The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026709	Citrobacter koseri strain AR_0024 chromosome, complete genome	4919580	1842918	1880029	4919580	head,plate,protease,transposase,tail	Shigella_phage(58.97%)	49	NA	NA
WP_104877666.1|1842918_1843398_-	helix-turn-helix transcriptional regulator	NA	L7P7S1	Pseudomonas_phage	53.6	7.0e-10
WP_023205166.1|1843625_1843853_+	DNA-binding protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	44.1	4.2e-05
WP_104877667.1|1843849_1845847_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	70.6	1.2e-284
WP_104877560.1|1845894_1846842_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	81.7	9.0e-142
WP_057525287.1|1846854_1847094_+	hypothetical protein	NA	A0A0C4UQY4	Shigella_phage	58.1	2.1e-15
WP_104877561.1|1847110_1847368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877562.1|1847399_1848017_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	62.4	6.6e-69
WP_104877563.1|1848100_1848379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877564.1|1848362_1848842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877565.1|1848924_1849383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877566.1|1849379_1850186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877567.1|1850185_1850635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877568.1|1850621_1851125_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	46.9	2.2e-30
WP_079821771.1|1851154_1851388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023205152.1|1851613_1852036_+	phage transcription regulator	NA	A0A0C4UQZ9	Shigella_phage	74.6	1.0e-52
WP_079821742.1|1852150_1852663_+	lysozyme	NA	C9DGM9	Escherichia_phage	84.1	2.4e-80
WP_104877569.1|1852649_1853036_+	DUF2570 domain-containing protein	NA	A0A0C4UR28	Shigella_phage	52.0	4.3e-26
WP_104877570.1|1852935_1853238_+	peptidase	NA	NA	NA	NA	NA
WP_057525299.1|1853393_1853705_+	DUF2730 family protein	NA	A0A0C4UQY8	Shigella_phage	63.8	6.3e-28
WP_070812877.1|1853701_1853989_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	92.6	6.4e-43
WP_058216081.1|1853998_1854577_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	91.7	1.6e-88
WP_104877572.1|1854642_1855131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104877573.1|1855167_1856850_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	84.2	1.4e-275
WP_104877574.1|1856849_1858394_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	76.1	2.9e-230
WP_104877575.1|1858377_1859709_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	73.2	1.1e-188
WP_104877576.1|1859835_1860306_+	phage virion morphogenesis protein	NA	C9DGN8	Escherichia_phage	70.1	4.0e-58
WP_104877577.1|1860515_1861616_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	77.4	2.8e-147
WP_104877578.1|1861612_1862533_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	74.2	7.9e-135
WP_158660917.1|1862594_1863035_+	hypothetical protein	NA	C9DGP3	Escherichia_phage	59.1	8.4e-26
WP_104877579.1|1863031_1863457_+	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	61.7	4.6e-45
WP_104877580.1|1863456_1863993_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	76.0	1.7e-76
WP_104877581.1|1863985_1864162_+	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	65.1	5.7e-10
WP_104877582.1|1864158_1865658_+|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	71.5	8.2e-206
WP_023205135.1|1865667_1866024_+	hypothetical protein	NA	A0A0C4UQZ1	Shigella_phage	88.1	5.7e-57
WP_104877583.1|1866033_1866471_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	69.9	1.8e-49
WP_104877584.1|1866612_1868646_+	tape measure protein	NA	C9DGQ1	Escherichia_phage	48.7	4.9e-137
WP_104877585.1|1868653_1870090_+	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	42.6	2.9e-99
WP_104877586.1|1870079_1871213_+|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	72.1	2.6e-156
WP_104877587.1|1871212_1871797_+|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	73.1	5.1e-79
WP_104877588.1|1871793_1872243_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	71.0	4.5e-51
WP_104877589.1|1872232_1873315_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	67.1	9.6e-140
WP_104877669.1|1873311_1873851_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	68.9	8.6e-65
WP_104877670.1|1874336_1875173_+	hypothetical protein	NA	Q7Y417	Enterobacteria_phage	44.6	9.1e-13
WP_104877590.1|1875191_1875719_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	47.1	4.8e-36
WP_104877671.1|1875852_1876038_+	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	69.4	1.0e-17
WP_104877591.1|1875958_1876702_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	88.8	3.2e-126
WP_047458052.1|1877232_1878174_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.3e-23
WP_058668795.1|1878286_1878661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012133235.1|1878976_1880029_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	3.4e-81
>prophage 2
NZ_CP026709	Citrobacter koseri strain AR_0024 chromosome, complete genome	4919580	2027412	2038034	4919580	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_047457825.1|2027412_2029359_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	4.1e-40
WP_000447499.1|2029494_2029716_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_012133050.1|2030039_2030360_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	1.6e-13
WP_012133049.1|2030390_2032667_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	7.4e-166
WP_049009757.1|2033829_2034807_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	34.7	3.4e-43
WP_058668946.1|2034803_2038034_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.4	6.5e-83
>prophage 3
NZ_CP026709	Citrobacter koseri strain AR_0024 chromosome, complete genome	4919580	2553877	2562140	4919580	capsid	Enterobacteria_phage(83.33%)	9	NA	NA
WP_000699011.1|2553877_2554120_+|capsid	phage capsid protein	capsid	Q9T0Q8	Enterobacteria_phage	63.0	2.1e-07
WP_033548378.1|2554166_2555417_+	attachment protein	NA	D0U161	Enterobacteria_phage	50.9	4.2e-06
WP_001130312.1|2555416_2555758_+	DUF5455 family protein	NA	D0U162	Enterobacteria_phage	36.1	2.3e-07
WP_000268236.1|2555758_2556853_+	hypothetical protein	NA	A7BJY0	Enterobacteria_phage	54.1	3.0e-109
WP_001258048.1|2556860_2558126_+	general secretion pathway protein GspD	NA	A7BJY1	Enterobacteria_phage	50.9	3.0e-108
WP_000378923.1|2558195_2558504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058669171.1|2559116_2559896_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012132409.1|2560409_2560838_+	universal stress protein	NA	NA	NA	NA	NA
WP_012132408.1|2560853_2562140_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	53.9	1.1e-123
>prophage 4
NZ_CP026709	Citrobacter koseri strain AR_0024 chromosome, complete genome	4919580	2955743	3007615	4919580	terminase,integrase,tail	Enterobacteria_phage(24.53%)	72	2950775:2950802	3005379:3005406
2950775:2950802	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_060937472.1|2955743_2958305_-	hypothetical protein	NA	A0A0U4B0B2	Pseudomonas_phage	38.5	9.9e-18
WP_060816056.1|2958360_2961078_-	kinase	NA	A0A286S259	Klebsiella_phage	59.0	0.0e+00
WP_060816055.1|2961074_2961455_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	78.6	7.2e-58
WP_060816054.1|2961807_2962296_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	70.7	2.9e-59
WP_060816053.1|2962292_2962757_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	55.7	2.2e-48
WP_060816052.1|2962756_2965915_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	37.6	9.4e-95
WP_071258613.1|2965954_2966185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816051.1|2966220_2966775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816050.1|2966837_2968001_-	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	42.1	1.6e-60
WP_060816049.1|2968025_2968418_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_060816048.1|2968414_2968795_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	50.8	1.1e-29
WP_060816047.1|2968796_2969180_-	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	48.0	4.4e-23
WP_060937471.1|2969368_2969764_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	44.5	1.6e-15
WP_060816044.1|2969760_2970342_-	hypothetical protein	NA	S4TR53	Salmonella_phage	77.5	1.2e-80
WP_077956913.1|2970335_2970971_-	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.8	2.1e-14
WP_060816042.1|2971034_2971211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816041.1|2971302_2972763_-	glycosyltransferase family 2 protein	NA	A0A220NRM5	Escherichia_phage	79.6	8.4e-240
WP_060816040.1|2972766_2972970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816039.1|2973123_2974071_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	8.4e-132
WP_060816038.1|2974080_2974869_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.4	3.0e-66
WP_060816037.1|2974983_2975460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816036.1|2975551_2975806_-	hypothetical protein	NA	A0A1Q1PVR6	Bacillus_phage	60.2	9.4e-22
WP_060816035.1|2975955_2977068_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.2	2.7e-113
WP_060816034.1|2977054_2978458_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.0	3.1e-130
WP_060816033.1|2978459_2979773_-|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.1	8.5e-183
WP_060816032.1|2979756_2980752_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	44.6	6.3e-37
WP_060816094.1|2981128_2981665_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_096753928.1|2981670_2982198_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	81.7	1.3e-78
WP_012132741.1|2982197_2982503_-	hypothetical protein	NA	O64361	Escherichia_phage	84.2	4.4e-42
WP_060816029.1|2983360_2984158_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	93.6	1.1e-143
WP_060816028.1|2984147_2984294_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	75.0	3.5e-13
WP_060816027.1|2984290_2984647_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	86.3	2.0e-57
WP_060816026.1|2984643_2984934_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	4.3e-47
WP_060816025.1|2984936_2985143_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	70.6	2.0e-22
WP_060816024.1|2985142_2985742_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	88.8	4.5e-99
WP_012132752.1|2985779_2986028_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	98.8	8.0e-42
WP_060816023.1|2986145_2986379_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	90.9	2.6e-34
WP_060816022.1|2986576_2987125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816021.1|2987127_2987466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816019.1|2987705_2987933_-	hypothetical protein	NA	A0A193GYL4	Enterobacter_phage	93.3	1.1e-29
WP_060816018.1|2987932_2988535_-	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	43.8	5.1e-34
WP_060816017.1|2988527_2989394_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	39.1	9.7e-18
WP_060816016.1|2989390_2989903_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	76.0	1.4e-72
WP_060816015.1|2989905_2990127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077956857.1|2990126_2990723_-	ead/Ea22-like family protein	NA	K7PLZ3	Enterobacterial_phage	67.1	5.1e-18
WP_060816014.1|2990719_2991331_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	50.3	3.5e-38
WP_060816013.1|2991327_2991639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816012.1|2991655_2992351_-	phage replication protein	NA	G8C7U6	Escherichia_phage	48.3	3.1e-59
WP_072271882.1|2992347_2993346_-	replication protein	NA	A5VW95	Enterobacteria_phage	72.9	2.8e-53
WP_060816092.1|2993460_2993955_-	regulator	NA	K7PJT7	Enterobacteria_phage	60.1	1.6e-41
WP_024130423.1|2994005_2994239_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	62.3	9.5e-21
WP_060816011.1|2994310_2994730_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	70.4	9.1e-46
WP_000555155.1|2994949_2995357_+	hypothetical protein	NA	K7P7N9	Enterobacteria_phage	100.0	4.5e-50
WP_015980176.1|2995344_2995995_+	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	100.0	1.3e-107
WP_060816091.1|2996030_2996240_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	88.4	1.8e-26
WP_060816010.1|2996614_2996926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060816090.1|2997018_2997291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816009.1|2997411_2997597_+	YebW family protein	NA	NA	NA	NA	NA
WP_060816008.1|2997606_2997765_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	88.5	4.2e-20
WP_077956858.1|2997786_2998140_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	76.9	2.0e-46
WP_060816007.1|2998285_3001252_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	79.0	0.0e+00
WP_060816006.1|3001264_3002374_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	87.8	2.9e-184
WP_060816005.1|3002408_3002753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816004.1|3002745_3003354_+	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	45.4	2.0e-41
WP_060816003.1|3003343_3003616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060816002.1|3003623_3003863_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	73.1	3.8e-25
WP_060816001.1|3003924_3004197_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.8	3.6e-11
WP_060816000.1|3004171_3005251_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.1	8.7e-101
WP_012132024.1|3005639_3005978_-	YebY family protein	NA	NA	NA	NA	NA
3005379:3005406	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_077956859.1|3005994_3006870_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_012132022.1|3006869_3007244_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_024130259.1|3007384_3007615_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.0e-14
>prophage 5
NZ_CP026709	Citrobacter koseri strain AR_0024 chromosome, complete genome	4919580	3520935	3574575	4919580	head,terminase,portal,holin,protease,capsid,tail	Enterobacteria_phage(51.28%)	66	NA	NA
WP_058667634.1|3520935_3524403_-	host specificity protein J	NA	M9P0D8	Enterobacteria_phage	85.9	0.0e+00
WP_058667636.1|3524457_3525075_-|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	83.4	6.1e-91
WP_058669107.1|3525052_3525787_-	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	82.1	5.7e-120
WP_058667638.1|3525789_3526527_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	92.2	2.3e-137
WP_058667640.1|3526582_3526921_-|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	88.4	9.5e-54
WP_058667642.1|3526923_3529482_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	58.8	1.7e-259
WP_058667644.1|3529447_3529780_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	79.2	2.0e-43
WP_058667646.1|3529788_3530202_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	66.4	2.8e-31
WP_058667648.1|3530239_3530977_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	79.6	1.4e-105
WP_058667650.1|3530984_3531383_-|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	73.5	9.5e-53
WP_058667652.1|3531379_3531934_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	87.5	5.7e-72
WP_058667653.1|3531946_3532300_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	70.1	1.4e-44
WP_058667655.1|3532310_3532703_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	47.3	2.0e-18
WP_058667657.1|3532745_3533771_-|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	90.9	2.9e-178
WP_058667659.1|3533838_3534171_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	76.4	1.8e-41
WP_058667660.1|3534180_3535509_-	S49 family peptidase	NA	O64320	Escherichia_phage	75.6	1.1e-180
WP_058667662.1|3535489_3537082_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	90.6	1.4e-285
WP_058667664.1|3537078_3537285_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	92.6	4.6e-27
WP_060815839.1|3537284_3539207_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	94.4	0.0e+00
WP_058667666.1|3539181_3539727_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	94.5	1.2e-90
WP_125336880.1|3539977_3540487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058667670.1|3540571_3540781_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	86.6	2.9e-29
WP_058667672.1|3540840_3541086_-	hypothetical protein	NA	K7PKT0	Enterobacteria_phage	64.2	2.8e-23
WP_058667674.1|3541151_3541382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271854.1|3541522_3541792_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.3	4.5e-22
WP_058667676.1|3541798_3542428_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	80.9	3.9e-93
WP_058667678.1|3542584_3542863_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	71.9	1.9e-31
WP_047462987.1|3542852_3543245_-	membrane protein	NA	G8C7V8	Escherichia_phage	79.7	7.4e-50
WP_058667680.1|3543352_3543949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667682.1|3544088_3544898_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	63.8	1.6e-83
WP_058667684.1|3544916_3545912_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	69.5	5.5e-142
WP_058667686.1|3545908_3546595_-	antirepressor	NA	G0ZND1	Cronobacter_phage	53.3	4.9e-57
WP_058667690.1|3546940_3547933_-	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	77.6	4.5e-136
WP_058667692.1|3547929_3548109_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_058669109.1|3548110_3548755_-	antirepressor	NA	A0A2I7RHG4	Vibrio_phage	50.7	5.7e-47
WP_058667694.1|3548993_3549545_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	53.5	7.0e-46
WP_058667696.1|3549573_3549816_-	cytoplasmic chaperone TorD	NA	NA	NA	NA	NA
WP_058667698.1|3549954_3550641_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	40.3	2.7e-39
WP_058667700.1|3550632_3551514_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	29.0	1.9e-29
WP_058667702.1|3552789_3553161_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	91.9	5.3e-58
WP_058667704.1|3553217_3554045_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	74.2	1.0e-112
WP_058667706.1|3554173_3554713_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	68.7	1.7e-65
WP_058667707.1|3554873_3555128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667709.1|3555124_3555616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667712.1|3555612_3556386_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_153257544.1|3556382_3556535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667715.1|3557008_3557218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667717.1|3558924_3559134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058667719.1|3559136_3560315_+	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.4	1.2e-29
WP_012131563.1|3560703_3561351_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_058667721.1|3561430_3562480_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_012131561.1|3562476_3563034_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_047462438.1|3563030_3564974_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_047462435.1|3564970_3565450_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_012131557.1|3565446_3565659_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_012131556.1|3565655_3566393_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_012131555.1|3566537_3567197_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_012131554.1|3567193_3567814_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	24.5	8.2e-11
WP_012131552.1|3567826_3568429_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_047462429.1|3568438_3568888_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_047462425.1|3568884_3569748_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_058667724.1|3569734_3570430_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_012131548.1|3570436_3572923_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_012131547.1|3572919_3573186_-	chaperone NapD	NA	NA	NA	NA	NA
WP_024130164.1|3573172_3573667_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_024130163.1|3574077_3574575_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 6
NZ_CP026709	Citrobacter koseri strain AR_0024 chromosome, complete genome	4919580	3917344	3958375	4919580	terminase,tail,head	Salmonella_phage(53.33%)	52	NA	NA
WP_104877602.1|3917344_3917584_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	92.4	4.5e-34
WP_058667930.1|3917647_3918010_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	71.7	1.5e-44
WP_058667931.1|3918006_3918930_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	88.5	5.8e-154
WP_104877603.1|3918926_3920351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877604.1|3920478_3920931_-	hypothetical protein	NA	U5P083	Shigella_phage	46.4	5.8e-22
WP_104877605.1|3920941_3922291_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	63.8	5.9e-22
WP_060816144.1|3922290_3922971_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	79.6	1.4e-109
WP_104877606.1|3922967_3924167_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	90.7	1.3e-198
WP_104877607.1|3924167_3924521_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	94.0	1.6e-56
WP_104877608.1|3924523_3925177_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	64.8	2.5e-82
WP_104877609.1|3925218_3925572_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.0	9.1e-23
WP_104877610.1|3925571_3926636_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	83.1	3.8e-157
WP_104877611.1|3926638_3926941_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	1.6e-47
WP_104877612.1|3926940_3927528_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	89.2	1.1e-86
WP_104877613.1|3927527_3929744_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	83.3	0.0e+00
WP_045269847.1|3929921_3930374_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	80.0	1.1e-62
WP_000257260.1|3930377_3930818_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_104877614.1|3930829_3931975_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.9	4.5e-164
WP_060816152.1|3931978_3932542_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_104877615.1|3932516_3932906_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	96.9	1.7e-67
WP_104877616.1|3932892_3933441_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	82.3	1.5e-77
WP_060816154.1|3933437_3933848_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	86.8	4.2e-64
WP_060816155.1|3933813_3934173_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	43.1	2.0e-17
WP_060816184.1|3934216_3935158_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.2e-157
WP_039265773.1|3935176_3935674_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.0	3.5e-73
WP_104877617.1|3935680_3936901_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	81.4	1.0e-185
WP_158660920.1|3936904_3937651_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	84.5	1.1e-91
WP_060816159.1|3937535_3939005_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	86.9	7.6e-249
WP_058667956.1|3939004_3940627_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	83.5	1.6e-279
WP_039265766.1|3940629_3941202_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	67.9	1.8e-60
WP_058667957.1|3941260_3941806_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	73.7	1.6e-55
WP_058667958.1|3941802_3942333_-	lysozyme	NA	I6PBN2	Cronobacter_phage	62.0	2.9e-49
WP_039265763.1|3942310_3942631_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	79.8	4.8e-39
WP_039265761.1|3942702_3943317_-	methyltransferase domain-containing protein	NA	H2BDB7	Pseudomonas_virus	51.6	4.0e-50
WP_058667959.1|3943267_3944164_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	50.5	7.6e-74
WP_058667960.1|3944157_3944709_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	50.0	8.0e-42
WP_104877619.1|3944993_3945428_-	antitermination protein Q	NA	B6SD39	Bacteriophage	61.4	1.5e-40
WP_104877620.1|3945733_3947902_-	replication protein	NA	B6SCY1	Bacteriophage	71.5	5.0e-172
WP_104877621.1|3947905_3948106_-	transcriptional regulator	NA	K7RWG7	Bacteriophage	51.8	7.9e-08
WP_104877622.1|3948247_3948922_+	helix-turn-helix domain-containing protein	NA	B6SCU0	Bacteriophage	51.6	1.2e-60
WP_158660921.1|3949304_3949475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877623.1|3949744_3950656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877624.1|3950658_3951963_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	58.9	5.9e-144
WP_078775006.1|3951977_3952526_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	67.0	2.9e-68
WP_104877625.1|3952603_3954670_+	DNA polymerase	NA	Q775A3	Bordetella_phage	68.3	1.6e-276
WP_104877626.1|3954674_3954875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877627.1|3954885_3955104_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104445935.1|3955096_3955387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877628.1|3955383_3955572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877629.1|3955576_3955870_+	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	65.9	1.9e-26
WP_104877630.1|3955839_3956988_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	49.8	3.1e-104
WP_104877631.1|3956974_3958375_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.3	5.8e-214
>prophage 7
NZ_CP026709	Citrobacter koseri strain AR_0024 chromosome, complete genome	4919580	3971982	4045928	4919580	head,terminase,portal,holin,capsid,tRNA,integrase,tail	Cronobacter_phage(67.5%)	77	3975640:3975669	4051999:4052028
WP_047461924.1|3971982_3972720_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_012131206.1|3972851_3974189_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	1.9e-41
WP_012131205.1|3974234_3974618_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	75.0	8.0e-33
WP_047461918.1|3974936_3975626_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	3.2e-56
3975640:3975669	attL	GCCGGGTGGCGGCTTCGCCTTACCCGGCCT	NA	NA	NA	NA
WP_060815886.1|3975790_3976837_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_047461913.1|3977045_3977465_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.2e-15
WP_058667976.1|3977534_3978233_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_047461908.1|3978268_3980929_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_058667977.1|3981043_3982399_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_058669113.1|3982447_3982771_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_058667978.1|3982767_3984066_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.1	2.8e-45
WP_024130844.1|3990021_3992595_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	7.6e-127
WP_012134681.1|3992724_3993456_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_047461899.1|3993452_3994433_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_012134683.1|3994564_3995302_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_024130845.1|3995572_3995911_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_101706155.1|3996014_3996062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024130846.1|3996160_3997321_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_049011863.1|3997422_3998544_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_047461890.1|3998554_3999625_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	5.8e-89
WP_012134688.1|3999840_4000215_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_047461885.1|4000372_4000891_+	YfiR family protein	NA	NA	NA	NA	NA
WP_012134690.1|4000883_4002107_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	38.7	2.9e-07
WP_058667979.1|4002120_4002603_+	OmpA family protein	NA	NA	NA	NA	NA
WP_060815942.1|4002605_4003964_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_058669114.1|4004027_4004381_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_012134695.1|4004571_4004919_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024130850.1|4004960_4005728_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_024130851.1|4005772_4006321_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_012134698.1|4006339_4006588_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_012134699.1|4006837_4008199_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_012134700.1|4008362_4009154_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_047461874.1|4009172_4010459_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_024130852.1|4010511_4011105_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_024130853.1|4011228_4012107_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_047461871.1|4012192_4013854_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_012134705.1|4014003_4014348_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_012134706.1|4014461_4014752_-	RnfH family protein	NA	NA	NA	NA	NA
WP_012134707.1|4014741_4015218_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_012134708.1|4015348_4015831_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.4e-29
WP_104877633.1|4016422_4016863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104877673.1|4016885_4017086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104877634.1|4017312_4018989_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	64.1	9.1e-206
WP_104877635.1|4018991_4019540_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.1	2.1e-66
WP_104877636.1|4019511_4020237_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	52.3	1.2e-64
WP_104877637.1|4020226_4020682_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	43.6	1.2e-22
WP_104877638.1|4022879_4023467_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	80.5	4.9e-90
WP_104877639.1|4023459_4024644_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	79.4	7.4e-178
WP_104877640.1|4024640_4024970_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	73.4	1.2e-37
WP_104877641.1|4024966_4027240_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	56.9	2.1e-213
WP_104877642.1|4027427_4027688_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	64.0	9.6e-22
WP_096216982.1|4027807_4028176_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.3	6.1e-22
WP_042863243.1|4028175_4028517_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	90.1	1.4e-49
WP_039268767.1|4028513_4028807_-|holin	holin	holin	C7BGD7	Burkholderia_phage	48.4	6.8e-16
WP_104877644.1|4028816_4029272_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	73.5	1.2e-59
WP_104877645.1|4029268_4030396_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.1	1.1e-173
WP_104877646.1|4030392_4031100_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	79.1	4.7e-103
WP_104877647.1|4031096_4031603_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	70.1	2.5e-66
WP_104877648.1|4031599_4032052_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	75.3	2.1e-56
WP_104877649.1|4032149_4032851_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.4	1.3e-84
WP_095443378.1|4032854_4033877_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.1	1.6e-152
WP_104877650.1|4033936_4034731_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	55.2	3.2e-68
WP_104877651.1|4034903_4036679_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.8	1.4e-289
WP_104877652.1|4036675_4037728_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	3.1e-159
WP_104877653.1|4037724_4038048_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	85.4	7.0e-46
WP_104877654.1|4038021_4038234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104877655.1|4038352_4040401_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.9	6.1e-305
WP_063840858.1|4040369_4040582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104877656.1|4040578_4041445_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	92.5	3.9e-144
WP_104877657.1|4041435_4041669_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_063137277.1|4041736_4042138_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	54.1	7.9e-39
WP_044857842.1|4042137_4042575_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	53.6	4.9e-26
WP_063840861.1|4042564_4042759_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_013097411.1|4042768_4043272_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	70.7	1.9e-58
WP_104877658.1|4043668_4044244_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	71.7	1.6e-77
WP_096216632.1|4044243_4045260_+|integrase	site-specific integrase	integrase	F1BUN9	Cronobacter_phage	86.3	5.6e-174
WP_047461815.1|4045688_4045928_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	83.5	1.6e-31
4051999:4052028	attR	AGGCCGGGTAAGGCGAAGCCGCCACCCGGC	NA	NA	NA	NA
>prophage 8
NZ_CP026709	Citrobacter koseri strain AR_0024 chromosome, complete genome	4919580	4357123	4398214	4919580	transposase,plate,tRNA,protease	Erwinia_phage(33.33%)	41	NA	NA
WP_058668076.1|4357123_4357621_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_012135060.1|4357715_4358423_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_049010798.1|4358500_4359232_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_012135062.1|4359244_4360192_+	glutathione synthase	NA	NA	NA	NA	NA
WP_012135063.1|4360368_4360932_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_058668077.1|4360931_4361348_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_058668078.1|4361458_4362439_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_058668079.1|4362456_4363161_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012135068.1|4363179_4363746_+	YggT family protein	NA	NA	NA	NA	NA
WP_012135069.1|4363742_4364033_+	YggU family protein	NA	NA	NA	NA	NA
WP_058668080.1|4364040_4364634_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_060815921.1|4364626_4365763_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_049010789.1|4365881_4366928_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012135073.1|4367110_4367830_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_012135074.1|4367882_4368209_-	YggL family protein	NA	NA	NA	NA	NA
WP_024130937.1|4368208_4368928_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_024130938.1|4369089_4370142_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_012135077.1|4370170_4370446_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_065422798.1|4370543_4371626_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_049010794.1|4371837_4373094_+	nucleoside permease	NA	NA	NA	NA	NA
WP_058668081.1|4373166_4375302_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_104877662.1|4375729_4376437_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_024130940.1|4376770_4377109_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	39.4	5.3e-12
WP_072271836.1|4377167_4377323_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158660923.1|4377610_4377976_+	hypothetical protein	NA	Q716C2	Shigella_phage	49.1	1.8e-21
WP_125336793.1|4378175_4378490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271835.1|4378555_4378714_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_096753932.1|4378885_4379632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058668084.1|4380652_4381132_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_058668085.1|4381155_4382496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125337104.1|4382506_4385941_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_058668087.1|4386046_4387462_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_058668088.1|4387466_4388198_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_058668089.1|4388194_4390945_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	31.5	7.2e-83
WP_058669119.1|4390956_4391733_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_058668090.1|4391770_4393111_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_058668091.1|4393113_4393647_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_058669120.1|4393643_4394930_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_058668092.1|4394946_4395990_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_058668093.1|4395956_4397789_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_125337101.1|4397788_4398214_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
