The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	0	45714	5492922	head,protease,terminase,tail	Stx2-converting_phage(37.5%)	40	NA	NA
WP_001299337.1|0_1662_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_001063099.1|3707_3929_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125990.1|6617_6944_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|6953_7304_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573362.1|7300_7747_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|7743_8088_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|8152_8869_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|8883_9258_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|9353_9563_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_032279874.1|9610_12853_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.7	0.0e+00
WP_000807937.1|12845_13187_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|13186_13885_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194723.1|13895_14639_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_061089814.1|14584_15217_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_104858271.1|15559_19033_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
WP_044065729.1|19100_19700_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	3.5e-107
WP_104858272.1|19851_22878_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.2	2.9e-53
WP_000885577.1|22877_23462_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|23516_24185_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016240578.1|24241_24511_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	82.8	6.0e-19
WP_001079500.1|25284_25791_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|25836_26337_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|26422_26602_-	general stress protein	NA	NA	NA	NA	NA
WP_000443071.1|26982_27789_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|27788_28982_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001551007.1|28993_30352_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.5e-36
WP_000763524.1|30355_31951_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001551009.1|31950_33513_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|33604_33649_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285692.1|33786_34668_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|34664_35285_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001551010.1|35312_37208_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|37418_38294_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000622026.1|38463_39465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000710.1|39475_39784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278881.1|39835_40426_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559277.1|40422_41181_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001523120.1|41400_42450_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|42485_42737_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|43116_45714_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 2
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	50638	51229	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|50638_51229_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 3
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	59042	60977	5492922		Lactococcus_phage(100.0%)	1	NA	NA
WP_001551016.1|59042_60977_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.5	1.1e-32
>prophage 4
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	69910	71929	5492922		Salmonella_phage(50.0%)	2	NA	NA
WP_001551021.1|69910_71074_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	1.1e-27
WP_000573407.1|71122_71929_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 5
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	84719	85985	5492922		Klosneuvirus(100.0%)	1	NA	NA
WP_001551026.1|84719_85985_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.6e-24
>prophage 6
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	104361	104877	5492922		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945045.1|104361_104877_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 7
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	109305	175289	5492922	lysis,terminase,tail,tRNA,integrase,transposase	Escherichia_phage(50.98%)	69	105588:105603	149514:149529
105588:105603	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_095530534.1|109305_110518_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000885449.1|110695_111604_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000156573.1|111776_112592_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001551032.1|112688_113717_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_104858454.1|113716_115228_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_001046832.1|115422_115986_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_001314661.1|116006_117239_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|117493_118477_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001551034.1|118954_120328_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000662472.1|120456_121392_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_001551035.1|121443_122679_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.3e-238
WP_000079604.1|122680_122896_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001551036.1|122995_123184_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	7.9e-26
WP_001317028.1|123176_123371_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001551037.1|123427_124237_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	4.4e-105
WP_001551038.1|124229_126881_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001314664.1|126982_127258_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
WP_001551041.1|127332_127503_-	phage protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	9.7e-23
WP_000560221.1|127502_127724_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
WP_001551042.1|128266_128419_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001551043.1|128872_129349_-	DNA-binding transcriptional repressor RacR	NA	NA	NA	NA	NA
WP_001551044.1|129472_129769_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	43.5	1.6e-09
WP_001551045.1|129791_130214_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	5.3e-70
WP_001551047.1|131091_131838_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_158660451.1|131860_132622_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	93.3	2.3e-119
WP_001403739.1|132637_133069_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.7	4.4e-64
WP_000385105.1|133262_134417_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_001551050.1|134391_136656_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000940316.1|137069_137669_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.6e-107
WP_001551052.1|137668_137959_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.4	9.0e-45
WP_000640136.1|137955_138498_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.4e-75
WP_000839599.1|139779_139995_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_001551053.1|139994_140492_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_001228696.1|140708_140894_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|141090_142548_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291094.1|142685_143477_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|143469_144402_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|144379_144589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551055.1|144592_145687_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	1.0e-112
WP_104858274.1|145667_146969_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.3	1.4e-148
WP_001551056.1|146971_148378_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	2.3e-186
WP_001363932.1|148361_149474_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_001551057.1|149578_150343_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.4	1.8e-79
149514:149529	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_000918487.1|150441_151581_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|151803_152199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551058.1|152198_152582_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001551059.1|152582_152963_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	2.9e-19
WP_000673077.1|152959_153352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551060.1|153378_154341_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	3.8e-55
WP_122452218.1|154491_154851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032284309.1|154958_155159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551061.1|155322_157821_+|tail	lambda family phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.1	1.7e-86
WP_077634177.1|157824_158556_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	48.2	5.4e-54
WP_000024051.1|158548_158887_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152425.1|158886_159585_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.3	1.9e-128
WP_032147653.1|159590_160334_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	2.8e-146
WP_050436738.1|160270_160879_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	91.6	7.1e-100
WP_104858275.1|160939_164419_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_104858276.1|164486_165086_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	89.4	1.6e-99
WP_104858277.1|165150_167526_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.5	6.3e-168
WP_059319530.1|167525_167807_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	4.1e-18
WP_001306186.1|167816_168857_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	6.4e-125
WP_000355602.1|168899_169193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968130.1|169544_170402_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101728.1|170398_171256_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983720.1|171252_172080_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_000286867.1|172079_172994_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001295593.1|173580_174015_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837902.1|174155_175289_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
>prophage 8
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	180244	181234	5492922		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|180244_181234_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 9
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	210792	214695	5492922		Klosneuvirus(100.0%)	1	NA	NA
WP_001551082.1|210792_214695_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
>prophage 10
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	220034	220983	5492922		Escherichia_phage(50.0%)	2	NA	NA
WP_001306523.1|220034_220565_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000731833.1|220809_220983_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 11
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	234168	238219	5492922		Phage_TP(33.33%)	4	NA	NA
WP_001551090.1|234168_236130_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.9	1.2e-23
WP_023910283.1|236221_236452_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813795.1|236673_236850_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	59.6	1.2e-12
WP_104858278.1|237448_238219_-	DUF1311 domain-containing protein	NA	A0A2K9VNR0	Shigella_phage	60.8	3.6e-72
>prophage 12
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	243351	251492	5492922	terminase,portal,capsid	Enterobacteria_phage(25.0%)	7	NA	NA
WP_104858281.1|243351_244185_+	hypothetical protein	NA	Q8W645	Enterobacteria_phage	37.5	3.4e-20
WP_104858282.1|244490_244715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104858283.1|244750_245356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104858284.1|245443_247348_+|terminase	terminase	terminase	A0A2H4J898	uncultured_Caudovirales_phage	26.3	2.3e-40
WP_104858285.1|247420_247915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104858286.1|247925_249437_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	27.0	2.1e-31
WP_104858287.1|249482_251492_+|capsid	major capsid protein	capsid	A0A2I5ARA4	Synechococcus_phage	24.1	3.7e-28
>prophage 13
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	255774	271908	5492922	tail	Escherichia_phage(37.5%)	20	NA	NA
WP_033560180.1|255774_256053_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	55.4	4.9e-24
WP_104858456.1|256423_257164_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	70.5	1.3e-100
WP_104858289.1|257222_257693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049142989.1|257774_258083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077249849.1|258112_258463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104858457.1|258565_260806_+	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	34.6	1.4e-23
WP_104858290.1|260857_261418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104858458.1|261501_262071_+	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_033560185.1|262101_262545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104858291.1|262535_266189_+	DUF1983 domain-containing protein	NA	H6WZM7	Escherichia_phage	53.6	1.1e-46
WP_104858292.1|266291_266570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001406248.1|266588_266759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063074684.1|267150_267444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097086.1|267482_267830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949338.1|267839_268193_+	DUF882 domain-containing protein	NA	A0A140XFU9	Salmonella_phage	59.8	2.9e-37
WP_000361806.1|268185_268383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000850652.1|268727_270407_-	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	28.0	3.5e-40
WP_028132421.1|270470_270890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024233973.1|271198_271585_-	hypothetical protein	NA	C4MZ15	Escherichia_phage	47.3	7.9e-12
WP_001020593.1|271635_271908_-	hypothetical protein	NA	A0A1D7XF78	Escherichia_phage	52.2	1.8e-18
>prophage 14
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	274956	275970	5492922		Mycoplasma_phage(100.0%)	1	NA	NA
WP_001551095.1|274956_275970_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 15
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	283175	285916	5492922	transposase	Saccharomonospora_phage(50.0%)	2	NA	NA
WP_000526135.1|283175_283634_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000689376.1|283813_285916_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.5	4.3e-136
>prophage 16
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	291673	300698	5492922		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_104858293.1|291673_295885_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	1.4e-21
WP_000618048.1|295881_296367_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000236740.1|297577_298627_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	2.4e-18
WP_001523249.1|298721_300698_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.1	1.5e-159
>prophage 17
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	305251	306796	5492922		Escherichia_phage(100.0%)	1	NA	NA
WP_001551102.1|305251_306796_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	36.5	3.7e-20
>prophage 18
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	315075	316176	5492922		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768393.1|315075_316176_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	5.3e-138
>prophage 19
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	322335	324313	5492922	transposase	Saccharomonospora_phage(33.33%)	3	NA	NA
WP_000502112.1|322335_322794_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
WP_000781370.1|322901_323186_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_001551108.1|323302_324313_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	7.3e-25
>prophage 20
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	327586	329492	5492922		Planktothrix_phage(100.0%)	2	NA	NA
WP_001551109.1|327586_328513_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	3.5e-13
WP_001551110.1|328505_329492_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-18
>prophage 21
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	333808	337615	5492922		Klosneuvirus(50.0%)	2	NA	NA
WP_001551112.1|333808_336208_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426277.1|336232_337615_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 22
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	342894	349830	5492922		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_023910036.1|342894_345690_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.1e-17
WP_001551114.1|345734_348107_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628568.1|348144_349830_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.0	2.9e-10
>prophage 23
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	373637	378362	5492922		Lactococcus_phage(50.0%)	4	NA	NA
WP_001551127.1|373637_374990_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	30.6	5.6e-20
WP_001551128.1|375189_376512_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296726.1|376511_376778_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_032146881.1|376961_378362_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.8	9.6e-108
>prophage 24
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	385784	387320	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001551131.1|385784_387320_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	4.4e-21
>prophage 25
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	395201	396620	5492922		Bacillus_phage(100.0%)	1	NA	NA
WP_001551135.1|395201_396620_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 26
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	404367	406497	5492922		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|404367_404751_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803518.1|404782_405001_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012603.1|405057_406497_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	2.8e-30
>prophage 27
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	413979	414891	5492922		Bacillus_phage(100.0%)	1	NA	NA
WP_000592809.1|413979_414891_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-19
>prophage 28
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	419782	435220	5492922		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|419782_419986_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_001551142.1|420021_421482_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.5	2.5e-42
WP_001551143.1|421570_422938_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836035.1|422995_424015_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001295394.1|424026_425241_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001314753.1|425446_425773_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|425907_426249_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|426283_426844_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|426846_427557_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|427664_427970_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001551145.1|428168_430595_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_072198879.1|430655_433079_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	6.3e-208
WP_000213028.1|433089_433707_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001551147.1|433708_434563_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001551148.1|434605_435220_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
>prophage 29
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	452980	454282	5492922		Bacillus_phage(100.0%)	1	NA	NA
WP_001551152.1|452980_454282_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	3.2e-17
>prophage 30
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	464178	465990	5492922		Vaccinia_virus(100.0%)	1	NA	NA
WP_001551153.1|464178_465990_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 31
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	485771	487046	5492922	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|485771_487046_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 32
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	493957	495456	5492922		Salmonella_phage(50.0%)	2	NA	NA
WP_001298528.1|493957_494479_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_000250656.1|494559_495456_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 33
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	504259	513063	5492922		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101181.1|504259_505087_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|505214_505796_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_001551165.1|505941_507111_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|507276_507366_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|507664_508690_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|508686_509619_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182362.1|509731_510943_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|511233_512382_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|512421_513063_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 34
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	518568	520835	5492922		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587586.1|518568_519381_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001070006.1|519384_520170_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001309532.1|520166_520835_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.5e-23
>prophage 35
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	529125	534209	5492922		environmental_halophage(33.33%)	5	NA	NA
WP_000144587.1|529125_530346_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	9.9e-93
WP_001551170.1|530342_531614_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948872.1|531588_532335_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_001389790.1|532344_533832_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367171.1|533840_534209_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 36
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	552801	619104	5492922	lysis,terminase,tail,capsid,tRNA,head,integrase,portal	Enterobacteria_phage(44.26%)	80	572354:572381	619129:619156
WP_000553724.1|552801_554502_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.6	1.4e-31
WP_001551175.1|554558_556937_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.5	7.9e-171
WP_000368046.1|557269_558103_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001551176.1|558259_559306_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270810.1|559436_559628_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001551177.1|559631_561068_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001544590.1|561130_561844_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|562090_562555_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|562632_563382_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154182.1|563381_563933_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_001520628.1|563995_564976_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|565076_565376_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|565380_567768_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001551178.1|567782_568766_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.4	1.7e-34
WP_001386830.1|568904_568949_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|569071_569428_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|569481_569679_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|569775_570318_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|570321_572250_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
572354:572381	attL	AAATTGGTACACAATTTGGTACACAAAT	NA	NA	NA	NA
WP_000877736.1|572988_574731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551179.1|575212_575506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016247637.1|575548_576589_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	66.1	3.0e-122
WP_059319530.1|576598_576880_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	4.1e-18
WP_104858277.1|576879_579255_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.5	6.3e-168
WP_104858298.1|579319_579919_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	89.4	3.1e-100
WP_104858299.1|579986_583385_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_000090872.1|583445_584078_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	1.2e-94
WP_019843054.1|584014_584758_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.2e-149
WP_001551186.1|584763_585462_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847339.1|585461_585791_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
WP_104858300.1|585787_588349_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.6	0.0e+00
WP_000459467.1|588341_588776_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479143.1|588757_589180_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_001445656.1|589195_589936_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	4.7e-130
WP_000683105.1|589943_590339_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985116.1|590335_590914_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752996.1|590925_591279_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_000158895.1|591290_591686_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
WP_001551189.1|591727_592753_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	7.6e-187
WP_001299443.1|592807_593140_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123230.1|593149_594469_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
WP_001445654.1|594449_596051_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.2e-309
WP_000198149.1|596047_596254_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_104858301.1|596250_598176_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|598150_598696_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000738421.1|599364_599658_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|599748_599931_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135296.1|600147_600645_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839582.1|600644_600860_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001146309.1|601048_601780_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592546.1|602131_603091_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|603283_603808_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|603963_604341_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|604426_604567_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_000774488.1|604923_605214_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|605206_605377_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054342.1|605376_605832_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_104858302.1|605828_605930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|606046_606844_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001445652.1|606853_607405_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001551199.1|607869_609396_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001299444.1|609453_609603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070450.1|609650_609983_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|610050_610353_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788813.1|610349_611051_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_001551200.1|611047_611977_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_001182891.1|612063_612603_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_001067458.1|612672_612903_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|613007_613697_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_023148105.1|614208_614499_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995443.1|614574_614871_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_000100847.1|614876_615662_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_104858303.1|615658_616339_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.2	8.7e-131
WP_000682318.1|616335_616518_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|616490_616682_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|616692_616974_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763364.1|617072_617291_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488401.1|617338_617617_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
WP_001354056.1|617707_617938_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	55.7	2.9e-14
WP_001196928.1|617895_619104_-|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	74.9	4.7e-180
619129:619156	attR	AAATTGGTACACAATTTGGTACACAAAT	NA	NA	NA	NA
>prophage 37
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	630545	632807	5492922		Tupanvirus(100.0%)	1	NA	NA
WP_001551203.1|630545_632807_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 38
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	638924	639752	5492922		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|638924_639752_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 39
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	647228	648449	5492922		Klosneuvirus(100.0%)	1	NA	NA
WP_001551210.1|647228_648449_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	2.5e-27
>prophage 40
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	655213	655867	5492922		Planktothrix_phage(100.0%)	1	NA	NA
WP_001328827.1|655213_655867_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.7	2.4e-13
>prophage 41
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	660257	662213	5492922		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235805.1|660257_662213_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 42
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	667137	671223	5492922		Tupanvirus(50.0%)	4	NA	NA
WP_001135079.1|667137_667779_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	3.8e-19
WP_000438821.1|667871_669230_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|669347_670106_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723733.1|670242_671223_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.0e-07
>prophage 43
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	680036	680891	5492922		Indivirus(100.0%)	1	NA	NA
WP_001389767.1|680036_680891_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	25.0	3.0e-11
>prophage 44
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	684208	688785	5492922		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|684208_685492_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_001551217.1|685638_687114_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|687294_688785_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 45
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	703539	711644	5492922	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|703539_705225_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|705429_706011_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220981.1|706049_706745_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128845.1|706802_708713_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	3.5e-92
WP_001295493.1|708844_709189_+	RidA family protein	NA	NA	NA	NA	NA
WP_001322969.1|709550_709910_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|710029_710209_-	YoaH family protein	NA	NA	NA	NA	NA
WP_001551226.1|710282_711644_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	2.6e-41
>prophage 46
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	715506	717063	5492922		Moraxella_phage(100.0%)	1	NA	NA
WP_000394985.1|715506_717063_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 47
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	722703	722913	5492922		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|722703_722913_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 48
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	728245	730294	5492922		Moraxella_phage(100.0%)	1	NA	NA
WP_001055785.1|728245_730294_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 49
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	737790	746125	5492922	transposase	Escherichia_phage(40.0%)	10	NA	NA
WP_001551231.1|737790_738447_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.1	1.2e-55
WP_000976472.1|738842_739184_-	YebY family protein	NA	NA	NA	NA	NA
WP_001551232.1|739196_740069_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|740072_740447_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|740585_740816_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011653.1|740917_741574_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|741597_742260_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_001551233.1|742256_744317_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000064873.1|744473_744899_-|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
WP_001551234.1|744955_746125_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.0	1.7e-203
>prophage 50
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	752078	753554	5492922		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|752078_753554_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 51
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	757553	764620	5492922		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|757553_758876_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_011076428.1|758891_759824_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|759902_760658_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|760654_761440_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|761589_762600_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|762608_763220_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|763358_763424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024929.1|763494_764097_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001551239.1|764098_764620_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 52
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	768638	770689	5492922		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_001563891.1|768638_769457_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.9	4.6e-70
WP_000252980.1|769509_769905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019591.1|769945_770689_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 53
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	777173	778907	5492922	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_104858305.1|777173_778907_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	7.5e-86
>prophage 54
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	783427	789071	5492922		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|783427_783817_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|783831_784881_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204341.1|784883_785744_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001563895.1|785762_787364_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	1.2e-13
WP_001370571.1|787409_789071_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
>prophage 55
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	799157	800672	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|799157_800672_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 56
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	812665	813418	5492922		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|812665_813418_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 57
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	825639	826308	5492922		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334569.1|825639_826308_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	3.6e-81
>prophage 58
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	840320	852683	5492922		Bacillus_phage(33.33%)	11	NA	NA
WP_089602131.1|840320_842015_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.4	2.9e-18
WP_000009307.1|842185_842368_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|842446_843364_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|843536_844457_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785987.1|844445_844916_-	very short patch repair endonuclease	NA	NA	NA	NA	NA
WP_001157247.1|844896_846315_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
WP_000365598.1|846381_847077_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_000824345.1|848045_849104_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	49.3	6.6e-93
WP_047085553.1|849694_850546_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_047085554.1|850653_852012_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001340597.1|852011_852683_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
>prophage 59
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	858649	883305	5492922	integrase	Bacillus_phage(40.0%)	8	850320:850334	873178:873192
850320:850334	attL	TCCCAGACGCCGCAG	NA	NA	NA	NA
WP_000480163.1|858649_859912_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
WP_001413440.1|860105_861410_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_047085408.1|861437_862718_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000654453.1|862710_864513_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	7.9e-22
WP_089602127.1|864499_866302_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	8.5e-32
WP_000140405.1|866468_867428_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623048.1|867618_873726_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
873178:873192	attR	TCCCAGACGCCGCAG	NA	NA	NA	NA
WP_089602126.1|873813_883305_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
>prophage 60
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	923516	925926	5492922		Yersinia_phage(33.33%)	4	NA	NA
WP_104858308.1|923516_924335_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_000855059.1|924676_925150_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186726.1|925165_925642_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|925704_925926_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 61
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	933483	934650	5492922		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830155.1|933483_934650_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	6.5e-227
>prophage 62
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	942294	943194	5492922		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|942294_943194_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 63
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	950551	953374	5492922		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704893.1|950551_951718_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	1.9e-109
WP_044864422.1|951967_953374_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	8.0e-38
>prophage 64
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	961340	968863	5492922		Enterobacteria_phage(42.86%)	7	NA	NA
WP_033870520.1|961340_961883_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.9	1.7e-44
WP_033870519.1|961887_962766_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
WP_044863830.1|962823_963723_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	3.3e-29
WP_089602090.1|963722_964808_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.6e-100
WP_000183060.1|965179_966073_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_053882441.1|966315_967311_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	4.2e-09
WP_001116129.1|967468_968863_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	1.1e-18
>prophage 65
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	974479	981273	5492922		Bacillus_phage(25.0%)	6	NA	NA
WP_001356294.1|974479_975850_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.7e-32
WP_000079291.1|976042_977479_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	3.7e-46
WP_001507578.1|977481_978705_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001298845.1|978701_979181_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_096858202.1|979183_980149_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.5	1.1e-86
WP_000048188.1|980151_981273_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.2	9.0e-133
>prophage 66
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	985517	996465	5492922		uncultured_marine_virus(16.67%)	10	NA	NA
WP_000654503.1|985517_986357_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_001533053.1|986534_988697_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	8.3e-18
WP_000482901.1|988699_989143_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|989148_990288_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000454701.1|990946_992530_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001227701.1|992604_992943_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000687872.1|992932_993223_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_001252336.1|993275_995129_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|995150_995732_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|995823_996465_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 67
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1001190	1002543	5492922		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469743.1|1001190_1002543_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	1.9e-07
>prophage 68
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1015985	1124873	5492922	terminase,tail,capsid,tRNA,head,integrase,portal,holin,transposase	Enterobacteria_phage(46.48%)	111	1070871:1070891	1122379:1122399
WP_000675144.1|1015985_1017389_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_021577669.1|1017385_1018108_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_021577670.1|1018298_1018631_+	YegP family protein	NA	NA	NA	NA	NA
WP_000124651.1|1018873_1019125_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|1019126_1019423_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476027.1|1019525_1020887_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_024248383.1|1021216_1021534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807374.1|1021939_1022839_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178554.1|1022920_1023700_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_097485550.1|1023799_1024840_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490663.1|1024887_1026243_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823282.1|1026246_1026531_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001551331.1|1026561_1027014_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001551332.1|1027023_1028286_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001551333.1|1028314_1029169_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|1029399_1030452_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001551334.1|1030708_1031986_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|1031982_1032987_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_001551335.1|1032983_1033949_+	kinase	NA	NA	NA	NA	NA
WP_000434044.1|1033922_1034669_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001551336.1|1034720_1035539_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	2.3e-24
WP_000822274.1|1035603_1036404_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001551337.1|1036400_1037189_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|1037411_1037684_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134572.1|1037804_1038629_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153073.1|1038847_1039186_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_104858459.1|1039267_1040302_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001551340.1|1040312_1042793_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001551341.1|1042808_1043483_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|1043563_1044106_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001551342.1|1044400_1044682_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|1044944_1046054_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001551343.1|1046185_1048219_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	1.8e-54
WP_001551344.1|1048359_1052157_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000860770.1|1052169_1055964_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001551345.1|1055973_1059606_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636924.1|1059666_1059987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551350.1|1063922_1065059_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
WP_001551351.1|1065055_1067056_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|1067180_1067642_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551352.1|1067683_1068154_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|1068200_1068920_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1068916_1070602_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
1070871:1070891	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_104858310.1|1071116_1071365_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	96.3	7.0e-38
WP_104858460.1|1071482_1071770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104858311.1|1071812_1072853_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	81.1	1.2e-155
WP_059319530.1|1072862_1073144_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	4.1e-18
WP_104858312.1|1073143_1075522_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	76.1	9.7e-185
WP_104858276.1|1075586_1076186_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	89.4	1.6e-99
WP_104858313.1|1076253_1079643_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	87.0	0.0e+00
WP_072037205.1|1079986_1080619_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.4e-103
WP_000194723.1|1080564_1081308_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001552058.1|1081318_1082017_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	8.4e-129
WP_000847298.1|1082016_1082346_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_104858314.1|1082342_1084904_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.1	0.0e+00
WP_000533401.1|1084884_1085298_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
WP_104858315.1|1085324_1085756_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	70.1	1.1e-43
WP_000235111.1|1085769_1086522_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000683079.1|1086529_1086925_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975005.1|1086921_1087497_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_001204556.1|1087511_1087865_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000201501.1|1087857_1088241_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522589.1|1088292_1089321_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	7.3e-113
WP_000256824.1|1089378_1089726_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_104858316.1|1089762_1091568_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.6e-99
WP_053895456.1|1091557_1093150_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000259002.1|1093146_1093353_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012601968.1|1093336_1095307_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.7	9.6e-263
WP_001102145.1|1095236_1095785_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	6.1e-58
WP_001329960.1|1096172_1096358_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|1096490_1096631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071587457.1|1097043_1097229_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	9.9e-21
WP_001280932.1|1097451_1097583_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001151823.1|1097597_1097780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092910.1|1097936_1098470_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_000551290.1|1098598_1098913_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_000731196.1|1098922_1099729_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	99.6	4.8e-152
WP_000284510.1|1099733_1099949_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_104858317.1|1100099_1101953_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	91.7	0.0e+00
WP_104858318.1|1102742_1103792_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	90.5	1.3e-186
WP_000917767.1|1103942_1104140_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_002461075.1|1104839_1106036_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	3.7e-233
WP_001204795.1|1106395_1106788_-	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	57.6	2.7e-36
WP_089633252.1|1106805_1107795_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	4.9e-191
WP_001065351.1|1107847_1108105_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	70.1	1.6e-21
WP_000203849.1|1108101_1109502_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	1.4e-244
WP_000988266.1|1109498_1110398_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_032186468.1|1110408_1111401_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.4	4.6e-56
WP_032186469.1|1111397_1111697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|1111693_1111918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032186470.1|1111914_1112109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032186471.1|1112105_1112957_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	66.2	1.1e-93
WP_001090258.1|1113065_1113773_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	91.1	3.9e-118
WP_000838344.1|1114108_1114765_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
WP_021556323.1|1114868_1115369_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	96.2	1.8e-64
WP_000141093.1|1115659_1115866_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
WP_032202504.1|1116060_1116249_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	3.0e-09
WP_001199104.1|1116254_1116836_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	65.1	1.9e-70
WP_000179800.1|1117084_1117402_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
WP_001378249.1|1117355_1117670_+	hypothetical protein	NA	B1GS43	Salmonella_phage	84.9	6.1e-39
WP_104858319.1|1117656_1118343_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	2.3e-38
WP_001289973.1|1118339_1118825_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.1e-42
WP_104858320.1|1119338_1120283_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	58.9	2.6e-80
WP_000457723.1|1120367_1120610_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030157.1|1120613_1120748_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.5	1.9e-21
WP_001193437.1|1120766_1121021_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063640.1|1121054_1122341_+|integrase	site-specific integrase	integrase	H6WZF6	Escherichia_phage	99.8	1.3e-252
WP_032300430.1|1122361_1123063_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.9	8.8e-102
1122379:1122399	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|1123122_1123230_+	protein YohO	NA	NA	NA	NA	NA
WP_000783134.1|1123210_1123942_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|1123946_1124873_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 69
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1145194	1146715	5492922		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|1145194_1146715_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 70
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1150409	1151078	5492922		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|1150409_1151078_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 71
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1158251	1159109	5492922		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|1158251_1159109_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 72
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1173603	1177904	5492922		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091917.1|1173603_1175070_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.5e-42
WP_000198839.1|1175187_1176174_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001297918.1|1176212_1176926_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1177337_1177904_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 73
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1183658	1191307	5492922		Vibrio_phage(50.0%)	7	NA	NA
WP_000194914.1|1183658_1185248_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|1185251_1185596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|1185928_1187119_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|1187146_1187842_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|1187991_1189752_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494186.1|1189876_1190161_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1190299_1191307_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 74
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1203005	1203623	5492922		Bacillus_virus(100.0%)	1	NA	NA
WP_001328413.1|1203005_1203623_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 75
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1212389	1218158	5492922		Bacillus_phage(25.0%)	5	NA	NA
WP_000422197.1|1212389_1214033_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
WP_000884957.1|1214108_1214759_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786434.1|1214758_1215823_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.5	3.1e-18
WP_000406119.1|1215896_1216952_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865539.1|1217063_1218158_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	2.0e-116
>prophage 76
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1222321	1227164	5492922		Hokovirus(50.0%)	2	NA	NA
WP_000876029.1|1222321_1225171_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.5	8.4e-42
WP_000559127.1|1225337_1227164_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
>prophage 77
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1242087	1253827	5492922		Pseudomonas_phage(40.0%)	6	NA	NA
WP_001281220.1|1242087_1244715_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.9e-88
WP_000990772.1|1244861_1245584_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_021519829.1|1245644_1249373_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.6	1.6e-21
WP_001075170.1|1250068_1252354_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|1252442_1253573_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135039.1|1253572_1253827_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
>prophage 78
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1258588	1259665	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779071.1|1258588_1259665_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 79
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1265557	1269872	5492922	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_001551378.1|1265557_1266460_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	45.2	7.4e-69
WP_000992992.1|1266500_1267304_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001551379.1|1267320_1268610_-	MFS transporter	NA	NA	NA	NA	NA
WP_001551380.1|1268666_1269872_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
>prophage 80
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1273475	1279256	5492922		Tupanvirus(50.0%)	4	NA	NA
WP_001306469.1|1273475_1274078_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001376970.1|1275162_1276302_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.1	6.5e-30
WP_000461642.1|1276305_1277274_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	4.0e-36
WP_001551384.1|1277273_1279256_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.1e-19
>prophage 81
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1295252	1295711	5492922	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502112.1|1295252_1295711_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
>prophage 82
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1314720	1317948	5492922		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|1314720_1315320_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012889.1|1315378_1317211_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001551397.1|1317297_1317948_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	6.8e-08
>prophage 83
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1328507	1330368	5492922		Sodalis_phage(50.0%)	2	NA	NA
WP_000156122.1|1328507_1329398_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	3.1e-67
WP_001293612.1|1329594_1330368_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 84
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1334579	1336097	5492922		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|1334579_1336097_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 85
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1340591	1391614	5492922	terminase,tail,capsid,tRNA,plate,head,integrase,portal,holin	Enterobacteria_phage(81.25%)	64	1343597:1343616	1381969:1381988
WP_001283590.1|1340591_1341404_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|1341403_1342417_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_072019457.1|1342482_1343640_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.7e-22
1343597:1343616	attL	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_000023401.1|1343798_1344803_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_001390705.1|1344899_1345220_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000004249.1|1345333_1345621_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_000200505.1|1345627_1345834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813366.1|1346086_1346428_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	1.7e-55
WP_000159006.1|1346438_1346726_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.9e-32
WP_000514276.1|1346737_1346980_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000021652.1|1346976_1347090_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|1347176_1347380_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_104858322.1|1347376_1347622_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	86.4	5.1e-33
WP_000599411.1|1347763_1348129_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	3.9e-61
WP_158660452.1|1348135_1350958_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.3	0.0e+00
WP_104858323.1|1351034_1351994_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	1.3e-180
WP_000211251.1|1351998_1352310_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	4.2e-48
WP_001163782.1|1352373_1352706_+	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	96.4	5.5e-54
WP_001080492.1|1352702_1353017_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	94.2	5.5e-48
WP_000206711.1|1353018_1353432_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	49.3	2.2e-20
WP_000224220.1|1353433_1353697_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_000236496.1|1354283_1354808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|1354822_1355869_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_001402977.1|1355868_1357620_-	Terminase ATPase subunit (GpP)	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001262681.1|1357774_1358611_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
WP_104858324.1|1358634_1359687_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	4.1e-188
WP_104858325.1|1359732_1360533_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.7	5.8e-126
WP_000063100.1|1360634_1361129_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|1361128_1361329_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|1361331_1361655_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_032179099.1|1361651_1362044_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.1e-69
WP_000780577.1|1362040_1362436_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_032207317.1|1362574_1364455_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.7	9.3e-300
WP_000921127.1|1364478_1364946_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356371.1|1364938_1365574_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	2.6e-113
WP_001271937.1|1365570_1366152_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-102
WP_001435533.1|1366148_1366499_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
WP_104858326.1|1366502_1367399_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	2.5e-154
WP_001403408.1|1367391_1368000_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.4	5.8e-86
WP_104858327.1|1367996_1369760_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	49.2	5.8e-118
WP_000072167.1|1369759_1370374_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_032143395.1|1370380_1370854_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
WP_001165544.1|1370925_1371525_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
WP_158660453.1|1371551_1372040_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	4.7e-86
WP_104858329.1|1372052_1374860_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.3	0.0e+00
WP_000333503.1|1374846_1375002_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651568.1|1375010_1375385_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.0e-36
WP_000290462.1|1375440_1375953_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005453.1|1375952_1377137_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	4.9e-222
WP_104858330.1|1377294_1378404_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	1.6e-203
WP_000532200.1|1378524_1379547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000488107.1|1379738_1379999_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|1380189_1380330_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001173927.1|1380591_1380924_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000789404.1|1380928_1381822_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_001551404.1|1382089_1383085_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
1381969:1381988	attR	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_000127789.1|1383081_1384260_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|1384525_1385746_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_001551405.1|1385904_1387911_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|1388031_1388310_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089220.1|1388343_1388892_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_033877661.1|1388891_1389701_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001551406.1|1389700_1390525_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001551407.1|1390528_1391614_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
>prophage 86
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1409695	1410628	5492922		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|1409695_1410628_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 87
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1413667	1415101	5492922		Bacillus_phage(100.0%)	1	NA	NA
WP_001551412.1|1413667_1415101_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	5.3e-29
>prophage 88
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1421754	1429330	5492922		Bacillus_phage(50.0%)	4	NA	NA
WP_001551418.1|1421754_1425348_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001314918.1|1425403_1426549_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1426622_1427567_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001551419.1|1427635_1429330_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.4	4.0e-23
>prophage 89
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1433020	1433941	5492922		Morganella_phage(100.0%)	1	NA	NA
WP_001551422.1|1433020_1433941_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.4	3.2e-75
>prophage 90
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1437759	1438494	5492922		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1437759_1438494_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 91
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1465483	1480865	5492922		Streptococcus_phage(33.33%)	15	NA	NA
WP_001551434.1|1465483_1467499_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.3	1.1e-149
WP_001317975.1|1467569_1468568_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1468797_1469559_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1469743_1470715_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1471098_1471356_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|1471400_1473128_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1473168_1473678_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|1473719_1474571_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_001551436.1|1474675_1475044_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001295461.1|1475046_1475958_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_000021031.1|1476091_1477189_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|1477178_1478054_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|1478053_1478887_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290240.1|1478886_1479903_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517443.1|1480073_1480865_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
>prophage 92
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1484343	1489278	5492922		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001520983.1|1484343_1485645_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|1485702_1486602_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|1486697_1487273_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|1487333_1487783_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1487769_1488195_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102892.1|1488408_1489278_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 93
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1508231	1509182	5492922		Cyanophage(100.0%)	1	NA	NA
WP_001003734.1|1508231_1509182_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 94
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1526449	1527163	5492922		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1526449_1527163_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 95
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1548431	1552433	5492922		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|1548431_1549721_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|1549806_1550433_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|1550757_1551795_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028621.1|1551794_1552433_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.9	9.0e-29
>prophage 96
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1558867	1565164	5492922		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|1558867_1559041_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|1559354_1559870_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001551456.1|1559885_1560425_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.3	3.2e-43
WP_001551457.1|1560519_1562097_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1562165_1563632_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_001551458.1|1563793_1565164_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 97
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1573994	1574426	5492922		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1573994_1574426_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 98
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1584295	1590819	5492922		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133560.1|1584295_1585579_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
WP_000523616.1|1585823_1586024_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|1586035_1586371_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196617.1|1586372_1588223_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001551463.1|1588239_1588755_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1588850_1589174_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1589190_1589577_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1589604_1590819_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 99
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1605955	1607467	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493485.1|1605955_1607467_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 100
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1613225	1624533	5492922		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1613225_1614479_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_001551472.1|1614806_1615997_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1616041_1616380_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|1616440_1617775_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215901.1|1617764_1618478_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_019842313.1|1618642_1620070_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.0	1.4e-16
WP_001551475.1|1620645_1624533_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	4.5e-131
>prophage 101
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1628651	1628912	5492922		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|1628651_1628912_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 102
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1632371	1636114	5492922		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1632371_1633052_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1633324_1634299_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1634314_1636114_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 103
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1641885	1714081	5492922	protease,integrase,transposase,tRNA	Escherichia_phage(20.0%)	62	1632800:1632815	1699064:1699079
1632800:1632815	attL	CCAGTTCTGCCAGCGT	NA	NA	NA	NA
WP_000219193.1|1641885_1643220_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001551513.1|1643252_1644134_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001521088.1|1644236_1644824_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1644885_1645269_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262721.1|1645573_1646263_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_001521090.1|1646310_1647348_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1647554_1647974_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001308860.1|1648042_1648741_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001521091.1|1648772_1651433_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1651546_1652902_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001696047.1|1652947_1653271_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|1653267_1654566_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_100190661.1|1654874_1656223_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	5.1e-74
WP_001235102.1|1661805_1664379_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_001551518.1|1664508_1665240_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|1665236_1666217_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1666351_1667089_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1667359_1667701_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|1667804_1667852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|1667950_1669111_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|1669153_1670275_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|1670285_1671356_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_019842457.1|1671564_1671930_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212386.1|1672079_1672598_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001551521.1|1672587_1673814_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|1673829_1674312_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1674388_1674736_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264776.1|1674777_1675545_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1675575_1676124_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1676142_1676391_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_001551524.1|1676639_1678001_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1678167_1678959_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|1678979_1680266_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001307957.1|1680319_1680913_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|1681035_1681914_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001551525.1|1681999_1683661_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1683809_1684151_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117840.1|1684212_1684503_-	RnfH family protein	NA	NA	NA	NA	NA
WP_001551526.1|1684492_1684969_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1685100_1685583_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_049041147.1|1686283_1687555_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	90.9	4.8e-215
WP_042193563.1|1687655_1688126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057057019.1|1688142_1689297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042193569.1|1689289_1691164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042193573.1|1691156_1691654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032664200.1|1691771_1692221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239590.1|1695074_1695950_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|1695996_1696329_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000616807.1|1699236_1699890_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1699064:1699079	attR	ACGCTGGCAGAACTGG	NA	NA	NA	NA
WP_000557619.1|1699982_1700240_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|1700172_1700574_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|1700710_1703608_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|1703702_1704308_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	31.2	1.9e-12
WP_001351729.1|1705084_1705477_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|1705614_1706499_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|1706530_1707730_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|1707835_1708486_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|1708517_1708760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|1710381_1711086_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|1711229_1711784_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|1711914_1712745_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|1713376_1714081_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 104
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1738883	1742935	5492922		Klosneuvirus(50.0%)	4	NA	NA
WP_001551531.1|1738883_1740164_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	5.4e-33
WP_001295173.1|1740401_1741802_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1741822_1742485_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522413.1|1742485_1742935_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
>prophage 105
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1748741	1754039	5492922		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1748741_1748987_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001551533.1|1748983_1749394_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.5	3.9e-17
WP_001551534.1|1749366_1751511_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	3.8e-196
WP_001521117.1|1751520_1752480_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
WP_000985490.1|1752836_1754039_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 106
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1767022	1772408	5492922	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1767022_1767208_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047168.1|1767442_1770073_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|1770200_1770701_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1770769_1771831_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1771910_1772408_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 107
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1777875	1778841	5492922		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|1777875_1778841_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 108
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1786254	1787268	5492922		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001551541.1|1786254_1787268_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.3e-26
>prophage 109
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1806373	1814290	5492922		Escherichia_phage(83.33%)	6	NA	NA
WP_001272891.1|1806373_1808935_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
WP_001141345.1|1809040_1809697_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|1810524_1811292_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847985.1|1811487_1812396_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001551546.1|1812392_1813655_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_001278994.1|1813651_1814290_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 110
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1819504	1823220	5492922		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1819504_1820497_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1820559_1821699_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1821838_1822465_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1822458_1823220_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 111
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1826332	1828365	5492922		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|1826332_1826938_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001551550.1|1826937_1828365_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 112
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1847879	1849227	5492922	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_104858337.1|1847879_1849227_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	1.5e-73
>prophage 113
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1853896	1854682	5492922		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001551559.1|1853896_1854682_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	7.7e-22
>prophage 114
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1859763	1864684	5492922		Vibrio_phage(33.33%)	4	NA	NA
WP_001199973.1|1859763_1860435_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001551561.1|1860728_1861601_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|1861660_1862959_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1863046_1864684_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 115
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1868717	1872832	5492922		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_001551563.1|1868717_1870019_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	9.7e-38
WP_000186450.1|1870075_1872832_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 116
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1880375	1881224	5492922		Vibrio_phage(100.0%)	1	NA	NA
WP_000100411.1|1880375_1881224_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 117
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1886080	1886836	5492922		Bacillus_phage(100.0%)	1	NA	NA
WP_001314973.1|1886080_1886836_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	3.8e-10
>prophage 118
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1898362	1913747	5492922	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001299106.1|1898362_1899568_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
WP_000184256.1|1899567_1900011_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|1900061_1900868_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|1900943_1902041_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|1902619_1903873_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1904104_1905436_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775943.1|1905497_1907324_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	5.9e-25
WP_001551572.1|1907323_1910866_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138160.1|1910858_1913747_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	4.0e-68
>prophage 119
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1919224	1925997	5492922		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1919224_1920019_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1920025_1920901_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|1921051_1923298_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1923310_1923841_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|1924525_1925215_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1925283_1925997_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 120
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1935698	1938834	5492922	transposase	Saccharomonospora_phage(33.33%)	3	NA	NA
WP_000502112.1|1935698_1936157_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
WP_104858338.1|1936339_1937758_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|1938072_1938834_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 121
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1970642	1971395	5492922		Clostridium_phage(100.0%)	1	NA	NA
WP_001309712.1|1970642_1971395_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 122
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	1995675	2011067	5492922	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|1995675_1997076_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_016242984.1|1997093_1998410_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|1998445_1999813_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838435.1|1999848_2000337_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_016234880.1|2000336_2002256_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|2002691_2004140_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|2004141_2004267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2004263_2004335_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192796.1|2004389_2004938_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003333.1|2004980_2006498_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
WP_001701073.1|2006507_2007606_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813179.1|2007696_2009430_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_000715219.1|2009435_2010146_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2010170_2011067_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 123
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2014872	2019343	5492922		Pandoravirus(50.0%)	2	NA	NA
WP_001571859.1|2014872_2016306_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
WP_000195077.1|2016469_2019343_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
>prophage 124
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2027478	2028711	5492922		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2027478_2028711_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 125
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2047795	2048473	5492922		Bacillus_virus(100.0%)	1	NA	NA
WP_104858347.1|2047795_2048473_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	3.8e-09
>prophage 126
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2054175	2055084	5492922		Yersinia_phage(100.0%)	1	NA	NA
WP_000646927.1|2054175_2055084_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	2.0e-53
>prophage 127
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2063177	2125580	5492922	protease,integrase,transposase,tRNA	Enterobacteria_phage(55.56%)	51	2080434:2080448	2089027:2089041
WP_001062128.1|2063177_2064332_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2064767_2066162_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001296359.1|2066238_2066736_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_097497552.1|2066830_2067538_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|2067617_2068349_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|2068361_2069312_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001355636.1|2069420_2069984_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|2069983_2070400_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001546096.1|2070578_2071559_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2071576_2072281_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2072298_2072865_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|2072861_2073152_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174747.1|2073159_2073753_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239978.1|2073745_2074882_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_104858357.1|2074950_2075958_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|2076074_2077121_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2077296_2078016_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107562.1|2078199_2078526_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2078525_2079245_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_021523243.1|2079405_2080458_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
2080434:2080448	attL	GTTACGCACTGGCGC	NA	NA	NA	NA
WP_000091700.1|2080485_2080761_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|2080824_2081904_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001521262.1|2082105_2083362_+	nucleoside permease	NA	NA	NA	NA	NA
WP_104858358.1|2083407_2085543_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|2085940_2086648_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|2087026_2088292_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001521264.1|2088547_2089591_+	hypothetical protein	NA	NA	NA	NA	NA
2089027:2089041	attR	GTTACGCACTGGCGC	NA	NA	NA	NA
WP_001447126.1|2091284_2091836_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000332660.1|2094083_2094683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021516900.1|2094667_2095090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523245.1|2095133_2095637_-	P fimbrial tip protein PapF	NA	NA	NA	NA	NA
WP_001521268.1|2095711_2096233_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001521270.1|2097013_2097583_-	P fimbria major subunit PapA	NA	NA	NA	NA	NA
WP_000006214.1|2098508_2098742_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_000952372.1|2100169_2101342_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|2101341_2102139_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_001513409.1|2102744_2102858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|2104691_2104952_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109148.1|2104993_2105554_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|2105593_2106022_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_104858360.1|2107108_2107534_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	87.6	3.6e-42
WP_016233975.1|2107530_2107881_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.4e-39
WP_104858361.1|2107935_2109149_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.9e-168
WP_000074477.1|2109687_2110881_-	MFS transporter	NA	NA	NA	NA	NA
WP_158660454.1|2111016_2112741_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287501.1|2112741_2113689_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001702845.1|2113688_2115431_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|2115427_2116705_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_021523250.1|2116786_2118988_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_104858362.1|2119944_2123832_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	38.9	2.6e-227
WP_001254932.1|2124428_2125580_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 128
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2132333	2137285	5492922		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001223344.1|2132333_2134424_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000274668.1|2136298_2137285_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
>prophage 129
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2141851	2149297	5492922	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_000376547.1|2141851_2143324_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_001149834.1|2144280_2145198_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_085949591.1|2145349_2145487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435655.1|2145858_2146284_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_000624646.1|2146280_2146631_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000998080.1|2147758_2149297_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.1	3.2e-282
>prophage 130
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2162763	2165561	5492922		Pseudomonas_phage(50.0%)	5	NA	NA
WP_016231181.1|2162763_2163582_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	8.0e-46
WP_000849565.1|2163636_2164122_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001186726.1|2164137_2164614_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692329.1|2164676_2164898_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_000094916.1|2164916_2165561_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.6	1.2e-25
>prophage 131
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2170861	2171845	5492922		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001296394.1|2170861_2171845_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
>prophage 132
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2180404	2185732	5492922		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_001560697.1|2180404_2181574_-	nucleotide sugar dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	3.6e-116
WP_024190280.1|2181683_2182337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001560699.1|2182582_2183692_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	55.4	1.9e-114
WP_001560700.1|2183737_2185732_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	41.0	4.1e-11
>prophage 133
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2189509	2190202	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001560702.1|2189509_2190202_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	9.5e-08
>prophage 134
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2222838	2224011	5492922		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524942.1|2222838_2224011_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 135
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2246186	2247071	5492922		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2246186_2247071_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 136
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2252914	2260233	5492922		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013152.1|2252914_2253742_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691604.1|2253941_2254868_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|2254918_2255176_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095204.1|2255217_2257437_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000438655.1|2257688_2258438_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296416.1|2258760_2260233_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	4.5e-47
>prophage 137
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2267691	2272731	5492922		Bacillus_virus(50.0%)	4	NA	NA
WP_001281848.1|2267691_2269950_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	3.1e-84
WP_001296417.1|2270087_2271695_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183485.1|2271803_2272286_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|2272338_2272731_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 138
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2280574	2293020	5492922		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_000986428.1|2280574_2281558_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
WP_000940874.1|2281554_2282364_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
WP_001240664.1|2282737_2284879_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195296.1|2284942_2286835_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_001551663.1|2286863_2287445_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|2287444_2288272_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2288296_2288719_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2288719_2289349_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|2289553_2291035_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2291182_2291854_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2291859_2293020_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
>prophage 139
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2298912	2299566	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001551665.1|2298912_2299566_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	1.7e-46
>prophage 140
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2303854	2305288	5492922		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2303854_2305288_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 141
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2310425	2311664	5492922	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_001551671.1|2310425_2311664_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 142
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2317966	2334027	5492922	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|2317966_2318980_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|2319217_2319433_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2319543_2321289_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|2321483_2323325_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2323403_2323910_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001551675.1|2324163_2324928_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|2325205_2325829_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094690.1|2325857_2327378_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_001551676.1|2327684_2329175_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.4e-32
WP_000450588.1|2329216_2329549_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212438.1|2329767_2330751_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001551677.1|2330934_2334027_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	5.9e-158
>prophage 143
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2347656	2348622	5492922		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|2347656_2348622_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 144
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2369342	2371637	5492922		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2369342_2371637_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 145
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2379457	2380603	5492922		Streptococcus_phage(100.0%)	1	NA	NA
WP_001309778.1|2379457_2380603_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	4.0e-51
>prophage 146
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2398224	2406029	5492922		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|2398224_2399088_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_001551699.1|2399152_2401189_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246828.1|2401146_2401542_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2401561_2402152_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646049.1|2402161_2402737_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001551701.1|2402858_2403899_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|2403971_2404607_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2404734_2405253_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001551702.1|2405232_2405676_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189315.1|2405726_2406029_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 147
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2411731	2413621	5492922		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2411731_2413621_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 148
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2419102	2425741	5492922		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2419102_2421775_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031055.1|2421799_2423287_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2423314_2423767_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|2424397_2425741_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 149
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2429815	2432688	5492922	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2429815_2430664_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2430753_2432688_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 150
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2439316	2440794	5492922		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2439316_2440288_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445407.1|2440515_2440794_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
>prophage 151
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2444862	2459656	5492922		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2444862_2445672_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_001551707.1|2445881_2446859_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2446872_2447859_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030006.1|2447879_2448446_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	6.5e-55
WP_000030537.1|2448442_2449018_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2448986_2449544_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2449550_2450276_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2450323_2451757_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2451779_2452067_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|2452184_2452676_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2452721_2453576_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2453572_2453845_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620396.1|2454057_2454690_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047064.1|2454686_2455415_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|2455411_2456065_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2456294_2458631_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001551710.1|2458726_2459656_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 152
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2466405	2471138	5492922		Salmonella_phage(50.0%)	5	NA	NA
WP_000445130.1|2466405_2467518_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	89.2	1.2e-73
WP_000979887.1|2467577_2468042_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001551712.1|2468038_2468914_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|2468910_2469600_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001551713.1|2469647_2471138_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 153
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2474843	2475341	5492922	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|2474843_2475341_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 154
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2479307	2481832	5492922	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|2479307_2480675_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|2480764_2481832_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 155
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2498327	2499371	5492922		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2498327_2499371_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 156
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2509935	2510820	5492922		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258949.1|2509935_2510820_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 157
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2517324	2521478	5492922		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738583.1|2517324_2518350_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	40.1	8.1e-72
WP_000019662.1|2518417_2519599_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001308990.1|2519608_2520712_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078348.1|2520719_2521478_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
>prophage 158
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2531984	2533456	5492922	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114986.1|2531984_2532494_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
WP_000004443.1|2532508_2533456_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.1	1.4e-06
>prophage 159
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2553333	2558907	5492922		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|2553333_2554518_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2554588_2556703_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2556799_2557270_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2557366_2557741_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903375.1|2557866_2558154_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820713.1|2558161_2558521_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209685.1|2558520_2558907_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 160
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2564478	2574024	5492922		Tupanvirus(25.0%)	9	NA	NA
WP_001551739.1|2564478_2566398_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	3.3e-74
WP_001551740.1|2566397_2567420_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2567413_2567632_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2567685_2568555_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2568609_2569014_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2569315_2569948_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|2569998_2572089_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_001551741.1|2572151_2573375_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001551743.1|2573460_2574024_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	2.7e-61
>prophage 161
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2592930	2593767	5492922		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2592930_2593767_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 162
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2610744	2615256	5492922		Bacillus_phage(66.67%)	5	NA	NA
WP_001551762.1|2610744_2612367_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.2e-141
WP_000493756.1|2612483_2612801_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650973.1|2612859_2613156_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253707.1|2613187_2614540_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001157751.1|2614536_2615256_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 163
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2621821	2622715	5492922		Sodalis_phage(100.0%)	1	NA	NA
WP_000039100.1|2621821_2622715_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.5e-69
>prophage 164
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2628875	2631269	5492922		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_001551766.1|2628875_2631269_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 165
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2635684	2636911	5492922		Ralstonia_phage(100.0%)	1	NA	NA
WP_001551770.1|2635684_2636911_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	3.4e-133
>prophage 166
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2645818	2648266	5492922		Dickeya_phage(100.0%)	1	NA	NA
WP_000993450.1|2645818_2648266_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 167
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2658595	2660692	5492922		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_001551777.1|2658595_2660692_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	1.0e-41
>prophage 168
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2671704	2673515	5492922		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073563.1|2671704_2672448_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	2.2e-10
WP_000907822.1|2672444_2673515_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 169
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2677962	2679445	5492922		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416901.1|2677962_2678676_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
WP_000082101.1|2678677_2679445_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 170
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2685179	2687998	5492922		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2685179_2686034_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2686278_2687337_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2687329_2687998_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 171
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2691004	2695137	5492922		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2691004_2691631_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_001551784.1|2691704_2693903_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.5	8.5e-119
WP_000130615.1|2694004_2694250_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|2694471_2695137_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 172
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2703030	2708645	5492922		Bacillus_virus(50.0%)	3	NA	NA
WP_001521512.1|2703030_2703837_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
WP_001190062.1|2703841_2704243_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_104858369.1|2704445_2708645_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.8	2.0e-23
>prophage 173
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2712586	2718816	5492922		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_089559472.1|2712586_2713246_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.8	3.7e-25
WP_000649530.1|2713559_2714039_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_001216257.1|2714956_2716081_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001551789.1|2716080_2718816_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 174
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2732226	2734269	5492922		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|2732226_2734269_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 175
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2737617	2739753	5492922		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_001551793.1|2737617_2737971_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	7.4e-25
WP_001551794.1|2738025_2739315_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	6.6e-172
WP_000065800.1|2739327_2739753_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.5e-51
>prophage 176
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2752820	2754290	5492922		Pithovirus(50.0%)	2	NA	NA
WP_001521540.1|2752820_2753591_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
WP_032284189.1|2753642_2754290_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.7	3.0e-16
>prophage 177
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2801187	2803172	5492922		Bacillus_virus(50.0%)	2	NA	NA
WP_000103574.1|2801187_2802192_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196487.1|2802188_2803172_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 178
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2813281	2815615	5492922		Escherichia_phage(100.0%)	1	NA	NA
WP_001551816.1|2813281_2815615_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	1.2e-70
>prophage 179
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2819269	2821293	5492922	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|2819269_2819482_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_019842825.1|2819669_2819822_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085948682.1|2819923_2821293_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 180
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2825158	2826154	5492922		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001551822.1|2825158_2826154_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	28.1	9.1e-12
>prophage 181
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2831471	2833013	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146509.1|2831471_2833013_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 182
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2854483	2855096	5492922		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000499744.1|2854483_2854894_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	6.4e-20
WP_000833473.1|2854910_2855096_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	54.2	4.4e-13
>prophage 183
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2858444	2866754	5492922	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_001551838.1|2858444_2860289_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
WP_000206248.1|2860285_2861677_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|2861774_2862383_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_104858373.1|2862611_2866754_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	7.4e-23
>prophage 184
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2889043	2898550	5492922		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2889043_2889295_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156174.1|2889436_2889868_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|2890112_2891657_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214156.1|2891666_2892950_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001551846.1|2892953_2893913_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982075.1|2893899_2894934_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	1.3e-08
WP_000646014.1|2895172_2896198_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|2896207_2897404_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|2897617_2898550_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 185
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2901904	2903738	5492922		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_001052917.1|2901904_2902678_-	glycosyltransferase family 25 protein	NA	A0A0P0YNC5	Yellowstone_lake_phycodnavirus	33.7	7.6e-06
WP_000364807.1|2902709_2903738_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.6e-11
>prophage 186
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2911176	2915739	5492922		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|2911176_2911656_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114542.1|2911694_2912504_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
WP_001051798.1|2912601_2912769_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2912789_2913026_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2913242_2913911_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050171.1|2914082_2915303_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_001298007.1|2915283_2915739_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 187
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2919112	2925862	5492922		Morganella_phage(25.0%)	6	NA	NA
WP_001551850.1|2919112_2919937_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	79.0	1.2e-97
WP_000924289.1|2920227_2920845_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001445719.1|2920841_2922524_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	2.5e-22
WP_001295237.1|2922781_2923405_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2923459_2923735_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2923753_2925862_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 188
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2930163	2931555	5492922		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2930163_2931555_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 189
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2970284	2971619	5492922		Moraxella_phage(100.0%)	1	NA	NA
WP_001551896.1|2970284_2971619_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	3.0e-66
>prophage 190
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2982423	2991444	5492922		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_001551901.1|2982423_2984112_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	9.3e-57
WP_001300753.1|2984217_2984316_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|2984880_2984970_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001306726.1|2985249_2986434_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_001551902.1|2986441_2986939_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2986935_2987298_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703955.1|2987287_2987635_-	YidH family protein	NA	NA	NA	NA	NA
WP_001551904.1|2987742_2988192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551905.1|2988238_2989732_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.6	6.6e-30
WP_001551906.1|2989728_2991444_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	3.3e-41
>prophage 191
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	2998304	2999258	5492922		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|2998304_2998733_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2998844_2999258_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 192
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3003685	3004834	5492922		Oenococcus_phage(100.0%)	1	NA	NA
WP_001551912.1|3003685_3004834_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 193
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3009538	3016907	5492922		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|3009538_3011953_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|3011981_3013055_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3013054_3014155_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3014159_3015563_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|3015859_3015940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|3016169_3016310_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3016326_3016686_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3016649_3016907_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 194
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3029581	3030919	5492922		Moraxella_phage(100.0%)	1	NA	NA
WP_001316740.1|3029581_3030919_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 195
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3039926	3047398	5492922		Bacillus_phage(50.0%)	7	NA	NA
WP_000063125.1|3039926_3040700_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|3040790_3041681_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3041680_3042640_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867161.1|3042726_3043767_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_001353740.1|3044569_3044809_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000777554.1|3046305_3046779_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000704156.1|3046873_3047398_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
>prophage 196
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3058152	3061514	5492922		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334086.1|3058152_3059982_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_001551936.1|3060143_3061514_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
>prophage 197
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3073468	3074461	5492922		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|3073468_3074461_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 198
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3077629	3083482	5492922		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3077629_3079498_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|3079664_3080084_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_001551940.1|3080091_3081597_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.6e-15
WP_000211858.1|3081601_3082567_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3082591_3083482_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 199
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3096876	3098523	5492922		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001551957.1|3096876_3098523_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
>prophage 200
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3106851	3112265	5492922		Bacillus_phage(33.33%)	4	NA	NA
WP_001238886.1|3106851_3108873_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_104858377.1|3108919_3110404_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3110539_3111805_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3111935_3112265_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 201
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3116295	3122439	5492922		Enterobacteria_phage(40.0%)	6	NA	NA
WP_001551962.1|3116295_3117426_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.4	1.5e-26
WP_001551963.1|3117422_3118685_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	9.2e-25
WP_001551965.1|3118684_3119752_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	5.1e-101
WP_000676062.1|3119770_3120652_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	2.5e-106
WP_001145185.1|3120629_3121304_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_001551966.1|3121308_3122439_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 202
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3130457	3132113	5492922		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395844.1|3130457_3132113_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 203
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3142432	3146291	5492922		Bacillus_phage(100.0%)	3	NA	NA
WP_001551974.1|3142432_3143329_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	5.0e-25
WP_001213584.1|3143328_3144045_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|3144128_3146291_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 204
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3153667	3155497	5492922		Catovirus(100.0%)	1	NA	NA
WP_024186454.1|3153667_3155497_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 205
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3170135	3173422	5492922		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187543.1|3170135_3171776_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|3171854_3172124_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|3172127_3172643_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3172645_3173422_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 206
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3182211	3182826	5492922		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|3182211_3182826_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 207
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3196512	3199299	5492922		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|3196512_3199299_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 208
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3203377	3205848	5492922		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|3203377_3204787_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3204798_3205848_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 209
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3222843	3225623	5492922		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|3222843_3223740_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_001521800.1|3223907_3224804_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3224837_3225623_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 210
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3237132	3240183	5492922		Escherichia_phage(100.0%)	1	NA	NA
WP_077626238.1|3237132_3240183_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 211
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3256717	3261728	5492922		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|3256717_3257338_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166043.1|3257597_3258581_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270252.1|3258729_3259404_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3259659_3261033_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3261029_3261728_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 212
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3273302	3277805	5492922		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3273302_3274148_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3274572_3274818_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3274902_3275388_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3275480_3276407_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3276473_3277805_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 213
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3283442	3287672	5492922		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_104858380.1|3283442_3287672_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	6.4e-22
>prophage 214
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3307617	3314864	5492922		Synechococcus_phage(33.33%)	5	NA	NA
WP_001550384.1|3307617_3308280_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.7e-28
WP_001185146.1|3308291_3310793_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|3311101_3312181_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3312195_3312516_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001550385.1|3312566_3314864_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 215
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3329632	3331147	5492922		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_019842605.1|3329632_3331147_+	sugar ABC transporter ATP-binding protein	NA	A7IVC2	Paramecium_bursaria_Chlorella_virus	22.8	1.0e-06
>prophage 216
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3336038	3337253	5492922		Oenococcus_phage(100.0%)	1	NA	NA
WP_001550400.1|3336038_3337253_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 217
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3344005	3345850	5492922		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001366808.1|3344005_3345850_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 218
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3354192	3357245	5492922		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023085.1|3354192_3355143_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
WP_000031784.1|3356060_3357245_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 219
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3361361	3369690	5492922		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3361361_3365390_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3365466_3369690_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 220
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3378907	3380671	5492922		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3378907_3379579_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|3379621_3380212_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3380398_3380671_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 221
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3386060	3387650	5492922		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001550410.1|3386060_3387650_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 222
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3403575	3407259	5492922		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|3403575_3407259_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 223
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3430689	3431805	5492922		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3430689_3431805_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 224
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3440929	3441538	5492922		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3440929_3441538_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 225
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3448105	3450653	5492922		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3448105_3449521_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001550427.1|3449573_3450653_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	6.8e-29
>prophage 226
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3454859	3458473	5492922		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3454859_3457682_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3457936_3458473_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 227
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3462290	3463640	5492922		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3462290_3463640_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 228
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3469250	3471209	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001550433.1|3469250_3471209_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.7	8.7e-91
>prophage 229
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3480493	3482641	5492922		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3480493_3482641_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 230
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3487886	3489872	5492922		Tetraselmis_virus(100.0%)	1	NA	NA
WP_104858383.1|3487886_3489872_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	4.6e-148
>prophage 231
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3493806	3495356	5492922		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_001564234.1|3493806_3494487_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	7.1e-08
WP_001075519.1|3494597_3495356_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
>prophage 232
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3500915	3501704	5492922		Pithovirus(100.0%)	1	NA	NA
WP_001193403.1|3500915_3501704_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	3.2e-12
>prophage 233
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3506543	3508046	5492922		Burkholderia_virus(100.0%)	1	NA	NA
WP_001305708.1|3506543_3508046_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	7.0e-56
>prophage 234
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3529254	3532466	5492922	tRNA	Catovirus(50.0%)	2	NA	NA
WP_104858385.1|3529254_3530772_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.2	2.0e-87
WP_001550473.1|3531008_3532466_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	1.2e-47
>prophage 235
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3546742	3548726	5492922		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3546742_3547036_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3547079_3548726_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 236
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3552929	3553463	5492922		Morganella_phage(100.0%)	1	NA	NA
WP_001550477.1|3552929_3553463_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 237
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3558382	3559360	5492922		Tupanvirus(100.0%)	1	NA	NA
WP_001550479.1|3558382_3559360_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	4.0e-28
>prophage 238
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3567078	3567624	5492922		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3567078_3567624_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 239
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3571660	3584692	5492922	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990303.1|3571660_3572998_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001550486.1|3573007_3574855_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280339.1|3574847_3575798_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3575883_3576192_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3576268_3577549_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3577634_3578894_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3578896_3579901_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3579982_3580180_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3580283_3581582_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3581786_3582212_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076315.1|3582250_3584692_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 240
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3588535	3589699	5492922		Ralstonia_phage(100.0%)	1	NA	NA
WP_001550491.1|3588535_3589699_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
>prophage 241
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3603993	3605202	5492922	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_104858386.1|3603993_3605202_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	6.6e-206
>prophage 242
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3626476	3693662	5492922	protease,integrase,transposase,tRNA	Escherichia_phage(20.0%)	66	3661325:3661339	3685223:3685237
WP_000055075.1|3626476_3627007_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|3627316_3628273_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001550506.1|3628404_3629907_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.2e-10
WP_001550507.1|3629920_3630943_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001550508.1|3630929_3631925_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3631957_3632956_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001522402.1|3633131_3634505_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|3634654_3635206_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162173.1|3635299_3636652_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|3636834_3637221_+	cytochrome b562	NA	NA	NA	NA	NA
WP_000212715.1|3637412_3637655_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
WP_001105433.1|3637644_3637935_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_001009182.1|3637935_3638400_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_000187798.1|3638579_3640718_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001550509.1|3641111_3642767_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|3642816_3644238_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181335.1|3644356_3645304_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|3645488_3645542_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001550510.1|3645682_3648379_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	2.0e-45
WP_000047539.1|3648584_3648971_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3649043_3649505_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3649517_3650453_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|3650456_3650591_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230272.1|3650871_3651267_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500695.1|3651397_3652111_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001550511.1|3652181_3652775_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001305652.1|3652919_3653372_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001550512.1|3653494_3655162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550513.1|3655219_3656224_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|3656385_3656802_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059402.1|3656847_3657351_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001550514.1|3657543_3658740_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416382.1|3658793_3661649_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
3661325:3661339	attL	CTTCGCGGCCGTAGT	NA	NA	NA	NA
WP_001188293.1|3661648_3662131_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3662225_3663737_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3664003_3665104_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3665103_3666186_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001550515.1|3666346_3667849_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.0e-83
WP_001309159.1|3667926_3668925_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128343.1|3668991_3670311_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998698.1|3670375_3671140_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197412.1|3671163_3672195_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|3672411_3672975_+	gluconokinase	NA	NA	NA	NA	NA
WP_001519241.1|3672978_3673998_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_001550516.1|3674463_3675729_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.7	6.5e-79
WP_001550332.1|3677073_3678612_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	9.3e-298
WP_000612591.1|3678661_3679009_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_158660456.1|3679005_3679443_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	3.9e-68
WP_001067855.1|3679448_3680153_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_104858388.1|3680129_3680321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004743240.1|3680776_3681103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|3681290_3682106_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|3682192_3682495_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|3682388_3682640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|3682670_3684164_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|3684374_3684599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|3684595_3685333_-	recombinase family protein	NA	NA	NA	NA	NA
3685223:3685237	attR	CTTCGCGGCCGTAGT	NA	NA	NA	NA
WP_001044210.1|3685818_3685959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|3686494_3687199_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000113282.1|3687210_3687867_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|3687962_3689147_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_001550555.1|3689241_3689532_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	41.8	5.2e-08
WP_000027057.1|3689626_3690487_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|3690978_3691683_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_021553079.1|3692250_3692910_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	98.6	1.6e-129
WP_001067855.1|3692957_3693662_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 243
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3698096	3698651	5492922		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151839.1|3698096_3698651_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	4.6e-37
>prophage 244
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3704413	3705874	5492922		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|3704413_3705874_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 245
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3715445	3726220	5492922	transposase	Escherichia_phage(25.0%)	8	NA	NA
WP_001067855.1|3715445_3716150_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001535800.1|3716320_3717601_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000181193.1|3717785_3718706_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
WP_000199350.1|3718835_3719006_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000132607.1|3719389_3719728_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_001534836.1|3719942_3723206_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.8	1.5e-47
WP_001534837.1|3723300_3724611_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001550561.1|3724600_3726220_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	22.4	8.5e-07
>prophage 246
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3731902	3737267	5492922		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919568.1|3731902_3733567_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_001534847.1|3733615_3734977_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|3735191_3736106_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106043.1|3736244_3737267_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 247
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3740492	3741772	5492922		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3740492_3741230_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001535806.1|3741232_3741772_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
>prophage 248
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3749601	3752477	5492922		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|3749601_3751191_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|3751583_3752189_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3752315_3752477_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 249
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3757981	3759304	5492922		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477829.1|3757981_3759304_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	5.2e-79
>prophage 250
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3766024	3767257	5492922		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093813.1|3766024_3767257_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 251
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3771531	3775347	5492922		Klosneuvirus(50.0%)	2	NA	NA
WP_000046743.1|3771531_3773199_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	8.3e-42
WP_000409451.1|3773409_3775347_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 252
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3778533	3780647	5492922		Bacillus_phage(50.0%)	2	NA	NA
WP_001188679.1|3778533_3779223_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219577.1|3779222_3780647_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	1.2e-09
>prophage 253
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3792302	3802817	5492922	transposase	Cyanophage(16.67%)	10	NA	NA
WP_000130187.1|3792302_3793256_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|3793370_3793958_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3793992_3794559_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|3794707_3795421_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843562.1|3795446_3795851_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3796226_3798143_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3798231_3799362_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|3799465_3799675_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_085948682.1|3799717_3801087_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
WP_000681360.1|3801650_3802817_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 254
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3809786	3812603	5492922	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286869.1|3809786_3812603_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	4.6e-77
>prophage 255
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3817009	3818158	5492922		Halovirus(100.0%)	1	NA	NA
WP_001445800.1|3817009_3818158_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 256
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3823658	3829319	5492922		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001596503.1|3823658_3825212_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.2e-34
WP_000349954.1|3825285_3826503_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3826631_3827774_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787111.1|3827804_3829319_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 257
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3837213	3839161	5492922		Bacillus_phage(50.0%)	3	NA	NA
WP_000624375.1|3837213_3837693_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|3837778_3838012_+	antitoxin	NA	NA	NA	NA	NA
WP_000257195.1|3838312_3839161_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 258
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3848249	3853671	5492922		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_023154085.1|3848249_3851156_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_001520465.1|3851319_3853671_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	3.9e-37
>prophage 259
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3859991	3860690	5492922		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|3859991_3860690_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 260
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3874169	3875894	5492922		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425664.1|3874169_3875894_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 261
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3901876	3902920	5492922		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|3901876_3902920_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 262
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3907166	3907718	5492922		Sphingobium_phage(100.0%)	1	NA	NA
WP_001550610.1|3907166_3907718_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.4	1.1e-11
>prophage 263
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3916345	3917770	5492922		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3916345_3917770_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 264
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3925536	3932004	5492922		Mamastrovirus(33.33%)	5	NA	NA
WP_001550615.1|3925536_3927087_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	4.6e-18
WP_001306211.1|3927133_3929524_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3929729_3930266_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3930306_3930969_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3931077_3932004_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 265
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3935265	3936210	5492922	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_104858391.1|3935265_3936210_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	5.9e-61
>prophage 266
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3945696	3952502	5492922	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174642.1|3945696_3947115_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_001550621.1|3947153_3948080_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3948116_3948572_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396050.1|3948749_3949454_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294687.1|3949468_3949999_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001550622.1|3950072_3952502_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.9	1.1e-39
>prophage 267
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3957589	3958387	5492922		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3957589_3958387_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 268
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3964298	3964643	5492922		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3964298_3964643_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 269
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3968572	3969997	5492922	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|3968572_3969997_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 270
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	3981844	4056498	5492922	protease,plate,transposase,tRNA	Flavobacterium_phage(11.11%)	59	NA	NA
WP_001295562.1|3981844_3982603_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_019842250.1|3982615_3983473_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001520521.1|3983484_3984837_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3984866_3987299_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3987420_3987906_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139287.1|3987909_3988935_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3989039_3989495_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3989498_3990287_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_001550626.1|3990286_3991435_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_001550627.1|3991431_3992028_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	7.9e-27
WP_001294781.1|3992064_3995547_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	2.2e-209
WP_000055748.1|3995559_3996519_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|3996616_3998758_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|3998814_3999204_+	VOC family protein	NA	NA	NA	NA	NA
WP_001550628.1|3999268_4000567_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062311.1|4000615_4000876_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4000862_4001063_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185287.1|4001228_4001774_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|4001770_4002193_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239188.1|4002206_4002917_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001550629.1|4002947_4003772_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260708.1|4003824_4005543_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094022.1|4005653_4006361_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4006357_4006762_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|4006879_4007695_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4007734_4008388_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4008380_4009412_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|4009598_4010171_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997053.1|4015933_4016737_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|4016733_4017648_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4017888_4018689_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001550637.1|4018766_4019537_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4019583_4020942_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052732.1|4021013_4021769_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|4021802_4022525_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4022521_4022989_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|4023053_4023785_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001086163.1|4024323_4025109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236629.1|4025257_4025725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908071.1|4025734_4026649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|4026692_4027175_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001563736.1|4027198_4028551_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_122989438.1|4028561_4031996_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240537.1|4032104_4033517_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001550641.1|4033521_4034265_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_032179994.1|4034261_4037081_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.1	5.9e-80
WP_001521863.1|4037089_4037851_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246418.1|4037855_4039187_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4039189_4039714_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001550643.1|4039710_4040991_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348804.1|4041015_4042098_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_104858392.1|4042061_4043912_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001521866.1|4043915_4044329_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001550644.1|4044335_4045811_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521869.1|4045861_4046086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550646.1|4046120_4046621_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|4047317_4047836_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001077735.1|4054763_4055141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104858393.1|4055361_4056498_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 271
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4061046	4064258	5492922		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|4061046_4061625_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4061729_4062497_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4062467_4063208_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001550651.1|4063499_4064258_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 272
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4074716	4078428	5492922		Streptococcus_phage(66.67%)	3	NA	NA
WP_000749881.1|4074716_4075772_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|4076059_4077163_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_001550659.1|4077174_4078428_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
>prophage 273
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4090064	4092263	5492922		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001550666.1|4090064_4092263_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	7.4e-38
>prophage 274
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4110484	4111336	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001550672.1|4110484_4111336_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.3	2.6e-47
>prophage 275
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4117380	4120685	5492922		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001309281.1|4117380_4118250_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.2e-52
WP_001306921.1|4118409_4119003_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|4119014_4119251_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001543522.1|4119359_4120685_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 276
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4126260	4132180	5492922	holin	Catovirus(50.0%)	4	NA	NA
WP_001550677.1|4126260_4127931_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	4.0e-60
WP_001550678.1|4127944_4129417_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001376735.1|4129430_4130018_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131040.1|4130146_4132180_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 277
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4144861	4149399	5492922		Bacillus_virus(50.0%)	4	NA	NA
WP_001550685.1|4144861_4146346_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	1.0e-11
WP_000818889.1|4146338_4147310_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001550686.1|4147306_4148263_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001550687.1|4148349_4149399_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	2.2e-72
>prophage 278
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4157779	4163374	5492922		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010270.1|4157779_4159666_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
WP_000076225.1|4159902_4161162_+	cytosine permease	NA	NA	NA	NA	NA
WP_001550690.1|4161151_4162435_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_001550692.1|4162474_4163374_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 279
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4167047	4168172	5492922	integrase	Ralstonia_phage(100.0%)	1	4160926:4160939	4170790:4170803
4160926:4160939	attL	GACTATCTGATGAA	NA	NA	NA	NA
WP_001419915.1|4167047_4168172_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	37.9	9.9e-39
WP_001419915.1|4167047_4168172_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	37.9	9.9e-39
4170790:4170803	attR	GACTATCTGATGAA	NA	NA	NA	NA
>prophage 280
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4171918	4174075	5492922		Streptococcus_phage(100.0%)	1	NA	NA
WP_001420449.1|4171918_4174075_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	26.0	1.4e-33
>prophage 281
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4179007	4185794	5492922	transposase	Salmonella_phage(33.33%)	3	NA	NA
WP_000608644.1|4179007_4180270_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001550695.1|4181514_4184589_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.0	0.0e+00
WP_019842507.1|4184711_4185794_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.7	2.2e-192
>prophage 282
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4191204	4193165	5492922		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_001550700.1|4191204_4192155_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001550701.1|4192151_4193165_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	7.1e-44
>prophage 283
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4196244	4197354	5492922		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4196244_4197354_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 284
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4202646	4203414	5492922		Planktothrix_phage(100.0%)	1	NA	NA
WP_001550706.1|4202646_4203414_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	1.2e-24
>prophage 285
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4210283	4211441	5492922		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001550711.1|4210283_4211441_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 286
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4218854	4219970	5492922		Bacillus_phage(100.0%)	1	NA	NA
WP_000484041.1|4218854_4219970_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 287
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4224256	4236607	5492922	transposase	Bacillus_phage(50.0%)	9	NA	NA
WP_001366457.1|4224256_4225168_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001550716.1|4225292_4226201_+	fructokinase	NA	NA	NA	NA	NA
WP_001304835.1|4226343_4227528_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001550718.1|4227653_4230797_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001550719.1|4230793_4231996_-	exonuclease subunit SbcD	NA	L0LAJ8	Bacillus_phage	25.1	9.1e-06
WP_000113933.1|4232185_4232875_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|4232932_4234228_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000149639.1|4234634_4235954_+	branched-chain amino acid transporter carrier protein BrnQ	NA	NA	NA	NA	NA
WP_000502112.1|4236148_4236607_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
>prophage 288
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4243679	4254354	5492922	transposase,tRNA	uncultured_Mediterranean_phage(50.0%)	10	NA	NA
WP_000667319.1|4243679_4244807_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4244829_4245162_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4245189_4247037_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4247047_4248019_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4248147_4248495_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4248618_4249503_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_104858395.1|4250706_4251915_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	3.2e-208
WP_000543535.1|4252238_4252688_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150479.1|4252691_4253795_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	2.2e-54
WP_001021161.1|4253883_4254354_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 289
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4277711	4282758	5492922	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4277711_4278335_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4278460_4279735_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4279922_4282277_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4282485_4282758_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 290
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4285898	4294175	5492922	transposase	Bacillus_phage(50.0%)	7	NA	NA
WP_000817229.1|4285898_4286594_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
WP_001238217.1|4286658_4288359_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001309304.1|4288458_4289277_+	HMP-PP phosphatase	NA	NA	NA	NA	NA
WP_000502112.1|4289460_4289919_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
WP_000884589.1|4290140_4290599_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001550738.1|4290628_4292401_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.0e-49
WP_001550739.1|4292393_4294175_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.8e-42
>prophage 291
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4303011	4306161	5492922		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|4303011_4306161_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 292
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4312999	4321457	5492922		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4312999_4313551_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|4313679_4315611_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4315663_4315993_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4315992_4316598_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|4316707_4318582_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|4318762_4319407_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250117.1|4319538_4320501_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000764314.1|4320497_4321457_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.7	7.2e-14
>prophage 293
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4329989	4332494	5492922		uncultured_virus(100.0%)	1	NA	NA
WP_001550745.1|4329989_4332494_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.6	7.7e-116
>prophage 294
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4355762	4357925	5492922		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001550749.1|4355762_4357925_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.9	1.9e-17
>prophage 295
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4363628	4364306	5492922		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|4363628_4364306_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 296
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4367442	4368129	5492922		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|4367442_4368129_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 297
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4375036	4376818	5492922		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001305518.1|4375036_4376818_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 298
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4383009	4384155	5492922		Streptococcus_phage(100.0%)	1	NA	NA
WP_001550755.1|4383009_4384155_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	4.1e-48
>prophage 299
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4395576	4398707	5492922	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|4395576_4396962_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001522081.1|4396997_4397519_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190286.1|4397626_4397839_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4397840_4398707_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 300
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4423601	4428361	5492922		Ralstonia_phage(33.33%)	3	NA	NA
WP_089570751.1|4423601_4425503_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	8.6e-27
WP_000253856.1|4426239_4427688_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.5	1.7e-11
WP_000770953.1|4427677_4428361_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 301
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4431506	4434650	5492922		Leptospira_phage(100.0%)	1	NA	NA
WP_001550776.1|4431506_4434650_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 302
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4445590	4451633	5492922		Tupanvirus(50.0%)	3	NA	NA
WP_001550785.1|4445590_4449472_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.7	4.4e-62
WP_001550786.1|4449687_4450821_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140646.1|4450817_4451633_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 303
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4465939	4467762	5492922		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|4465939_4466569_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029782.1|4466541_4467762_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	6.1e-58
>prophage 304
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4470870	4472985	5492922		Bacillus_virus(50.0%)	2	NA	NA
WP_001366511.1|4470870_4472436_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.9e-44
WP_001308472.1|4472556_4472985_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
>prophage 305
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4487074	4487721	5492922		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4487074_4487284_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4487337_4487721_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 306
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4492540	4494980	5492922		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4492540_4493752_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231416.1|4493891_4494980_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 307
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4501990	4507113	5492922	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001157896.1|4501990_4504573_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
WP_001044880.1|4504807_4505290_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207528.1|4505334_4506270_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4506387_4507113_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 308
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4512996	4514076	5492922		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4512996_4514076_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 309
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4518172	4519837	5492922		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000337082.1|4518172_4519837_-	asparagine synthase B	NA	E5EQ62	Micromonas_sp._RCC1109_virus	38.5	1.4e-84
>prophage 310
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4524463	4528277	5492922	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023126.1|4524463_4526410_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
WP_001287134.1|4526612_4528277_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 311
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4532430	4533195	5492922		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001550797.1|4532430_4533195_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	5.8e-06
>prophage 312
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4539850	4558192	5492922		Hokovirus(28.57%)	13	NA	NA
WP_001550800.1|4539850_4540528_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.1	2.6e-26
WP_001328700.1|4540524_4543209_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	2.5e-11
WP_001550801.1|4543201_4543774_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001550802.1|4543782_4545831_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.7	7.1e-27
WP_001550803.1|4545853_4547527_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4547526_4547616_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424926.1|4547928_4548135_+	YbfA family protein	NA	NA	NA	NA	NA
WP_104858399.1|4548382_4552534_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.1e-23
WP_000720081.1|4552530_4553034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136512020.1|4553151_4553727_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	37.5	6.9e-20
WP_001522578.1|4554743_4555253_+	YbgA family protein	NA	NA	NA	NA	NA
WP_001550810.1|4555249_4556668_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	5.6e-63
WP_001550812.1|4556710_4558192_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 313
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4561570	4562362	5492922		Kaumoebavirus(100.0%)	1	NA	NA
WP_104858400.1|4561570_4562362_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.9	2.6e-09
>prophage 314
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4606296	4609816	5492922		Vibrio_phage(33.33%)	4	NA	NA
WP_001550829.1|4606296_4607016_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	1.4e-22
WP_001550830.1|4607012_4607954_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	1.3e-23
WP_000784342.1|4608067_4608448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550831.1|4608763_4609816_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 315
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4614178	4620754	5492922		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|4614178_4615195_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_001550833.1|4615457_4616930_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147439.1|4616997_4617786_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4617914_4618064_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001550835.1|4618230_4619004_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604039.1|4619003_4619693_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|4619695_4620754_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 316
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4631722	4633012	5492922		Klosneuvirus(100.0%)	1	NA	NA
WP_001550860.1|4631722_4633012_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	5.9e-19
>prophage 317
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4639454	4640363	5492922		Streptococcus_phage(100.0%)	1	NA	NA
WP_001550864.1|4639454_4640363_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	1.8e-27
>prophage 318
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4650636	4665574	5492922		Anomala_cuprea_entomopoxvirus(16.67%)	14	NA	NA
WP_001550869.1|4650636_4652373_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000743444.1|4652365_4653361_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4653363_4654035_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001550870.1|4654263_4655628_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001522657.1|4655784_4656225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001522659.1|4656224_4656506_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_001550871.1|4656676_4658827_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	6.3e-42
WP_000386515.1|4658854_4659817_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001550872.1|4659957_4661043_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|4661182_4661443_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|4661707_4661974_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990146.1|4662047_4662725_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_001550873.1|4662766_4665049_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|4665313_4665574_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 319
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4669114	4674339	5492922		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4669114_4669837_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4669833_4670493_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4670631_4671378_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4671781_4672285_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001550876.1|4672583_4673471_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4673705_4673771_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4673823_4674339_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 320
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4679335	4680931	5492922		Tupanvirus(100.0%)	1	NA	NA
WP_000961457.1|4679335_4680931_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.3e-62
>prophage 321
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4688532	4692663	5492922		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209345.1|4688532_4690965_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001550881.1|4690970_4691870_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001550882.1|4692000_4692663_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	1.3e-25
>prophage 322
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4695889	4697761	5492922		Planktothrix_phage(100.0%)	1	NA	NA
WP_001445743.1|4695889_4697761_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 323
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4710050	4711253	5492922		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|4710050_4711253_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 324
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4719818	4728873	5492922		Vibrio_phage(25.0%)	10	NA	NA
WP_001195231.1|4719818_4720076_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001550889.1|4720235_4720523_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|4721203_4722106_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4722193_4722670_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126069.1|4723020_4724133_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001550891.1|4724227_4725361_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105416.1|4725370_4726315_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|4726311_4727157_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389258.1|4727216_4727705_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149712.1|4727745_4728873_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	7.9e-28
>prophage 325
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4731998	4732727	5492922		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|4731998_4732727_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 326
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4736407	4737238	5492922		Roseobacter_phage(100.0%)	1	NA	NA
WP_001550894.1|4736407_4737238_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
>prophage 327
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4740825	4742544	5492922		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815339.1|4740825_4742544_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	3.1e-31
>prophage 328
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4751830	4800503	5492922	protease,integrase,transposase	Escherichia_phage(33.33%)	40	4752810:4752825	4788259:4788274
WP_000188187.1|4751830_4753777_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
4752810:4752825	attL	ATCAGCAGGCGCTGAA	NA	NA	NA	NA
WP_000410785.1|4753849_4754074_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000092883.1|4754478_4755717_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.5	4.0e-126
WP_001206975.1|4756136_4756346_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	71.4	1.5e-17
WP_001710147.1|4756356_4757403_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_104858404.1|4757395_4757716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001710148.1|4757722_4758022_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_048230479.1|4758018_4759836_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.1	1.7e-128
WP_000125504.1|4760123_4760369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126661.1|4760365_4760788_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001334714.1|4761212_4761422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001017075.1|4761418_4763332_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	57.2	2.5e-215
WP_000373413.1|4763589_4764075_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	67.5	5.9e-49
WP_001596797.1|4764077_4764359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|4765145_4765466_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4765496_4767773_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279872.1|4768647_4769850_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_104858405.1|4770036_4771854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|4772965_4773262_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|4773506_4773704_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_104858406.1|4773922_4775011_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282076.1|4776953_4777517_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001333439.1|4778191_4783150_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000622487.1|4783146_4784583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024167628.1|4784687_4784894_+	methyltransferase	NA	NA	NA	NA	NA
WP_000757210.1|4785062_4786952_-	enterotoxin	NA	NA	NA	NA	NA
WP_000459228.1|4786965_4788141_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_023063580.1|4788152_4789724_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
4788259:4788274	attR	TTCAGCGCCTGCTGAT	NA	NA	NA	NA
WP_001411498.1|4789837_4790242_-	aldolase	NA	NA	NA	NA	NA
WP_000072188.1|4790424_4791249_+	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_001411497.1|4791311_4791749_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_001441239.1|4791830_4792466_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_001411495.1|4792628_4792766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001387298.1|4793573_4793672_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001411493.1|4793673_4794456_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001504743.1|4794761_4795682_+	ribokinase	NA	NA	NA	NA	NA
WP_000998343.1|4795709_4797026_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107484.1|4797037_4798051_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_072185504.1|4798701_4799484_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	2.9e-138
WP_033877970.1|4799480_4800503_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	2.7e-200
>prophage 329
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4813360	4918125	5492922	plate,tail,tRNA,terminase,capsid,head,integrase,portal,holin,transposase	Enterobacteria_phage(53.62%)	109	4878100:4878119	4914837:4914856
WP_085949416.1|4813360_4814522_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
WP_001505014.1|4814802_4816080_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|4816142_4818140_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_104858408.1|4818293_4819433_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.0e-67
WP_001411475.1|4819612_4820557_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001300030.1|4820621_4821572_-	virulence factor VirK	NA	NA	NA	NA	NA
WP_001333382.1|4821576_4822665_-	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001300024.1|4822667_4823489_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_032284320.1|4825085_4826594_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	4.7e-44
WP_000177057.1|4827244_4827502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4828059_4828827_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4828827_4829784_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125175.1|4829780_4830779_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_032284319.1|4830775_4831678_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188248.1|4831722_4834047_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001513690.1|4834133_4835087_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|4835083_4835605_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|4837192_4837450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|4838182_4839541_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_104858409.1|4839779_4841165_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	7.7e-259
WP_000612632.1|4841214_4841562_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_001171554.1|4841558_4841939_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001221615.1|4842293_4842728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270978.1|4842715_4843117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221528.1|4843376_4843946_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_016234078.1|4844690_4844867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840367.1|4845166_4845433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329787.1|4845501_4845780_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813455.1|4845874_4846477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033872750.1|4847976_4848594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001069759.1|4848678_4849551_+	GTPase family protein	NA	NA	NA	NA	NA
WP_104858410.1|4849922_4852769_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_095530534.1|4853831_4855044_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000581502.1|4856794_4857250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104858411.1|4857328_4857562_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234726.1|4857661_4858480_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_000214311.1|4858571_4859057_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001186726.1|4859072_4859549_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692298.1|4859611_4859833_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_000086768.1|4859851_4860535_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.1	9.0e-27
WP_001285602.1|4860545_4860926_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_104858412.1|4861006_4861387_+	toxin	NA	NA	NA	NA	NA
WP_001054233.1|4861383_4861872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042024643.1|4861888_4862086_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_104858470.1|4862170_4863013_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001040187.1|4863503_4863722_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4864006_4864711_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001550899.1|4864752_4866474_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.8e-21
WP_001043596.1|4866474_4868241_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|4868363_4869329_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|4869873_4870368_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001550902.1|4870502_4874570_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001522754.1|4874728_4875340_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|4875350_4876694_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4876784_4878077_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
4878100:4878119	attL	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000078920.1|4878382_4878523_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001383550.1|4878713_4878974_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001403416.1|4879014_4880124_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	4.8e-195
WP_001403415.1|4880281_4881466_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	9.9e-223
WP_000290462.1|4881465_4881978_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_001403413.1|4882032_4882398_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	97.5	8.4e-56
WP_000333494.1|4882406_4882562_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_104858413.1|4882548_4885356_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.2	0.0e+00
WP_158660453.1|4885368_4885857_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	4.7e-86
WP_001403410.1|4885883_4886483_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.9	2.0e-86
WP_001438363.1|4886554_4887061_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	64.1	6.0e-52
WP_032208827.1|4887071_4887500_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	6.4e-39
WP_032208527.1|4887510_4888044_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.6	7.0e-43
WP_104858414.1|4888054_4888513_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.5	4.5e-38
WP_001057725.1|4888512_4889124_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.0	7.9e-83
WP_104858415.1|4889130_4890744_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	59.7	2.3e-153
WP_001403408.1|4890740_4891349_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.4	5.8e-86
WP_001403407.1|4891341_4892238_-|plate	baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	97.0	2.8e-153
WP_000213444.1|4892241_4892592_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271937.1|4892588_4893170_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-102
WP_000356371.1|4893166_4893802_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	2.6e-113
WP_000921127.1|4893794_4894262_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_032207317.1|4894285_4896166_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.7	9.3e-300
WP_000780577.1|4896304_4896700_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_032179099.1|4896696_4897089_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.1e-69
WP_001342221.1|4897085_4897409_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|4897411_4897612_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|4897611_4898106_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_001402975.1|4898207_4899008_-|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	92.9	5.4e-132
WP_104858324.1|4899053_4900106_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	4.1e-188
WP_001262681.1|4900129_4900966_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
WP_001402977.1|4901120_4902872_+	Terminase ATPase subunit (GpP)	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001402978.1|4902871_4903918_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	9.7e-206
WP_000224227.1|4904429_4904693_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_001167296.1|4904694_4905186_-	hypothetical protein	NA	G9L661	Escherichia_phage	92.0	3.7e-83
WP_001402979.1|4905188_4905764_-	Plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	94.6	4.9e-66
WP_158660457.1|4905840_4908663_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.3	0.0e+00
WP_074517548.1|4908669_4909035_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	1.3e-59
WP_158660458.1|4909031_4909649_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	41.2	2.0e-09
WP_000104308.1|4909660_4909960_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
WP_021545614.1|4909956_4910223_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	1.2e-30
WP_032229732.1|4910219_4910423_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	9.5e-25
WP_104858417.1|4910453_4910864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021665.1|4910957_4911071_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.2e-10
WP_000514274.1|4911067_4911310_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_050009738.1|4911321_4911600_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000776266.1|4911610_4911961_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	4.7e-56
WP_001287828.1|4912098_4912290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856386.1|4912296_4912719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|4912723_4913245_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|4913349_4913691_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023737.1|4913760_4914753_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850305.1|4915052_4917497_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
4914837:4914856	attR	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000213098.1|4917507_4918125_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 330
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4922963	4926178	5492922		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|4922963_4923704_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292809.1|4923895_4926178_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 331
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4930276	4931365	5492922		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057132.1|4930276_4931365_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	2.0e-81
>prophage 332
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4936451	4940992	5492922		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4936451_4936736_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_001550905.1|4936942_4939207_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|4939243_4940992_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 333
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4955697	4966481	5492922	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|4955697_4956246_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109449.1|4956272_4956920_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|4956970_4958161_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977905.1|4958345_4959419_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	2.3e-101
WP_000117881.1|4960021_4961422_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001305916.1|4961591_4962794_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001550911.1|4963059_4965672_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.2	1.6e-18
WP_001550912.1|4965713_4966481_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
>prophage 334
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4982400	4984308	5492922		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|4982400_4984308_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 335
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	4996918	4998973	5492922		Bacillus_phage(100.0%)	1	NA	NA
WP_001550921.1|4996918_4998973_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 336
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5003206	5067091	5492922	lysis,terminase,tail,head,integrase,portal,coat,protease,holin	Enterobacteria_phage(53.12%)	85	5013010:5013027	5065743:5065760
WP_000375136.1|5003206_5003866_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001058323.1|5004586_5005705_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001550924.1|5005701_5007495_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001550925.1|5007513_5008221_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_001550926.1|5008217_5008805_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001550927.1|5008801_5009200_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004895.1|5009196_5010054_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_001550929.1|5010187_5011732_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460792.1|5011743_5012880_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|5012892_5012985_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
5013010:5013027	attL	TTAGCGTCGCATCAGGCA	NA	NA	NA	NA
WP_001550931.1|5013064_5014375_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000087763.1|5014362_5014575_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|5014860_5015073_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071528143.1|5015083_5015272_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|5015246_5015477_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|5015466_5015640_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001550932.1|5015688_5016762_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_023909335.1|5016833_5019578_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	2.4e-38
WP_021537877.1|5019672_5020746_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	97.2	4.6e-195
WP_001303849.1|5020723_5020942_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001277766.1|5021055_5021235_-	Eag protein	NA	K7PL40	Enterobacteria_phage	96.6	2.8e-28
WP_104858419.1|5021331_5022225_-	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	56.6	2.0e-74
WP_158660459.1|5022221_5022431_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	98.6	2.7e-35
WP_104858421.1|5022625_5023324_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	48.1	2.1e-31
WP_104858422.1|5023320_5023488_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	92.7	6.2e-22
WP_024215524.1|5023484_5023766_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	3.3e-44
WP_000753554.1|5023782_5024097_-	hypothetical protein	NA	K7P7J8	Enterobacteria_phage	100.0	1.2e-50
WP_000041318.1|5024108_5024591_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.1	2.5e-79
WP_024240078.1|5024574_5025486_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.0	2.2e-169
WP_029701297.1|5025482_5025791_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	98.0	7.3e-53
WP_001243355.1|5025875_5026028_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_029394724.1|5026012_5026147_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	97.7	9.0e-16
WP_027662175.1|5026380_5026851_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	2.4e-87
WP_157834315.1|5026905_5027043_-	hypothetical protein	NA	K7PH17	Enterobacteria_phage	97.8	3.0e-22
WP_104858423.1|5027051_5027357_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	90.7	4.9e-25
WP_000233126.1|5027975_5028344_-	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	100.0	1.3e-56
WP_000428318.1|5028361_5029078_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000620665.1|5029184_5029379_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_015966855.1|5029487_5029766_+	ABC transporter	NA	K7P8A8	Enterobacteria_phage	100.0	1.1e-42
WP_000539336.1|5029948_5030839_+	hypothetical protein	NA	G5DA89	Enterobacteria_phage	99.7	3.4e-159
WP_000131505.1|5030828_5032265_+	AAA family ATPase	NA	G5DA90	Enterobacteria_phage	99.4	5.1e-274
WP_000796283.1|5032340_5032667_+	hypothetical protein	NA	I6RSP8	Salmonella_phage	99.1	9.5e-59
WP_104858424.1|5032880_5033321_+	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	97.9	8.5e-79
WP_021548189.1|5033317_5033845_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	97.1	2.0e-98
WP_104858425.1|5033841_5034024_+	NinE family protein	NA	Q716C5	Shigella_phage	98.3	6.3e-28
WP_000566871.1|5034020_5034191_+	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	5.5e-26
WP_060626368.1|5034183_5034906_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	99.2	3.5e-130
WP_000002230.1|5034905_5035196_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_104858426.1|5035192_5035555_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	99.2	3.5e-62
WP_000994515.1|5035551_5035740_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001235459.1|5035736_5036360_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|5036793_5037117_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|5037100_5037577_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_104858427.1|5037573_5038041_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	4.2e-76
WP_001139680.1|5038028_5038181_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000191869.1|5038263_5038743_+	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	60.4	1.1e-55
WP_104858428.1|5038976_5039348_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	89.4	7.7e-57
WP_000807788.1|5039451_5039694_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000179910.1|5039773_5040199_+	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_104858429.1|5040195_5041611_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.4	5.8e-278
WP_104858430.1|5041612_5043811_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.5	0.0e+00
WP_096221738.1|5043901_5044795_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	98.0	9.1e-128
WP_097471993.1|5044813_5046067_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	98.8	3.5e-234
WP_001462613.1|5046108_5046297_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	6.5e-28
WP_104858431.1|5046277_5046739_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	99.3	7.8e-83
WP_104858432.1|5046748_5048167_+	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.8	3.8e-277
WP_104858433.1|5048166_5048868_+|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	88.4	1.2e-103
WP_000627625.1|5048867_5049323_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	4.4e-86
WP_104858434.1|5049325_5050021_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	96.9	4.4e-114
WP_104858435.1|5050031_5051363_+	acyltransferase	NA	A0A0M5M1J8	Salmonella_phage	71.4	6.0e-160
WP_104858436.1|5051362_5053486_+	DNA transfer protein	NA	B9UDL1	Salmonella_phage	98.0	0.0e+00
WP_023568671.1|5053486_5053810_-	hypothetical protein	NA	A0A0M3ULJ1	Salmonella_phage	87.9	6.1e-26
WP_023568673.1|5054176_5054587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052906992.1|5054583_5054826_-	Arc family DNA-binding protein	NA	I6R0M0	Salmonella_phage	84.8	6.8e-30
WP_023568675.1|5054919_5055081_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	92.5	1.5e-20
WP_104858472.1|5055149_5056040_+	phage antirepressor Ant	NA	I6R977	Salmonella_phage	98.3	7.6e-167
WP_158660460.1|5056140_5058792_+	hypothetical protein	NA	Q0H8C6	Salmonella_phage	61.2	1.1e-64
WP_104858473.1|5058828_5059116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550934.1|5059576_5060605_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120121.1|5060577_5061270_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001550935.1|5061399_5062572_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001550936.1|5062571_5065118_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.0	6.9e-72
WP_001544437.1|5065114_5065714_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|5065865_5066171_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
5065743:5065760	attR	TTAGCGTCGCATCAGGCA	NA	NA	NA	NA
WP_000420641.1|5066170_5067091_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
>prophage 337
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5071394	5073494	5492922		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|5071394_5071568_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001365093.1|5071650_5072979_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	2.8e-234
WP_001028095.1|5072999_5073494_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 338
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5088383	5089307	5492922		Cronobacter_phage(100.0%)	1	NA	NA
WP_001304747.1|5088383_5089307_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.1e-91
>prophage 339
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5096131	5150434	5492922	integrase,transposase	Stx2-converting_phage(21.43%)	40	5097007:5097021	5100339:5100353
WP_001550941.1|5096131_5097499_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	9.6e-20
5097007:5097021	attL	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_000279872.1|5097777_5098980_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_104858405.1|5099166_5100984_-	hypothetical protein	NA	NA	NA	NA	NA
5100339:5100353	attR	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_001303889.1|5102095_5102392_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|5102618_5102816_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335695.1|5103034_5104468_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032277685.1|5105288_5105852_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233440.1|5106006_5108367_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.0	6.9e-34
WP_000035067.1|5108384_5108573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001440936.1|5109016_5109280_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.8	4.1e-44
WP_032277686.1|5109276_5109681_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	92.5	1.2e-63
WP_001423524.1|5111140_5111338_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	72.2	2.0e-16
WP_001333359.1|5112391_5113336_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000677247.1|5113680_5114400_+	amino acid racemase	NA	NA	NA	NA	NA
WP_000262195.1|5114465_5115764_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_001301456.1|5117741_5118200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023153739.1|5118657_5119167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|5119255_5119879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124179.1|5119974_5120208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287881.1|5120260_5120452_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001345400.1|5121126_5122173_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001016257.1|5122341_5123088_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_086353658.1|5123102_5124644_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	2.9e-129
WP_085950854.1|5124829_5126367_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001285507.1|5128929_5130162_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	5.0e-60
WP_000502842.1|5130146_5130785_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_000226519.1|5130863_5131133_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001333354.1|5131153_5131798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032264836.1|5133878_5135072_-	MFS transporter	NA	NA	NA	NA	NA
WP_158660454.1|5135207_5136932_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287501.1|5136932_5137880_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_104858437.1|5137879_5139622_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_104858438.1|5139618_5140956_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_158660462.1|5140961_5143157_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_104858360.1|5143716_5144142_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	87.6	3.6e-42
WP_000624715.1|5144138_5144429_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.7	1.9e-34
WP_005067636.1|5144680_5145424_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_001139133.1|5145473_5146841_-	MFS transporter	NA	NA	NA	NA	NA
WP_000705119.1|5146912_5148025_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	26.0	1.3e-27
WP_104858440.1|5149221_5150434_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	95.9	8.2e-164
>prophage 340
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5167724	5169281	5492922		Staphylococcus_phage(100.0%)	1	NA	NA
WP_023149703.1|5167724_5169281_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.5	1.0e-105
>prophage 341
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5178438	5180609	5492922		Yersinia_phage(33.33%)	4	NA	NA
WP_001234682.1|5178438_5179257_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
WP_000214398.1|5179347_5179833_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001186726.1|5179848_5180325_+	RadC family protein	NA	NA	NA	NA	NA
WP_001220314.1|5180387_5180609_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
>prophage 342
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5186626	5187460	5492922		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|5186626_5187460_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 343
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5191594	5192128	5492922		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857406.1|5191594_5192128_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 344
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5201436	5202357	5492922		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|5201436_5202357_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 345
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5207019	5207265	5492922		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|5207019_5207265_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 346
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5223111	5224053	5492922		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001366226.1|5223111_5224053_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 347
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5237226	5238408	5492922		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|5237226_5237961_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|5238171_5238408_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 348
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5241680	5243323	5492922		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257002.1|5241680_5242322_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267924.1|5242318_5243323_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 349
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5255576	5255834	5492922		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|5255576_5255834_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 350
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5263122	5266845	5492922		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|5263122_5263824_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_019842380.1|5263823_5265068_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001550961.1|5265096_5266008_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|5266023_5266845_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 351
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5270287	5353576	5492922	terminase,tail,capsid,tRNA,head,integrase,portal,protease,holin,transposase	Escherichia_phage(27.78%)	104	5281086:5281101	5335162:5335177
WP_000074983.1|5270287_5271406_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|5271374_5271644_-	excisionase	NA	NA	NA	NA	NA
WP_032284123.1|5271705_5274177_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000199480.1|5274272_5274461_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001405662.1|5274457_5274646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935597.1|5274656_5275511_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_012601410.1|5276018_5276285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|5276273_5276612_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379587.1|5276623_5276776_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001003379.1|5276965_5277373_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476988.1|5277450_5277678_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|5277661_5278213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|5278184_5279225_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|5279136_5279679_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450707.1|5279712_5280483_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	6.7e-87
WP_021524280.1|5280498_5280891_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	3.8e-38
WP_001266130.1|5280887_5281184_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
5281086:5281101	attL	ATGCTGAATGGCTGGC	NA	NA	NA	NA
WP_001209471.1|5281180_5281642_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	3.8e-37
WP_104858444.1|5281619_5281976_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	3.0e-58
WP_021572854.1|5282069_5282252_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.3e-25
WP_001289993.1|5282417_5282933_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_000813254.1|5283491_5283647_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980988.1|5283863_5284115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405664.1|5284181_5284460_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	5.1e-05
WP_001265091.1|5284461_5285508_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904112.1|5285520_5285895_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762885.1|5285891_5286713_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000562553.1|5287605_5287737_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001586961.1|5288017_5288353_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	4.0e-44
WP_001538589.1|5288613_5290575_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	4.3e-239
WP_023143432.1|5290711_5290894_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001538590.1|5290931_5291177_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_000284506.1|5291253_5291469_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_104858445.1|5291473_5292280_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	96.6	6.7e-146
WP_000551290.1|5292289_5292604_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_001092910.1|5292732_5293266_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_032140280.1|5293820_5293907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072006851.1|5294128_5294314_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	6.0e-18
WP_000235436.1|5294824_5295334_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_104858446.1|5295305_5297234_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	3.6e-262
WP_000258993.1|5297217_5297424_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_104858447.1|5297420_5299013_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	1.4e-184
WP_104858448.1|5299002_5300508_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.3e-99
WP_000256814.1|5300544_5300892_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_001573716.1|5300949_5301978_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000201530.1|5302029_5302404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|5302396_5302750_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974996.1|5302765_5303299_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683079.1|5303295_5303691_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_044065356.1|5303698_5304448_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.2	2.4e-126
WP_001309426.1|5304466_5304898_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
WP_000533401.1|5304924_5305338_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
WP_001556919.1|5305318_5307880_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.7	0.0e+00
WP_000847298.1|5307876_5308206_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001514118.1|5308205_5308904_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.2e-127
WP_000194723.1|5308914_5309658_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_072037205.1|5309603_5310236_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.4e-103
WP_032198501.1|5310579_5314272_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_001228261.1|5314339_5314939_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_104858449.1|5315090_5318117_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.2	6.6e-53
WP_001545928.1|5318116_5318701_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.0e-104
WP_000240999.1|5318755_5319424_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|5319480_5319747_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|5319978_5320842_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|5320825_5321962_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|5322211_5323438_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|5323486_5324608_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001557264.1|5324856_5326086_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	3.8e-132
WP_000953274.1|5326451_5326640_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.5e-13
WP_001674252.1|5326692_5327985_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000336139.1|5327974_5328199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|5328191_5328557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204077.1|5328549_5328771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204962.1|5328772_5329006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001403029.1|5329011_5329311_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001586920.1|5329307_5331062_+	phage/plasmid primase P4 family domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
WP_001586921.1|5331350_5331629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|5331625_5332036_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_104858450.1|5332046_5332319_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137345.1|5332606_5333764_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504054.1|5333803_5334376_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_001398592.1|5334413_5335589_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
5335162:5335177	attR	ATGCTGAATGGCTGGC	NA	NA	NA	NA
WP_001586922.1|5335585_5335924_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.3e-31
WP_000134113.1|5335920_5336217_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|5336216_5336657_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000113645.1|5336946_5337303_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001586923.1|5337286_5338948_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	5.2e-278
WP_000133425.1|5338961_5339243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|5340099_5341560_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|5341559_5342231_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|5342399_5343770_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|5343773_5344415_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|5344450_5345557_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476103.1|5345610_5346072_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000873387.1|5346081_5346720_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000246191.1|5347052_5347388_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|5347387_5347837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522898.1|5348418_5349669_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_000526135.1|5349864_5350323_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001309448.1|5350479_5350803_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	63.6	1.3e-39
WP_000526135.1|5351441_5351900_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_019842521.1|5352056_5352167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522899.1|5352219_5352624_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332298.1|5352844_5353576_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 352
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5359121	5361785	5492922		Escherichia_phage(100.0%)	1	NA	NA
WP_001563811.1|5359121_5361785_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.0	1.7e-84
>prophage 353
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5373355	5375043	5492922		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|5373355_5373775_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001550982.1|5373774_5375043_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	1.6e-207
>prophage 354
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5393156	5393915	5492922		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001563812.1|5393156_5393915_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 355
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5409772	5412524	5492922		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033363.1|5409772_5411452_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	7.9e-24
WP_001298109.1|5411576_5412524_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 356
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5415660	5419668	5492922		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001550996.1|5415660_5416743_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456570.1|5416742_5417576_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200377.1|5417572_5417965_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|5417968_5418778_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|5418813_5419668_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 357
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5422944	5423175	5492922		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|5422944_5423175_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 358
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5434308	5444675	5492922		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|5434308_5435847_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571705.1|5435843_5436554_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|5436553_5437231_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|5438312_5439155_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001314642.1|5439204_5439663_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|5439775_5440681_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|5440772_5441786_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|5441987_5442896_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|5443040_5443454_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|5444057_5444675_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 359
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5453086	5455101	5492922		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|5453086_5454100_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_001551001.1|5454096_5455101_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 360
NZ_CP026723	Escherichia coli strain 266917_2 chromosome, complete genome	5492922	5463037	5492072	5492922	holin,integrase	Escherichia_phage(44.44%)	49	5458989:5459002	5477067:5477080
5458989:5459002	attL	CTGCTTCCAGCGAT	NA	NA	NA	NA
WP_000113674.1|5463037_5464168_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|5464145_5464394_-	excisionase	NA	NA	NA	NA	NA
WP_104858453.1|5464458_5466933_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001093903.1|5467025_5467217_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|5467213_5467402_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|5467412_5468267_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_032296960.1|5468569_5468782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358771.1|5468824_5469103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394529.1|5469062_5469464_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_001658095.1|5469486_5469705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|5469864_5470020_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|5470273_5470735_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|5470842_5471118_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|5471101_5471527_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|5471598_5472639_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|5472550_5473093_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450707.1|5473126_5473897_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	6.7e-87
WP_021524280.1|5473912_5474305_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	3.8e-38
WP_001266130.1|5474301_5474598_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209471.1|5474594_5475056_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	3.8e-37
WP_000403782.1|5475033_5475390_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_032234226.1|5475485_5475668_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.5e-26
WP_001289987.1|5475833_5476193_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	9.2e-39
WP_001167296.1|5476195_5476687_+	hypothetical protein	NA	G9L661	Escherichia_phage	92.0	3.7e-83
WP_000224227.1|5476688_5476952_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207997.1|5476962_5477130_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
5477067:5477080	attR	ATCGCTGGAAGCAG	NA	NA	NA	NA
WP_000206826.1|5477126_5477471_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000967408.1|5477705_5477918_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001004956.1|5478083_5478734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|5478714_5479818_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001403449.1|5480208_5480481_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|5480482_5481529_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_000904112.1|5481541_5481916_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762880.1|5481912_5482734_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917767.1|5482960_5483158_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000935536.1|5483308_5484358_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_106104550.1|5484655_5484742_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|5485230_5485443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586961.1|5485513_5485849_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	4.0e-44
WP_000874316.1|5486109_5487966_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	89.6	0.0e+00
WP_000284510.1|5488116_5488332_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|5488336_5488681_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|5488646_5488919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992072.1|5489024_5489558_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_032140280.1|5490112_5490199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072006851.1|5490420_5490606_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	6.0e-18
WP_000828072.1|5491006_5491333_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_000095744.1|5491464_5491665_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829198.1|5491706_5492072_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	6.2e-59
>prophage 1
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	0	2041	129627	integrase	Macacine_betaherpesvirus(100.0%)	1	956:967	4368:4379
956:967	attL	AAAAACTCTTCA	NA	NA	NA	NA
WP_001066940.1|1300_2041_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001066940.1|1300_2041_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
4368:4379	attR	TGAAGAGTTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	13151	17923	129627	transposase	Escherichia_phage(50.0%)	5	NA	NA
WP_000950177.1|13151_14225_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|14217_15528_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_104858474.1|16241_17454_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	3.1e-163
WP_086218813.1|17420_17501_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	92.3	5.0e-06
WP_024210387.1|17503_17923_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	75.3	2.1e-34
>prophage 3
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	22175	26230	129627	transposase	Escherichia_phage(33.33%)	3	NA	NA
WP_002431139.1|22175_22883_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.7	3.2e-19
WP_023063783.1|23034_24033_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A0B5A2A5	Yersinia_phage	42.6	1.5e-22
WP_001254932.1|25078_26230_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 4
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	34268	41880	129627	transposase	Burkholderia_virus(33.33%)	7	NA	NA
WP_001402894.1|34268_35663_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.8	1.7e-35
WP_001402895.1|35768_36800_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024200979.1|36774_37794_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_032269703.1|37857_38571_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.7	5.2e-17
WP_089643065.1|39259_40282_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001402899.1|40441_40924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402900.1|41040_41880_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	37.4	8.8e-24
>prophage 5
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	47057	47804	129627		Xanthomonas_phage(100.0%)	1	NA	NA
WP_032188604.1|47057_47804_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	4.2e-09
>prophage 6
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	72330	72552	129627		Vibrio_virus(100.0%)	1	NA	NA
WP_001278694.1|72330_72552_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
>prophage 7
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	80333	81155	129627		Yersinia_phage(100.0%)	1	NA	NA
WP_001234469.1|80333_81155_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
>prophage 8
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	86893	87523	129627		Planktothrix_phage(100.0%)	1	NA	NA
WP_000621743.1|86893_87523_-	dispersin export ABC transporter ATP-binding protein AatC	NA	G9BWD6	Planktothrix_phage	35.4	1.2e-20
>prophage 9
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	90978	91606	129627	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_077513856.1|90978_91227_+	hypothetical protein	NA	A0A0N7BVE9	Escherichia_phage	83.8	4.0e-25
WP_000239755.1|91369_91606_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	63.8	2.0e-18
>prophage 10
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	104339	105491	129627	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001254932.1|104339_105491_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 11
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	111868	118046	129627	integrase	Enterobacteria_phage(40.0%)	9	112985:112998	119118:119131
WP_032154304.1|111868_112435_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	46.2	5.7e-35
WP_000457137.1|112566_112944_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.2	6.1e-25
WP_104858481.1|112943_114140_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.3	6.2e-132
112985:112998	attL	TGAAAAAGTTTTCC	NA	NA	NA	NA
WP_071606672.1|114146_114218_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001278815.1|114219_114636_-	recombinase	NA	NA	NA	NA	NA
WP_001403375.1|114628_115609_-	Plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_000030204.1|116021_116330_-	molecular chaperone GroEL	NA	NA	NA	NA	NA
WP_001144036.1|116416_117061_-	ParA family protein	NA	NA	NA	NA	NA
WP_024210383.1|117239_118046_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.8	1.3e-53
119118:119131	attR	GGAAAACTTTTTCA	NA	NA	NA	NA
>prophage 12
NZ_CP026724	Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence	129627	124287	126909	129627		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_023063774.1|124287_126909_+	ABC transporter	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.6	3.5e-18
>prophage 1
NZ_CP026725	Escherichia coli strain 266917_2 plasmid p266917_2_02, complete sequence	97124	0	96806	97124	terminase,plate,head,holin,tail,integrase	Escherichia_phage(60.75%)	107	973:991	96965:96983
WP_001076427.1|0_861_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
973:991	attL	TTTCCCTCCAGCACACATC	NA	NA	NA	NA
WP_001285362.1|1418_2615_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|2631_3633_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_000067710.1|3858_5565_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_000085143.1|5625_7215_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	100.0	1.1e-306
WP_104858482.1|7224_8040_+	hypothetical protein	NA	Q1MVJ7	Enterobacteria_phage	98.5	1.1e-111
WP_000035251.1|8075_8657_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
WP_104858483.1|8668_9178_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	5.0e-91
WP_001697750.1|10188_10893_-	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	99.1	8.7e-134
WP_024187338.1|11061_11907_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.9	1.5e-151
WP_001187875.1|11936_12737_-	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_061819307.1|12901_13936_-	antirepressor	NA	A0A077SLI1	Escherichia_phage	98.3	6.5e-186
WP_000245703.1|13932_14154_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.3	3.6e-38
WP_000908460.1|14734_15052_+	hypothetical protein	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
WP_048266593.1|15059_15839_+	hypothetical protein	NA	Q71TC6	Escherichia_phage	100.0	4.3e-150
WP_050196863.1|16048_16615_+	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.4	8.1e-98
WP_000523980.1|16625_17237_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_050196864.1|17251_18133_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.3	8.3e-174
WP_104858484.1|18214_21904_+	transglycosylase SLT domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	88.0	0.0e+00
WP_000002800.1|21903_22260_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_050196865.1|22256_23690_+	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	99.6	1.2e-270
WP_001189832.1|23689_24526_+	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_001286325.1|24604_25039_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
WP_104858485.1|25050_27975_+|tail	phage tail protein	tail	A0A1B0V7G4	Salmonella_phage	44.7	2.9e-13
WP_000367945.1|27980_28592_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
WP_072085895.1|28591_29032_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	55.8	5.4e-41
WP_072201552.1|29060_29537_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.2	5.5e-47
WP_023156927.1|29547_29976_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	1.3e-39
WP_068873683.1|29986_30442_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.8	5.1e-34
WP_023156927.1|30470_30899_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	1.3e-39
WP_068890269.1|30909_31353_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	68.4	7.6e-51
WP_001165547.1|31442_32015_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_000145199.1|32450_32714_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_000887652.1|32788_33118_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580770.1|33114_33558_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_001345482.1|33544_34147_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_050196852.1|34148_36068_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.2	0.0e+00
WP_000175491.1|36064_36430_+	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_050196853.1|36442_39430_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.0	0.0e+00
WP_001165936.1|39419_39728_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_023155275.1|39759_40854_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.7	5.1e-40
WP_050196854.1|40846_41635_-	hypothetical protein	NA	A0A077SK34	Escherichia_phage	98.8	2.3e-143
WP_023351452.1|41837_42326_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	86.4	2.0e-73
WP_001345478.1|42495_43053_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000132937.1|43344_44364_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_050196855.1|44356_46066_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.3	0.0e+00
WP_104858486.1|46142_52910_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.7	0.0e+00
WP_000224043.1|52943_53384_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|53380_53629_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000526244.1|53665_54793_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	74.1	7.6e-156
WP_023351534.1|54895_55537_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	96.7	1.2e-110
WP_104858487.1|55726_56287_-	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	97.3	3.6e-98
WP_001224243.1|56533_56845_-	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	94.2	1.3e-44
WP_050858708.1|56895_57927_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.1	1.9e-193
WP_000542335.1|57934_58156_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	98.6	1.3e-35
WP_000874154.1|58760_58970_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000611656.1|59080_59932_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000124155.1|59956_61441_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
WP_104858488.1|61440_62634_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	98.7	1.5e-207
WP_001312282.1|62720_63173_-	late promoter-activating protein (Gp10)	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_052870176.1|63261_64305_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.4	2.0e-206
WP_001339207.1|64332_64512_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
WP_001216034.1|64516_64897_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|64896_65118_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_104858489.1|65190_65580_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	5.4e-69
WP_001133670.1|65754_66327_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	100.0	6.7e-108
WP_001667237.1|66333_66585_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	100.0	7.6e-40
WP_097494657.1|67246_67609_-	hypothetical protein	NA	Q71TI4	Escherichia_phage	98.3	8.3e-56
WP_097494658.1|67605_68538_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	97.4	1.3e-177
WP_074505450.1|68519_68894_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	96.8	7.0e-66
WP_000269001.1|68900_69194_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	5.3e-45
WP_000517420.1|69372_69606_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	100.0	2.5e-37
WP_000969524.1|69682_69943_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	98.8	1.9e-41
WP_077717773.1|69939_70821_-	DUF551 domain-containing protein	NA	Q858C8	Salmonella_phage	44.4	2.5e-53
WP_000360279.1|70831_71029_-	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	84.6	1.5e-30
WP_000013838.1|71030_71252_-	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	73.0	5.0e-19
WP_104858490.1|71253_71640_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	74.0	1.6e-41
WP_077717771.1|72153_72861_-	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	86.2	8.2e-108
WP_001702241.1|72857_73445_-	ead/Ea22-like family protein	NA	E7C9P6	Salmonella_phage	70.4	1.4e-39
WP_104858491.1|73441_74086_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	97.7	6.3e-131
WP_050009073.1|74078_74339_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	97.7	5.8e-43
WP_001561097.1|74331_75072_-	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	5.0e-140
WP_000021766.1|75266_75773_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	100.0	4.8e-94
WP_063123388.1|75845_77108_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.5	7.8e-234
WP_000684845.1|77409_78111_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_001354545.1|78107_78785_-	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000484112.1|78781_79408_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.0	2.3e-122
WP_000095381.1|79909_80065_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
WP_000943609.1|80131_80710_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	100.0	1.5e-107
WP_000840931.1|80712_80958_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000235786.1|81104_81482_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141908.1|81491_82709_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_104858492.1|82712_83441_+|tail	phage tail protein	tail	A0A077SK19	Escherichia_phage	99.6	3.5e-138
WP_000602717.1|83427_84213_+	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000212015.1|84214_85231_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	4.5e-192
WP_000535207.1|85223_85856_+	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_001198652.1|85902_86901_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.4	2.1e-194
WP_050009070.1|86900_88265_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	6.2e-253
WP_000234829.1|88736_88901_-	DUF3927 family protein	NA	A0A1B0VDU8	Salmonella_phage	100.0	1.2e-17
WP_000900640.1|88900_89326_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_104858493.1|91079_93344_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.2	0.0e+00
WP_000472529.1|93340_94246_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_001177860.1|94238_94523_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_001311689.1|94797_94977_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
WP_001569402.1|94985_95774_+	hypothetical protein	NA	Q71TL4	Escherichia_phage	100.0	1.0e-119
WP_000007765.1|95813_96236_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
WP_001281124.1|96413_96806_+	hypothetical protein	NA	Q71TL7	Escherichia_phage	100.0	1.5e-71
96965:96983	attR	GATGTGTGCTGGAGGGAAA	NA	NA	NA	NA
