The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	1243159	1294246	5302595	tail,holin,coat,tRNA,integrase,terminase	Klebsiella_phage(21.28%)	64	1235825:1235841	1297978:1297994
1235825:1235841	attL	TATTCAGCGGCGGCAGC	NA	NA	NA	NA
WP_002914079.1|1243159_1243897_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004144357.1|1243881_1245501_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_121980491.1|1245829_1245925_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_002914074.1|1245921_1246497_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_002914072.1|1246529_1247180_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_002914070.1|1247179_1248136_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_004144354.1|1248132_1248612_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_104716491.1|1249043_1250273_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	95.8	1.5e-237
WP_023301228.1|1250250_1250526_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
WP_071557557.1|1250564_1250804_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
WP_104716492.1|1250811_1251120_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	1.2e-23
WP_104716493.1|1251116_1251800_-	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	44.2	5.8e-42
WP_104716494.1|1251834_1252923_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.0	1.1e-106
WP_104716495.1|1252935_1255974_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.9	5.0e-295
WP_023282477.1|1256111_1256267_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_004179600.1|1256275_1256467_-	YebW family protein	NA	NA	NA	NA	NA
WP_048230998.1|1256897_1257254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048230996.1|1257350_1257614_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104716496.1|1257616_1258153_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.8	3.1e-59
WP_004215886.1|1258500_1259421_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	61.3	1.7e-92
WP_004215885.1|1259417_1260161_+	replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.2	3.1e-65
WP_016946299.1|1260153_1260489_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.4e-11
WP_104716497.1|1260481_1261267_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	1.8e-63
WP_048279473.1|1261263_1261467_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	83.3	3.8e-26
WP_004184518.1|1261459_1261714_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.7	5.3e-09
WP_075995090.1|1261710_1261947_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	48.5	7.4e-13
WP_104716498.1|1261939_1262485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104716499.1|1263357_1263615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104716500.1|1263611_1265579_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	55.2	1.3e-203
WP_032423783.1|1265727_1265961_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	70.1	5.8e-26
WP_022631486.1|1266038_1266260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328006.1|1266317_1266917_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.9	1.3e-90
WP_004892208.1|1267125_1267422_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
WP_023282412.1|1267418_1267775_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
WP_023287514.1|1267890_1268712_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_024176410.1|1268968_1269268_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_023301209.1|1269264_1269804_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
WP_023320787.1|1269800_1270148_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
WP_104716501.1|1270144_1270420_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	91.2	3.5e-06
WP_104716502.1|1270370_1270565_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	90.2	1.2e-24
WP_032427058.1|1270561_1270822_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	58.0	2.1e-21
WP_073545918.1|1270926_1271163_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	62.8	3.8e-17
WP_104716504.1|1271412_1272417_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.3	1.7e-34
WP_087653572.1|1272394_1273699_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	2.7e-144
WP_087588067.1|1273702_1275127_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	70.9	8.3e-192
WP_104716505.1|1275110_1276223_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.1	1.2e-108
WP_048271641.1|1276326_1277091_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	62.2	1.3e-79
WP_104716506.1|1277178_1278315_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.6	1.3e-155
WP_104716507.1|1278850_1279261_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	41.2	9.3e-11
WP_074186757.1|1279262_1279496_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	50.8	2.6e-10
WP_104716508.1|1279482_1279866_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	5.4e-21
WP_064155820.1|1279867_1280419_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	40.4	1.0e-28
WP_064155821.1|1280415_1280808_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_104716509.1|1280831_1282004_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_104716510.1|1282057_1282540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072158607.1|1282677_1282884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|1282960_1283317_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_057775156.1|1283366_1283651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104716511.1|1283861_1287440_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	29.4	7.0e-78
WP_104716512.1|1287439_1287904_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	69.1	9.3e-60
WP_104716513.1|1288084_1288567_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	93.8	3.4e-81
WP_004190616.1|1288576_1288957_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
WP_104716514.1|1288953_1292016_+	kinase	NA	A0A286S259	Klebsiella_phage	94.0	0.0e+00
WP_043906946.1|1292092_1294246_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	9.6e-83
1297978:1297994	attR	GCTGCCGCCGCTGAATA	NA	NA	NA	NA
>prophage 2
NZ_CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	1360482	1375204	5302595	tail,integrase	Morganella_phage(50.0%)	18	1360235:1360255	1380299:1380319
1360235:1360255	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
WP_032424540.1|1360482_1361736_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	7.2e-147
WP_004213158.1|1361831_1362839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213159.1|1362969_1363188_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004213160.1|1363187_1363622_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
WP_004213161.1|1363635_1364238_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
WP_004213162.1|1364237_1364417_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023302683.1|1364413_1365379_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
WP_004213165.1|1365375_1365879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213166.1|1365875_1366085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213167.1|1366081_1366708_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
WP_004213168.1|1366717_1367068_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
WP_004213169.1|1367060_1369823_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
WP_032424539.1|1370162_1370609_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_004213171.1|1370589_1370973_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213172.1|1370977_1371451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213173.1|1371634_1371805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|1371804_1372131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213175.1|1372138_1375204_+|tail	phage tail length tape-measure protein 1	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
1380299:1380319	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 3
NZ_CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	1717107	1724012	5302595	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1717107_1717971_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004214747.1|1717981_1718755_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_004151134.1|1718995_1719892_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1720134_1721496_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004201558.1|1721814_1722537_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004214740.1|1722533_1724012_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 4
NZ_CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	2687296	2696710	5302595		Escherichia_phage(87.5%)	9	NA	NA
WP_161267581.1|2687296_2688931_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.5	4.4e-181
WP_004176258.1|2688985_2690251_+	MFS transporter	NA	NA	NA	NA	NA
WP_004209813.1|2690281_2691370_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
WP_004176262.1|2691456_2691717_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2692014_2692875_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004209817.1|2692895_2693657_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
WP_002903955.1|2693917_2694820_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004183946.1|2694831_2696097_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|2696089_2696710_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	2731918	2811232	5302595	tail,head,holin,protease,capsid,portal,integrase,terminase	Klebsiella_phage(21.43%)	88	2757534:2757550	2790296:2790312
WP_004209779.1|2731918_2732731_+|protease	serine protease	protease	NA	NA	NA	NA
WP_002903685.1|2732744_2732861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903683.1|2732904_2733234_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903681.1|2733220_2733583_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903679.1|2734025_2735060_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002903677.1|2735284_2736940_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_004143107.1|2736939_2737782_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_002903639.1|2737799_2738099_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143105.1|2738091_2738925_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004209782.1|2738924_2739725_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004209783.1|2739861_2740821_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004209784.1|2740824_2741442_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004209787.1|2741441_2742344_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_004148289.1|2742333_2743260_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022615525.1|2743417_2745073_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004209791.1|2745337_2746258_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004179716.1|2746421_2746778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004183910.1|2746933_2748550_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176303.1|2748546_2749266_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_004209794.1|2749246_2750197_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004209796.1|2750264_2753042_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.0	6.8e-65
WP_002903581.1|2753759_2755196_+	anion permease	NA	NA	NA	NA	NA
WP_004152246.1|2755250_2756903_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_023302609.1|2757065_2758682_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
2757534:2757550	attL	CTGCTGCTGGCGCTGTT	NA	NA	NA	NA
WP_004143067.1|2759726_2760116_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004215412.1|2760108_2760873_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_020316475.1|2760862_2762215_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004214878.1|2762224_2763427_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004176317.1|2763437_2764094_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|2764104_2764791_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151560.1|2764960_2765767_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143055.1|2765763_2766327_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004148273.1|2766428_2767337_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004214881.1|2767503_2768814_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004176321.1|2768813_2770259_+	amidohydrolase	NA	NA	NA	NA	NA
WP_022615523.1|2770378_2771497_+	transporter	NA	NA	NA	NA	NA
WP_004214887.1|2771625_2772726_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	8.3e-115
WP_004214894.1|2773927_2774227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022615522.1|2774394_2775039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022615521.1|2775094_2775829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039108567.1|2775841_2777995_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	4.8e-90
WP_016530179.1|2778067_2781145_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
WP_022615519.1|2781141_2781522_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_004864228.1|2781534_2782011_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177132.1|2781997_2782471_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_039108569.1|2782491_2785881_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	60.5	0.0e+00
WP_016530182.1|2785941_2786175_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_016530183.1|2786248_2786554_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530184.1|2786556_2786961_-|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	57.4	3.2e-32
WP_016530185.1|2786991_2787696_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	6.6e-81
WP_016530186.1|2787752_2788100_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_016530187.1|2788096_2788546_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	7.4e-62
WP_016530188.1|2788542_2788881_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	7.8e-40
WP_016530189.1|2788889_2789207_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.0	1.8e-22
WP_023284978.1|2789284_2790523_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.4	1.8e-158
2790296:2790312	attR	CTGCTGCTGGCGCTGTT	NA	NA	NA	NA
WP_000999827.1|2790532_2791132_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_016530190.1|2791124_2792351_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_016530191.1|2792340_2792502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025108055.1|2792498_2794250_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	4.0e-252
WP_016530193.1|2794253_2794751_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
WP_023317581.1|2794908_2795259_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	81.6	4.6e-51
WP_039108578.1|2795360_2795762_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_039108580.1|2795837_2796083_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	91.4	4.8e-31
WP_039108582.1|2796402_2796594_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	94.6	3.4e-24
WP_039108585.1|2796544_2796820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039108587.1|2796816_2797164_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	2.0e-38
WP_039108588.1|2797160_2797700_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	97.2	4.8e-100
WP_024176410.1|2797696_2797996_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_125330507.1|2798811_2799138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004886669.1|2799405_2800227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004886665.1|2800251_2800737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004886660.1|2800785_2801127_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	2.5e-54
WP_039108593.1|2801145_2802126_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
WP_000779146.1|2802138_2802516_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_039108595.1|2802525_2803335_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.5	5.0e-109
WP_039108597.1|2803331_2804270_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	74.2	2.0e-101
WP_004184738.1|2804259_2804439_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_004213338.1|2804676_2805138_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_016530206.1|2805163_2805361_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_032408726.1|2805465_2806113_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_004213349.1|2806880_2807180_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
WP_004213351.1|2807179_2807965_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	5.3e-63
WP_004213355.1|2808092_2808437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039108606.1|2808429_2809092_+	morphogenetic protein	NA	Q71T76	Escherichia_phage	56.0	2.2e-54
WP_039108608.1|2809088_2809274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530209.1|2809393_2809654_+	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_002903398.1|2810265_2810424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213367.1|2810716_2811232_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.9	2.0e-23
>prophage 6
NZ_CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	3109110	3154112	5302595	tail,head,capsid,portal,plate,tRNA,integrase,terminase	Enterobacteria_phage(51.43%)	56	3114338:3114355	3150379:3150396
WP_004213129.1|3109110_3109611_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3109727_3110174_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|3110157_3110952_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020324105.1|3111059_3112235_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3112266_3112959_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|3113104_3113614_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|3113618_3113957_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176548.1|3113946_3114186_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3114338:3114355	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|3114450_3114702_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_032432765.1|3114745_3115885_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.0	1.6e-145
WP_064146766.1|3116039_3117212_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_064146767.1|3117211_3117727_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	60.6	6.3e-57
WP_004131585.1|3117772_3118090_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_071993210.1|3118110_3118248_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_104716547.1|3118234_3121210_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	4.4e-219
WP_064146769.1|3121224_3121698_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	67.6	1.3e-53
WP_064146770.1|3122160_3122823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077274787.1|3122840_3124064_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_064146771.1|3124663_3125761_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_104716548.1|3125760_3125973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064146772.1|3125969_3128996_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_060568679.1|3128985_3129909_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	5.8e-53
WP_004131573.1|3129910_3130261_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
WP_064146773.1|3130257_3130845_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	2.6e-59
WP_064146774.1|3130841_3131477_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	52.4	1.6e-57
WP_064146775.1|3131473_3131941_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_158608812.1|3131941_3132277_-	peptidase	NA	B6SD31	Bacteriophage	34.4	4.3e-06
WP_064146776.1|3132463_3133009_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	7.4e-32
WP_104716549.1|3133005_3133290_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_004131559.1|3133280_3133481_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_047720963.1|3133480_3133996_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_064146777.1|3134108_3134966_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.5	2.8e-70
WP_048299350.1|3135015_3136050_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_048299349.1|3136059_3136899_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	1.2e-94
WP_104716550.1|3137055_3138783_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
WP_104716551.1|3138776_3139838_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.6	4.1e-143
WP_151433774.1|3140429_3141956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064146780.1|3142590_3142857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064146781.1|3142853_3145481_-	replication protein	NA	A0A0M4RTM8	Salmonella_phage	51.8	7.1e-189
WP_064146782.1|3145498_3146455_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.1	1.9e-83
WP_162859387.1|3146451_3146643_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.8	2.7e-05
WP_064146784.1|3146689_3147256_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	32.6	5.5e-14
WP_004213098.1|3147252_3147477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216855.1|3147545_3147818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181449.1|3147833_3148211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|3148226_3148445_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|3148465_3148744_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|3148864_3149164_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_004216842.1|3149279_3150263_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004176549.1|3150527_3151541_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3150379:3150396	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|3151598_3151700_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3151699_3151774_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3151891_3152017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3152075_3152339_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3152469_3153108_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3153197_3154112_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 7
NZ_CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	3436537	3446001	5302595	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3436537_3438259_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3438285_3439005_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3439358_3439577_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3439697_3441977_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3442007_3442325_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3442650_3442872_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_023302553.1|3442948_3444889_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.2e-36
WP_002896440.1|3444885_3446001_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
NZ_CP026586	Klebsiella pneumoniae strain NUHL30457 chromosome, complete genome	5302595	3928525	3976176	5302595	head,coat,tRNA,integrase,terminase	Enterobacteria_phage(20.75%)	65	3927340:3927386	3973247:3973293
3927340:3927386	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_104716567.1|3928525_3930709_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	1.3e-82
WP_104716568.1|3930795_3933273_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.5	8.8e-197
WP_023341837.1|3933259_3933655_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	56.3	2.1e-36
WP_023341838.1|3933651_3934122_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_023283377.1|3934121_3934598_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_048987939.1|3934660_3935284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104716569.1|3935306_3938612_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	53.9	1.4e-213
WP_162859393.1|3938684_3939623_-	hypothetical protein	NA	A5VW58	Enterobacteria_phage	73.3	1.3e-81
WP_064484068.1|3939729_3939897_-	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
WP_077254637.1|3940022_3940376_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_063443022.1|3940416_3940851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724823.1|3940925_3941180_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	74.6	2.3e-20
WP_050008822.1|3941182_3941938_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.8	2.1e-61
WP_104716570.1|3942116_3942794_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	2.2e-73
WP_004151263.1|3942846_3943599_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_032442345.1|3943667_3944060_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.2	9.7e-34
WP_104716571.1|3944056_3944482_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	6.6e-28
WP_016528891.1|3944484_3944847_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	2.5e-20
WP_096834996.1|3944846_3945020_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
WP_104716572.1|3945019_3945403_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	77.2	8.0e-49
WP_104716573.1|3945405_3945645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104716574.1|3945677_3946733_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	3.5e-102
WP_101739635.1|3946729_3947191_-	hypothetical protein	NA	B1GS72	Salmonella_phage	51.0	1.7e-29
WP_104716575.1|3947190_3948546_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.9	5.1e-130
WP_104716576.1|3948611_3949292_-	HNH endonuclease	NA	S5M802	Pseudoalteromonas_phage	38.7	1.5e-37
WP_104716577.1|3949393_3950398_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.0	2.1e-112
WP_104716578.1|3950324_3951794_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	6.9e-149
WP_104716579.1|3951806_3953279_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.7	2.0e-249
WP_104716580.1|3953278_3953881_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	2.9e-77
WP_104716582.1|3954406_3954790_-	DUF2570 domain-containing protein	NA	M9NYX9	Enterobacteria_phage	51.2	2.1e-09
WP_043906736.1|3954786_3955290_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	8.5e-75
WP_004146347.1|3955292_3955607_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_050485953.1|3956121_3956577_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	39.4	3.6e-24
WP_032429601.1|3956759_3956900_-	YlcG family protein	NA	NA	NA	NA	NA
WP_032426208.1|3956896_3957259_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	3.3e-52
WP_004141687.1|3957255_3957546_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	5.3e-45
WP_104716583.1|3957538_3957709_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	63.6	1.6e-09
WP_004884220.1|3957708_3958164_-	dLP12 prophage	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
WP_023339691.1|3959185_3959374_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
WP_104716584.1|3959373_3959682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104716585.1|3959788_3960169_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.3	9.2e-13
WP_012542626.1|3960165_3960459_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_162859394.1|3960458_3961874_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.5	1.1e-183
WP_073545955.1|3961878_3962730_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.3	6.9e-85
WP_004151298.1|3962770_3962917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043875707.1|3963002_3963224_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_097403957.1|3963263_3963482_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.1e-13
WP_004191591.1|3963590_3964250_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	62.4	8.3e-70
WP_032452107.1|3964575_3966018_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_087835226.1|3966095_3966299_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	3.5e-19
WP_162859389.1|3966584_3966743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|3966735_3966942_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_016529276.1|3967022_3967307_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_104716587.1|3967322_3968168_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.0	4.5e-68
WP_004223153.1|3968164_3968845_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	2.3e-123
WP_004178787.1|3968841_3969270_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	7.5e-64
WP_104716588.1|3969266_3969920_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	3.3e-111
WP_074182332.1|3969916_3970375_+	HNH endonuclease	NA	G9FH70	Rhodococcus_phage	42.1	2.1e-24
WP_004146321.1|3971420_3971639_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_101839117.1|3971640_3971856_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	57.1	1.2e-14
WP_004151317.1|3971857_3972193_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_104716589.1|3972069_3973233_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_004143017.1|3973664_3974531_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3973247:3973293	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|3974532_3974745_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|3974790_3976176_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP026587	Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence	215697	44378	93564	215697	integrase,transposase	Bacillus_phage(27.78%)	41	34840:34854	80501:80515
34840:34854	attL	TTTGTTGAATAAATA	NA	NA	NA	NA
WP_004213592.1|44378_47348_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
WP_004213590.1|47350_47908_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_000118563.1|48037_49114_-	signal peptidase II	NA	NA	NA	NA	NA
WP_104716610.1|49110_51516_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000405672.1|51601_52036_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004152084.1|52331_53732_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|53728_54409_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004213583.1|54463_55393_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|55397_55778_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_011251290.1|55817_56714_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_004213580.1|56713_58531_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|58764_59214_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|59502_60240_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|60273_60471_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|60511_62959_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|63085_63526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|63612_66759_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004213579.1|66769_68062_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004213578.1|68175_68538_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004213577.1|68566_69952_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_004213574.1|70141_70822_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
WP_000555737.1|70814_72290_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_023302802.1|72540_72972_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004213569.1|73115_73466_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
WP_023302803.1|73852_74761_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_004213565.1|75397_76372_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_077250520.1|77304_78117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213560.1|78113_78893_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_004213558.1|79037_79967_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_077250517.1|80279_80438_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_011154535.1|80552_81521_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.1e-171
80501:80515	attR	TTTGTTGAATAAATA	NA	NA	NA	NA
WP_023302792.1|81561_82416_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004215174.1|82464_84690_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
WP_004215173.1|84691_85594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225020.1|85677_85860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004215188.1|85878_86340_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004215186.1|86455_87403_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004225018.1|87738_88734_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|88939_89953_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|90065_90593_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077250518.1|90606_93564_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
>prophage 2
NZ_CP026587	Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence	215697	137373	213005	215697	integrase,transposase	Salmonella_phage(17.65%)	59	136826:136844	197114:197132
136826:136844	attL	GATTTATTCAACAAAGCCC	NA	NA	NA	NA
WP_004213833.1|137373_138510_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004213829.1|138575_138893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|139044_139368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011154511.1|140119_141079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186937.1|141121_141529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213821.1|141538_141982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213807.1|143245_144214_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_023302784.1|144541_146134_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	4.2e-176
WP_104716613.1|146164_146515_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	1.5e-38
WP_004215130.1|146511_146952_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004902307.1|147148_147331_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_023302806.1|148579_149551_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	6.6e-156
WP_004211841.1|149550_150717_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
WP_004211839.1|151446_152457_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_004211835.1|154776_155313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004214667.1|158063_158846_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
WP_004902343.1|161192_161630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902347.1|161629_162661_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
WP_011251296.1|162660_163527_-	ParA family protein	NA	NA	NA	NA	NA
WP_011154535.1|166198_167167_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.1e-171
WP_004213078.1|167257_167548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213077.1|167899_168106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213076.1|168095_168389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213075.1|168404_169538_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_004213073.1|170145_170376_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004213072.1|170372_170816_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_032488580.1|171959_172598_+	RmpA2	NA	NA	NA	NA	NA
WP_004213934.1|173609_174530_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_011251327.1|174578_175070_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_004213932.1|175132_175408_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004902152.1|175491_175920_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_004213927.1|175957_176518_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213925.1|176559_176820_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
WP_004213924.1|177486_179688_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_104716614.1|179769_181047_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_004213922.1|181050_182784_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_004213921.1|182783_183731_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004213920.1|183731_185456_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_023302795.1|185612_186812_+	MFS transporter	NA	NA	NA	NA	NA
WP_004213918.1|187509_187704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145290.1|188564_189074_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
WP_004213915.1|189623_189941_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_004902159.1|190177_190564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902162.1|190661_191861_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_004213424.1|192267_192975_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032412871.1|193637_194636_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004213250.1|194641_195598_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004213252.1|195619_196447_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
WP_011154535.1|197146_198115_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.1e-171
197114:197132	attR	GGGCTTTGTTGAATAAATC	NA	NA	NA	NA
WP_004902375.1|198221_198545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302796.1|199728_200382_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004213611.1|201939_202491_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004213613.1|202563_203466_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004213615.1|203608_203830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213617.1|203891_206066_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	30.6	2.8e-05
WP_004902400.1|206525_207755_-	esterase family protein	NA	NA	NA	NA	NA
WP_023302798.1|207859_211504_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.7	3.2e-46
WP_004213623.1|211646_212762_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_074160420.1|212777_213005_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP026588	Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence	126149	0	12940	126149		Escherichia_phage(37.5%)	18	NA	NA
WP_006788217.1|1244_1424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|1543_2170_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004098982.1|2834_3710_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197646.1|4121_5393_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_001568036.1|5392_5824_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_001568038.1|6057_7029_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_015345000.1|7031_7703_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|7766_7997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343518.1|8115_8232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|8433_9135_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568042.1|9134_9356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|9365_9785_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_013214013.1|9838_10606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015344998.1|10678_11035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015060021.1|11049_11715_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_013214014.1|11757_12264_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_001568047.1|12306_12498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|12685_12940_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
>prophage 2
NZ_CP026588	Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence	126149	15978	20338	126149		Vibrio_phage(33.33%)	5	NA	NA
WP_004152756.1|15978_16542_+	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
WP_015344995.1|16913_17255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015344994.1|17371_17914_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_001568055.1|17962_18211_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_013023805.1|18280_20338_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.2e-21
>prophage 3
NZ_CP026588	Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence	126149	26264	31185	126149	transposase	Klebsiella_phage(20.0%)	9	NA	NA
WP_013023814.1|26264_26621_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
WP_013023815.1|26681_26894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152719.1|26904_27129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|27209_27530_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|27519_27798_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_013023817.1|27798_28212_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015344990.1|28347_29556_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.3	2.8e-47
WP_074421342.1|29883_30060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152492.1|30363_31185_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 4
NZ_CP026588	Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence	126149	65741	108539	126149	transposase,integrase	Escherichia_phage(25.0%)	42	91743:91802	105959:106779
WP_013023834.1|65741_66467_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
WP_013609537.1|66538_67132_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023836.1|67292_67895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343481.1|67944_68589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343480.1|68644_69295_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004152383.1|69291_69600_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_001067858.1|69787_70492_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_048337415.1|70525_70783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493286.1|71018_71348_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|71328_71610_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_077256884.1|71756_72332_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
WP_012477564.1|72382_72973_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|73109_73682_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_001493761.1|73718_75110_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|75391_76048_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_011091028.1|80012_80888_+	class A extended-spectrum beta-lactamase CTX-M-3	NA	A0A1B0VBP7	Salmonella_phage	82.1	5.4e-125
WP_013023839.1|80934_81411_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_000027057.1|81669_82530_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|82712_83270_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143759.1|83433_86439_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.8	0.0e+00
WP_094545105.1|86440_87169_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214121.1|87385_88600_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001255015.1|88627_88933_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|89199_90399_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|90504_91155_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|91186_91429_-|transposase	transposase	transposase	NA	NA	NA	NA
91743:91802	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|91805_92510_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|92631_93537_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|93533_94772_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|94771_95356_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|95848_96613_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000050481.1|97496_99038_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|99442_100282_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|100275_100623_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749984.1|100739_101585_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_001749985.1|101765_102239_-	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
WP_001749986.1|102371_102824_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_063840321.1|102920_103475_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_000845048.1|103766_104780_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|105250_105955_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001323889.1|106278_107856_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
105959:106779	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTCCTCCTGAGGGAAATGTGTCAGGAAGAAATCTATGACCCTTGACGGCGTATGTCAATCAATTCGGAAGGCAACTCTATTCTGACGATTTAGCGCCGGATGGTCTGACGCCAAGTTAGGGTATAGCCTAGATTGACATGCGCGATGCAACCCTTAACTTGCTTGCACCTATCGTTTCCATGCTAGCTTTATCGTAACGCTCAAGAAATTGGGCTTAATGCCGAAAACAATAAAATAAAACAGCCAACCCTTGAGGTTCTTATGCGCCAGAATTTACCAGTGACGGGTCGAAACTTAGAACTCCCAAAAGATGCCAATATTCTTTCGACTACCTCCCCTCAAAGCCATATCACGTACGTTAATCCTGACTTCATTAAAATCAGTGGTTTCACTGAGGAAGAACTATTAGGCCAGCCTCACAACATCGTAAGACACCCAGATATGCCGCCTGCTGCATTTGAGCATATGTGGAGTACATTAAAATCTGGCCGCTCATGGATGGGGCTAGTAAAAAATCGCTGTAAAAATGGCGACCACTATTGGGTAAGTGCTTATGTAACGCCAATAGCTAAGAATGGTTCGATTGTTGAATACCAGTCTGTAAGGACCAAGCCTGAACCTGAGCAGGTTTTGGCTGCGGAAAAATTATATGCTCAATTGAGAAGCGGGAAGGCCGCGAGGCCGAAATTGGCTGCTAGCTTTTCCGTGAAAATACTCTTGCTCATATGGGGTAGTATTATATCAAGCGCAATGGCTGCCGGC	NA	NA	NA	NA
WP_014343478.1|108059_108539_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	2.7e-17
>prophage 1
NZ_CP026589	Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence	89247	2356	57722	89247	protease,transposase	Escherichia_phage(32.0%)	67	NA	NA
WP_000616807.1|2356_3010_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|3102_3360_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|3292_3694_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|5004_5709_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014342101.1|6117_6240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|6219_7095_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|7129_8098_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|9848_10553_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|11663_12368_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839979.1|12433_12952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104716615.1|12956_13373_-	FosA3/FosA4 family fosfomycin resistance glutathione transferase	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|13758_14463_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000957857.1|15140_15329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|15420_15957_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|16139_17000_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|17169_17925_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067858.1|18374_19079_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_071557810.1|19069_19210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|21020_21302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|21424_21775_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|21777_22740_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|22886_23180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|23256_23940_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|23940_24162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|24175_24610_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001198928.1|25849_26275_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271762.1|26321_26744_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_104716616.1|26740_26923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012372796.1|27236_28904_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_000218642.1|30303_30534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|30585_31947_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_015059007.1|31993_32557_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
WP_021537720.1|32556_32805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290834.1|33399_33927_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|33984_34218_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000845953.1|36370_36805_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|36801_37521_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|37800_37959_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_012881134.1|38574_38811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272251.1|38873_39170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234445.1|39280_40102_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_104716617.1|40398_41046_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|41322_41706_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_015059009.1|41896_42583_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_001254386.1|42676_42904_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_021519752.1|42937_43303_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012106.1|43317_43629_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399794.1|43650_44217_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_072095570.1|44227_44932_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_032297072.1|44931_46359_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000002778.1|46348_46939_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_001352845.1|46892_47123_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_001038341.1|47134_47386_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_062955122.1|47382_47898_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001278692.1|48032_48254_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	39.4	4.4e-07
WP_001067855.1|49069_49774_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013213989.1|50089_50515_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213988.1|50642_50798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213987.1|50843_51140_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004199234.1|52374_53256_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_014343469.1|53272_53419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213985.1|53531_54512_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_014343468.1|54634_55108_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_001067855.1|55147_55852_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_008324180.1|55977_56352_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
WP_015493069.1|56977_57337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324183.1|57398_57722_-	hypothetical protein	NA	I3UM57	Rhodobacter_phage	38.1	6.0e-13
>prophage 2
NZ_CP026589	Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence	89247	62205	76011	89247	transposase	Enterobacteria_phage(18.18%)	18	NA	NA
WP_015493072.1|62205_62460_-	hypothetical protein	NA	H9C187	Pectobacterium_phage	46.2	5.2e-12
WP_015493073.1|62652_62844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|62886_63393_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493075.1|63797_64577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|64630_65050_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493077.1|65060_65282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|65281_65959_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493079.1|66317_66989_+	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_015493080.1|67168_67591_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493081.1|67590_68862_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_016479949.1|68997_69969_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493083.1|69965_71171_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_022652286.1|71533_72166_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_040219232.1|72219_72420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493085.1|72566_73517_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_015493086.1|73513_74125_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493087.1|74121_74517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|75030_76011_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP026590	Klebsiella pneumoniae strain NUHL30457 plasmid p4, complete sequence	49215	11561	18429	49215	integrase,transposase	Escherichia_phage(33.33%)	7	12247:12261	22131:22145
WP_001067855.1|11561_12266_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
12247:12261	attL	GCAGAGTTTTTGAAA	NA	NA	NA	NA
WP_000845048.1|12480_13494_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|13649_14123_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|14343_14610_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|14752_15517_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|15777_16992_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|17025_18429_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
22131:22145	attR	GCAGAGTTTTTGAAA	NA	NA	NA	NA
