The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	465913	513200	4829687	terminase,capsid,integrase,tRNA,portal,lysis,head,tail	Enterobacteria_phage(60.0%)	59	464125:464139	513392:513406
464125:464139	attL	TTCACTTCCAGTTTG	NA	NA	NA	NA
WP_022296362.1|465913_467020_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_022296361.1|467073_467535_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_022296360.1|467544_468198_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|468369_469620_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|469733_470876_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|470865_471102_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|471241_471481_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|471464_471791_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|471790_472012_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|472110_472392_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|472402_472594_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|472566_472749_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_021524004.1|472745_473426_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	1.0e-131
WP_000100847.1|473422_474208_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_022296359.1|474213_474510_-	host-nuclease inhibitor protein gam from bacteriophage origin	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_023148105.1|474585_474876_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000340376.1|475267_476131_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
WP_000858975.1|476197_476887_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|476991_477222_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_022296358.1|477291_477831_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_077543238.1|477827_478847_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	67.3	1.3e-109
WP_022296357.1|478843_479545_+	phage DNA replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	3.0e-126
WP_077884392.1|479794_484060_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|484096_485140_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072190466.1|485489_485591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053006.1|485587_486043_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	4.5e-59
WP_000224907.1|486042_486213_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774475.1|486205_486496_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099697.1|486492_486855_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971095.1|486851_486992_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204794.1|487077_487461_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000737271.1|487649_488732_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_022296415.1|489321_489537_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.5e-33
WP_000075094.1|489536_490034_+	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	99.4	1.7e-91
WP_001441931.1|490030_490474_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	92.5	4.3e-70
WP_000084844.1|490512_490887_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	80.6	1.5e-47
WP_001205136.1|490985_491168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|491477_492026_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_022296416.1|491997_493926_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	9.7e-260
WP_000258997.1|493909_494116_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001441934.1|494112_495705_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_022296417.1|495694_497200_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.5	7.9e-100
WP_000256813.1|497236_497584_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522651.1|497641_498670_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|498721_499096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|499088_499442_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_001007371.1|499453_500032_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
WP_000683149.1|500028_500424_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
WP_022296418.1|500431_501172_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.4	4.3e-131
WP_000479163.1|501187_501610_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_000459457.1|501591_502026_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_059346522.1|502018_504580_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.4	0.0e+00
WP_022296420.1|504576_504906_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
WP_001152612.1|504905_505604_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_033556180.1|505608_506352_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
WP_122990320.1|506288_506921_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	96.2	6.7e-93
WP_022296423.1|506981_510464_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_022296424.1|510522_512922_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	I1TE37	Escherichia_virus	38.6	1.0e-72
WP_022296425.1|512918_513200_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	45.7	2.9e-16
513392:513406	attR	CAAACTGGAAGTGAA	NA	NA	NA	NA
>prophage 2
NZ_CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	828920	873742	4829687	protease,terminase,transposase,integrase,portal,lysis,tail	Enterobacteria_phage(55.81%)	57	815897:815911	832362:832376
815897:815911	attL	ACTGTTGATTGGCTC	NA	NA	NA	NA
WP_016232059.1|828920_830201_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.5e-155
WP_000005552.1|830235_830487_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_024009056.1|830559_833031_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
832362:832376	attR	ACTGTTGATTGGCTC	NA	NA	NA	NA
WP_001083280.1|833124_833316_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|833312_833501_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|833987_834563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379557.1|834564_834720_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001003381.1|834912_835320_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476994.1|835397_835625_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|835608_836130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042043081.1|836110_837076_+	phage O protein family	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_042043083.1|837116_837539_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	6.7e-65
WP_001366387.1|837535_837769_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
WP_001595803.1|837822_838488_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_059346558.1|839043_839256_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
WP_000980999.1|839472_839724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309521.1|839790_840069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104731921.1|840070_841120_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.0	4.8e-112
WP_001047133.1|841133_841886_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_000066484.1|842561_842777_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|843530_843746_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|843750_844062_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|844058_844592_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|844588_845086_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|845449_845662_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|845672_845861_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|845863_845929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|846008_846164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|846335_846509_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|846660_847071_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031431.1|847371_847578_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000244358.1|848122_849496_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000421825.1|849697_850237_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507031.1|850245_852345_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|852341_852554_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072134767.1|852481_854062_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001360054.1|854006_856034_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097045.1|856120_856444_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|856436_856712_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677120.1|856723_857314_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001079410.1|857310_857712_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_000211128.1|857722_858466_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|858526_858913_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|858921_859251_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372041.1|859222_862288_+|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	98.3	0.0e+00
WP_000447253.1|862287_862617_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152401.1|862626_863325_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	6.6e-134
WP_015912503.1|863329_864073_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	9.2e-150
WP_015912502.1|863970_864618_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	2.5e-111
WP_000515688.1|864678_868092_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000290533.1|868152_870525_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_000654143.1|870524_870806_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001353819.1|870815_871856_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	1.4e-124
WP_000355601.1|871898_872192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|872419_873010_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|873326_873560_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|873628_873742_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
>prophage 3
NZ_CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	1418008	1424315	4829687		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100804.1|1418008_1418554_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
WP_000857516.1|1418558_1419437_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
WP_001524985.1|1419495_1420395_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	2.6e-29
WP_000699403.1|1420394_1421480_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_000183060.1|1421852_1422746_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115961.1|1422920_1424315_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	8.3e-19
>prophage 4
NZ_CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	1461418	1575367	4829687	terminase,capsid,transposase,tRNA,portal,lysis,head,holin,tail	Enterobacteria_phage(41.67%)	113	NA	NA
WP_000244358.1|1461418_1462792_-|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_100692412.1|1463203_1463260_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001525001.1|1463538_1464786_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_021576246.1|1464785_1467908_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_021576247.1|1467908_1470986_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001527272.1|1470986_1472402_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675178.1|1472398_1473802_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|1473798_1474521_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_021539982.1|1474700_1475033_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1475179_1476541_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001441996.1|1477040_1477358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|1477773_1478673_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178556.1|1478754_1479534_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_021555541.1|1479633_1480674_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000823289.1|1482079_1482364_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182889.1|1482394_1482847_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_021576252.1|1482856_1484119_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001592309.1|1484147_1485002_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|1485228_1486281_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858523.1|1486537_1487815_+	MFS transporter	NA	NA	NA	NA	NA
WP_021576253.1|1487811_1488816_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	2.0e-14
WP_000011979.1|1488812_1489778_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434047.1|1489751_1490498_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021576254.1|1490549_1491368_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822280.1|1491432_1492233_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001527277.1|1492229_1493018_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|1493240_1493513_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134614.1|1493633_1494458_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|1494676_1495015_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000244358.1|1495201_1496575_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_001527282.1|1496654_1497689_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_022296301.1|1497704_1500185_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677331.1|1500200_1500875_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830465.1|1500955_1501498_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001005448.1|1502328_1503438_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001296226.1|1503569_1505603_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
WP_033556137.1|1505743_1509532_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001527292.1|1509541_1513174_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001525031.1|1514182_1515271_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_022296305.1|1515281_1517561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059338323.1|1517553_1518690_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.6e-161
WP_022296306.1|1518686_1520690_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
WP_001296231.1|1520814_1521276_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1521316_1521787_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1521833_1522553_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1522549_1524235_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001261928.1|1524749_1524998_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	84.0	1.8e-30
WP_000355615.1|1525115_1525412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204583.1|1525421_1525700_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	46.2	3.0e-21
WP_104731927.1|1525696_1527757_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	1.2e-151
WP_001530022.1|1527908_1528508_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	6.5e-106
WP_104731928.1|1528575_1532268_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.6	0.0e+00
WP_032300536.1|1532611_1533244_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_001351101.1|1533189_1533933_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_001327694.1|1533938_1534637_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_000847298.1|1534636_1534966_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_104731929.1|1534962_1537539_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.6	0.0e+00
WP_000533402.1|1537519_1537933_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|1537959_1538391_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235034.1|1538409_1539156_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.0	5.6e-123
WP_000683079.1|1539163_1539559_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974994.1|1539555_1540131_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_001204533.1|1540146_1540500_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000201498.1|1540492_1540876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001530577.1|1540927_1541956_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	6.6e-114
WP_104731930.1|1542013_1542361_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	54.8	3.7e-21
WP_001530579.1|1542397_1543903_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	1.2e-100
WP_021524278.1|1543892_1545485_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
WP_000259002.1|1545481_1545688_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_016247622.1|1545671_1547600_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	7.2e-263
WP_000235436.1|1547571_1548081_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001329960.1|1548484_1548670_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|1548802_1548943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028465.1|1549651_1550173_-	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_001082564.1|1550374_1550812_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	95.2	2.3e-68
WP_000992063.1|1551110_1551644_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	2.1e-100
WP_104731964.1|1551707_1552058_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	90.2	6.6e-50
WP_000284510.1|1552062_1552278_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001514225.1|1552353_1552623_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
WP_001405838.1|1552660_1552843_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	91.5	9.4e-24
WP_001530582.1|1552994_1554956_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.5	5.1e-240
WP_000301785.1|1555726_1556440_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|1556574_1556772_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000360285.1|1557050_1557668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204814.1|1557743_1558115_-	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	59.2	8.3e-35
WP_001358491.1|1558132_1559122_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001072669.1|1559129_1559945_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_000767110.1|1560107_1560503_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210143.1|1560499_1560826_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000066917.1|1560822_1561476_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_077466986.1|1561475_1561970_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	7.3e-87
WP_001571190.1|1561966_1562785_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	5.2e-122
WP_001571189.1|1562781_1563006_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_001087340.1|1563002_1564148_-	Rha family transcriptional regulator	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000526669.1|1564144_1564702_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001191669.1|1564694_1564955_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001387485.1|1565052_1565745_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_001555122.1|1566447_1566810_+	hypothetical protein	NA	U5P4J6	Shigella_phage	94.2	2.2e-56
WP_000081287.1|1566875_1567700_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|1567827_1568364_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001555123.1|1568354_1568717_+	phage protein	NA	K7PH61	Enterobacteria_phage	96.7	1.5e-65
WP_000111289.1|1568713_1568917_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476207.1|1568909_1569149_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
WP_001555124.1|1569145_1569745_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.5	1.2e-104
WP_001555125.1|1570258_1570777_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	74.6	1.3e-65
WP_000457723.1|1570861_1571104_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030154.1|1571107_1571242_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.2	4.2e-21
WP_001555126.1|1571260_1571515_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	98.8	3.3e-43
WP_016235940.1|1571548_1572835_+	DUF3596 domain-containing protein	NA	A0A0N7KZF5	Stx2-converting_phage	98.8	9.3e-251
WP_059338313.1|1572870_1573557_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.4	1.9e-101
WP_001216963.1|1573616_1573724_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|1573704_1574436_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|1574440_1575367_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 5
NZ_CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	1987629	2060722	4829687	terminase,transposase,capsid,tRNA,plate,holin,tail	Salmonella_phage(45.83%)	75	NA	NA
WP_000940023.1|1987629_1988370_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553451.1|1988488_1989292_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_022296792.1|1989436_1990291_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000983028.1|1990481_1991762_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244186.1|1991753_1992893_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_001296295.1|1993262_1993685_+	DoxX family protein	NA	NA	NA	NA	NA
WP_104731936.1|1993759_1995107_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	3.0e-74
WP_022296790.1|1995168_1996041_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000700787.1|1996052_1997147_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_001276657.1|1997179_1998178_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001525393.1|1998202_1999714_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	4.0e-11
WP_001124926.1|1999736_2000720_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001527538.1|2000816_2004098_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001527539.1|2004215_2005409_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919159.1|2005472_2006726_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883120.1|2007053_2008244_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2008288_2008627_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001314050.1|2008687_2010022_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215879.1|2010011_2010725_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_059338211.1|2010889_2012317_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	6.7e-16
WP_022296789.1|2012892_2016780_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	6.5e-130
WP_000734193.1|2017037_2018594_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001296300.1|2018590_2019127_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190644.1|2019151_2019787_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001296301.1|2019995_2020844_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001039127.1|2021723_2022569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053899353.1|2022918_2023437_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.6	3.1e-56
WP_059338209.1|2023436_2024039_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	1.0e-98
WP_059338210.1|2024010_2024448_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.5	1.4e-49
WP_059346512.1|2024449_2025136_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	70.0	3.7e-28
WP_059338207.1|2025135_2025816_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	2.9e-102
WP_001519786.1|2025812_2027012_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.4	8.3e-185
WP_001270632.1|2027011_2027365_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_001519787.1|2027364_2028117_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	2.9e-87
WP_000095759.1|2028174_2028747_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_021578671.1|2029072_2029417_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.8	2.5e-33
WP_021580413.1|2029420_2030482_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.7	7.7e-158
WP_021580414.1|2030484_2030787_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	1.8e-48
WP_001420197.1|2030786_2031374_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_046960513.1|2031373_2033362_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.7	2.3e-272
WP_000393962.1|2033539_2033992_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
WP_104731937.1|2033995_2034436_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	4.6e-56
WP_021578676.1|2034446_2035592_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	8.8e-160
WP_001298391.1|2035595_2036159_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_001519792.1|2036133_2036523_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	3.3e-66
WP_021517253.1|2036509_2037064_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	2.6e-80
WP_001125665.1|2037060_2037468_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
WP_160393966.1|2037466_2037700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627483.1|2037696_2038638_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	2.9e-156
WP_001066729.1|2038649_2039156_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
WP_021578677.1|2039159_2040380_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	87.8	1.2e-199
WP_137462770.1|2040394_2041129_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	85.1	4.0e-97
WP_021578679.1|2041019_2042486_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.0	1.8e-261
WP_021580416.1|2042485_2044108_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_000162795.1|2044110_2044683_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
WP_021578681.1|2044744_2045269_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	65.4	1.3e-41
WP_001194119.1|2045252_2045729_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_059338206.1|2045732_2046074_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	92.8	1.6e-53
WP_001174015.1|2046519_2046861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|2046892_2047315_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_021578683.1|2047596_2049789_-	hypothetical protein	NA	B6SCY1	Bacteriophage	71.4	2.7e-173
WP_000170998.1|2049792_2050005_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_000049986.1|2050125_2050749_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000801676.1|2051382_2051532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051353.1|2051528_2052431_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001520087.1|2052433_2053735_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	2.3e-132
WP_000769011.1|2053750_2054299_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_001520089.1|2054350_2054992_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	64.1	1.8e-69
WP_000215799.1|2054985_2055675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520090.1|2055736_2057800_+	hypothetical protein	NA	Q775A3	Bordetella_phage	67.8	7.9e-276
WP_001520092.1|2057805_2058021_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000637722.1|2058017_2058317_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	64.2	5.5e-29
WP_000312946.1|2058306_2058576_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	65.9	3.0e-26
WP_021580418.1|2058581_2059292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520094.1|2059330_2060722_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	72.8	6.0e-211
>prophage 6
NZ_CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	2190201	2197341	4829687		Escherichia_phage(83.33%)	6	NA	NA
WP_104731940.1|2190201_2192763_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.7e-31
WP_022296754.1|2192868_2193525_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	6.2e-49
WP_001296319.1|2193575_2194343_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|2194538_2195447_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|2195443_2196706_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|2196702_2197341_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 7
NZ_CP014111	Escherichia coli strain FDAARGOS_144 chromosome, complete genome	4829687	4381297	4473873	4829687	protease,terminase,transposase,integrase,capsid,head,portal,plate,holin,tail	Shigella_phage(50.0%)	97	4423942:4423990	4464881:4464929
WP_000224517.1|4381297_4382644_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001524049.1|4382646_4383171_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001524050.1|4383167_4384460_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001524051.1|4384464_4385514_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001524054.1|4385477_4387319_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001524058.1|4387324_4387750_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_104731953.1|4387754_4389239_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|4389261_4389765_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|4390470_4390989_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001524064.1|4391209_4393441_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	8.0e-24
WP_001524065.1|4393453_4394218_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_032144280.1|4395223_4395748_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_001518352.1|4395732_4396275_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_001524069.1|4396259_4398353_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_000227712.1|4399620_4400124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|4400214_4400703_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001468559.1|4400973_4401744_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|4401897_4402371_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001526639.1|4402413_4404858_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|4405097_4405676_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_059338284.1|4405880_4406654_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4406624_4407365_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093933.1|4407676_4408426_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000006239.1|4408601_4409099_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001526640.1|4409214_4410954_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207551.1|4410898_4411684_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|4411754_4412810_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|4412861_4413155_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|4413157_4413556_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_071589393.1|4413565_4414018_+	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	27.5	1.3e-05
WP_022296578.1|4414207_4415347_+	RNA ligase RtcB family protein	NA	A0A222ZKP1	Mycobacterium_phage	30.1	3.2e-29
WP_059346544.1|4415343_4415958_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293022.1|4416013_4417471_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291991.1|4417731_4418190_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189575.1|4418281_4419526_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174684.1|4419583_4419985_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749899.1|4420085_4421141_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
WP_001285288.1|4421429_4422533_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|4422544_4423798_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
4423942:4423990	attL	CATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
WP_000051887.1|4424002_4425166_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_059338283.1|4425392_4425698_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	1.5e-50
WP_001242749.1|4425697_4426060_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|4426050_4426587_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_104731954.1|4426714_4427539_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	5.0e-149
WP_000135665.1|4427604_4427967_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	2.5e-60
WP_001345148.1|4428669_4429362_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_001191669.1|4429459_4429720_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_052970432.1|4429712_4430264_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	95.1	1.0e-97
WP_024249648.1|4430260_4431409_+	Rha family transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	80.2	3.1e-165
WP_000620696.1|4431405_4431630_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_024249647.1|4431626_4432445_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
WP_072108508.1|4432441_4432936_+	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	98.8	7.3e-87
WP_049144297.1|4432935_4433589_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	98.6	2.4e-125
WP_021576792.1|4433585_4433912_+	LexA repressor	NA	U5P451	Shigella_phage	99.1	5.9e-53
WP_000767113.1|4433908_4434298_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_021576793.1|4434317_4435115_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_021576794.1|4435122_4436112_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.4e-193
WP_021576795.1|4436129_4436471_+	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	99.1	4.7e-61
WP_024247596.1|4436492_4436954_-	hypothetical protein	NA	A0A0P0ZCX2	Stx2-converting_phage	99.3	1.2e-72
WP_000043971.1|4437024_4438056_-	hypothetical protein	NA	A0A0P0ZDC5	Stx2-converting_phage	100.0	1.3e-189
WP_001120492.1|4438336_4438663_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	100.0	1.4e-57
WP_021576797.1|4438666_4439143_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	4.1e-87
WP_021576798.1|4439126_4439519_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	91.5	3.7e-57
WP_123000322.1|4439403_4439676_+	peptidase	NA	Q8SBD8	Shigella_phage	84.1	1.1e-33
WP_021576799.1|4439702_4440053_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	1.2e-62
WP_000929175.1|4440178_4440673_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_128492023.1|4440906_4442403_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	2.8e-299
WP_000605606.1|4442414_4442597_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_104731956.1|4442596_4443838_+|portal	phage portal protein	portal	U5P411	Shigella_phage	98.8	2.9e-241
WP_001193631.1|4443815_4444466_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257504.1|4444480_4445686_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	3.1e-224
WP_000601363.1|4445735_4445936_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_000927719.1|4445938_4446262_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|4446258_4446669_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000213502.1|4446643_4447150_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000779292.1|4447146_4447707_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497751.1|4447715_4447886_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_061353157.1|4447869_4449366_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	U5P0H3	Shigella_phage	99.6	1.0e-277
WP_064503060.1|4449365_4449722_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	2.0e-62
WP_000661054.1|4449721_4449991_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_059338365.1|4450132_4451968_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.2	2.9e-306
WP_125108175.1|4452028_4453357_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	6.1e-245
WP_000999510.1|4453353_4454433_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_001259084.1|4454432_4454981_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_128492022.1|4454980_4455406_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	1.7e-79
WP_059338193.1|4455392_4456451_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.6	2.8e-200
WP_059338194.1|4456441_4457026_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.6e-112
WP_059338195.1|4457029_4457680_+	hypothetical protein	NA	S5FKM2	Shigella_phage	98.6	1.1e-114
WP_032144283.1|4457651_4458086_+|tail	tail assembly chaperone	tail	S5FXM8	Shigella_phage	97.2	5.1e-76
WP_141095334.1|4458857_4459907_-	acyltransferase family protein	NA	S5FNR8	Shigella_phage	98.6	2.3e-194
WP_059338196.1|4463391_4464321_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	99.7	7.9e-175
WP_059338197.1|4464317_4464680_-	GtrA family protein	NA	U5P0S6	Shigella_phage	99.2	2.3e-58
WP_001524121.1|4465081_4465420_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	47.7	4.8e-21
4464881:4464929	attR	CATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
WP_001059463.1|4465854_4466349_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000244358.1|4467387_4468761_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000544830.1|4471903_4472701_-	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_000952372.1|4472700_4473873_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
>prophage 1
NZ_CP014110	Escherichia coli strain FDAARGOS_144 plasmid unnamed1, complete sequence	115764	29048	57264	115764	integrase,transposase	Escherichia_phage(33.33%)	25	30713:30733	55712:55732
WP_000952372.1|29048_30221_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|30220_31018_+	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
30713:30733	attL	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
WP_001298676.1|31011_31842_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000343766.1|32260_33481_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000115885.1|33499_34018_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000619112.1|34152_34401_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000109079.1|34397_34835_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000340835.1|36109_36502_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103694.1|36506_37478_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|37706_38351_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|38344_38620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016979.1|38757_39567_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
WP_001159871.1|39567_39873_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|39874_40093_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000244358.1|41744_43118_-|transposase	IS4-like element ISEc13 family transposase	transposase	Q9JMP3	Wolbachia_phage	29.1	2.1e-43
WP_000990667.1|43972_44614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309253.1|45788_46766_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
WP_001066947.1|47008_47749_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001332784.1|47869_48058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|48424_49594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|50440_50713_-	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001298664.1|51955_53926_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|53932_54724_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|55462_56242_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
55712:55732	attR	CGGCAGATAGCCTATTTCATC	NA	NA	NA	NA
WP_001310017.1|56241_57264_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
