA	NA
WP_104891191.1|300799_301459_-|tail	tail fiber protein	tail	A0A291LA10	Bordetella_phage	38.5	2.2e-14
>prophage 27
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	305830	307036	405209		environmental_halophage(100.0%)	1	NA	NA
WP_018517076.1|305830_307036_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	25.8	2.5e-32
>prophage 28
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	319429	320716	405209		uncultured_virus(100.0%)	1	NA	NA
WP_018517065.1|319429_320716_-	hypothetical protein	NA	A0A218MN59	uncultured_virus	21.8	1.7e-10
>prophage 29
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	342509	345778	405209		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_050566336.1|342509_344429_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.1	3.8e-14
WP_018517042.1|344611_345778_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	31.3	6.3e-20
>prophage 30
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	354210	355215	405209		Planktothrix_phage(100.0%)	1	NA	NA
WP_026242362.1|354210_355215_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	9.5e-25
>prophage 31
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	365837	370937	405209		Burkholderia_virus(100.0%)	1	NA	NA
WP_026242325.1|365837_370937_+	DEAD/DEAH box helicase family protein	NA	I6NW45	Burkholderia_virus	42.3	0.0e+00
>prophage 32
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	377215	378142	405209		Caulobacter_phage(100.0%)	1	NA	NA
WP_018516741.1|377215_378142_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	48.0	1.4e-70
>prophage 33
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	381387	381837	405209		Bacillus_phage(100.0%)	1	NA	NA
WP_018516736.1|381387_381837_-	thermonuclease family protein	NA	O64020	Bacillus_phage	43.0	2.6e-06
>prophage 34
NZ_CP025505	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence	405209	384961	388288	405209		Mycobacterium_phage(100.0%)	1	NA	NA
WP_018516732.1|384961_388288_+	Ti-type conjugative transfer relaxase TraA	NA	V5UQN3	Mycobacterium_phage	33.6	1.7e-14
>prophage 1
NZ_CP025510	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence	217776	11535	81319	217776	protease,transposase	Streptococcus_phage(33.33%)	45	NA	NA
WP_104891261.1|11535_12240_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_104891262.1|12786_13946_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	31.2	4.0e-19
WP_011654595.1|14554_15259_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.3	5.1e-25
WP_077988783.1|15631_16291_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077988782.1|16287_17349_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_158081473.1|19906_20203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108565382.1|22690_22942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104891263.1|23438_23852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158279264.1|24503_24857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158081463.1|25253_25394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077988539.1|25390_25714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077988540.1|25828_26143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077988541.1|27269_27464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077988542.1|28030_28912_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_104891264.1|29271_29976_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_158081469.1|30486_31887_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_077988773.1|32179_34129_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.4	4.7e-36
WP_104891311.1|34130_35246_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	42.1	6.4e-14
WP_011654595.1|36009_36714_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.3	5.1e-25
WP_104891263.1|36924_37338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104891266.1|37748_38429_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_077988841.1|39606_40689_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_104891262.1|40726_41885_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	31.2	4.0e-19
WP_104891268.1|42532_42724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104891264.1|43652_44357_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_077988233.1|44795_45491_-	conjugal transfer ATPase VirC1	NA	A0A0A8IL09	Aurantimonas_phage	29.9	3.2e-11
WP_104891270.1|48819_49728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064246079.1|49895_50480_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_104891271.1|50793_51498_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_077988064.1|51847_52168_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.5	2.7e-18
WP_158081451.1|52239_52395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077988065.1|52552_54241_+	type III effector HopG1	NA	NA	NA	NA	NA
WP_104891262.1|54371_55531_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	31.2	4.0e-19
WP_077988083.1|55862_56312_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_104891261.1|56891_57596_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_104891272.1|60515_65540_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011654595.1|69118_69823_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.3	5.1e-25
WP_158279264.1|70374_70728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104891273.1|70780_71485_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_077988119.1|71736_72387_+	porin family protein	NA	NA	NA	NA	NA
WP_077988120.1|72766_73024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104891264.1|73345_74050_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_077988544.1|74629_75286_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	26.7	5.3e-16
WP_104891275.1|77114_77819_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_011654595.1|80614_81319_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.3	5.1e-25
>prophage 2
NZ_CP025510	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence	217776	93246	186449	217776	transposase,integrase	Mycobacterium_phage(41.18%)	48	122911:122970	160141:160650
WP_104891314.1|93246_93999_+|transposase	IS6-like element ISRle39A family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	37.7	6.0e-32
WP_065279116.1|102626_104150_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_104891315.1|104348_105101_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.4	4.6e-32
WP_104891279.1|105307_106576_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.3e-92
WP_104891280.1|108823_109528_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_104891281.1|109632_110901_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	2.3e-92
WP_158672604.1|111287_111431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642540.1|111435_111903_+	nuclease	NA	NA	NA	NA	NA
WP_104891282.1|112113_112341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104891283.1|112337_112625_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_104891284.1|114841_115456_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_104891285.1|115473_116640_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_104891286.1|116629_117166_-	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_104891287.1|117192_120519_-	Ti-type conjugative transfer relaxase TraA	NA	V5UQN3	Mycobacterium_phage	34.1	1.1e-13
WP_104891288.1|120773_121016_+	TraC family protein	NA	NA	NA	NA	NA
WP_104891289.1|121497_122766_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	46.2	7.9e-93
122911:122970	attL	CGGGGCGTGTCGCAAAGTTTTCTGTTAACGCGGATTTGAGATTTGGATGGTGAAACGGCG	NA	NA	NA	NA
WP_104891290.1|123925_128932_-	shikimate kinase	NA	NA	NA	NA	NA
WP_077988445.1|129289_129610_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.4	3.9e-17
WP_104891291.1|131522_132539_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_104891292.1|132528_133095_-	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_104891293.1|133251_134346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104891294.1|137898_145224_+	AAA family ATPase	NA	Q7Y5U5	Haemophilus_phage	26.7	1.2e-12
WP_104891295.1|145759_146464_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_104891296.1|149346_149940_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	34.6	2.2e-21
WP_104891297.1|151122_152225_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.0	5.0e-11
WP_104891298.1|152338_152917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104891299.1|153086_153518_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_104891300.1|153690_154908_-	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	30.5	2.7e-21
WP_131618386.1|157114_158383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104891283.1|160387_160675_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
160141:160650	attR	CGCCGTTTCACCATCCAAATCTCAAATCCGCGTTAACAGAAAACTTTGCGACACGCCCCGTCAAAGTCATCGCGCAGTGGAATTCCTGATGTCATCCGCAAACCTCCGTTTGCGGTATTGATTCAGAACTCAACTGATTTGGAAACCTCAAAAAGAGTCACAGACCGCTCACGCTGGTATTAGACGTCTTCCAAGCGGAAGCCGTCGAAGCTCTTAGTTTTTGGACAGTCTGCTTGAATTTTGCAAATCAGCCGCGCGGCTGCTCTGGTTCCCGCGCCGCATGGCGAACGCCGATAATGACAACATCCTCGGCCGTCACTTCGTAGAAGATCAAATAGGGGTAGGGCGGCGTCACGATCCGGCGCAAGCCGCTTTCGCTGGTGAGCTGGCCGGAGTAGGGATGTTGCACTAAAAGGGTGGTGATTGCCTGAATGCGCGCCTGAACGTTACGCGCGCCTTGCGGTGATTGCTCGGCAATGTAGCCAAGAATATCGTCCAGCTCGGCAAGTG	NA	NA	NA	NA
WP_104891282.1|160671_160899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642540.1|161109_161577_-	nuclease	NA	NA	NA	NA	NA
WP_158672604.1|161581_161725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104891281.1|162111_163380_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	2.3e-92
WP_104891280.1|163484_164189_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_104891302.1|164221_166243_-	type IV secretion system ATPase VirD4	NA	NA	NA	NA	NA
WP_104891279.1|166437_167706_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	1.3e-92
WP_104891315.1|167912_168665_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.4	4.6e-32
WP_065279116.1|168863_170387_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_158672605.1|171436_178921_-	type III effector protein XopAD	NA	Q7Y5U5	Haemophilus_phage	26.2	7.4e-13
WP_104891314.1|179016_179769_-|transposase	IS6-like element ISRle39A family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	37.7	6.0e-32
WP_104891278.1|179927_180650_-	response regulator	NA	NA	NA	NA	NA
WP_131618399.1|180769_180970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104891277.1|181230_182232_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_104891313.1|182228_183404_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_077988073.1|183603_184386_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_077988072.1|184413_185088_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_104891304.1|185180_186449_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	3.9e-92
>prophage 1
NZ_CP025506	Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence	564641	84649	93758	564641		Planktothrix_phage(33.33%)	9	NA	NA
WP_018247003.1|84649_85705_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.0	1.3e-27
WP_018247002.1|85704_86484_+	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	34.3	1.4e-07
WP_018247001.1|86467_87472_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.5	5.1e-18
WP_018247000.1|87471_88281_+	inositol phosphatase	NA	NA	NA	NA	NA
WP_018246999.1|88356_90015_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.8	6.8e-20
WP_018246998.1|90143_91016_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_018246997.1|91078_92173_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_018246996.1|92184_92967_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	1.5e-17
WP_018246995.1|92963_93758_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.7e-16
