The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	1071983	1083337	4021165		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004246075.1|1071983_1073183_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|1073792_1074761_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_075206322.1|1074786_1076913_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.2e-205
WP_104836297.1|1076941_1077346_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	6.3e-12
WP_004246071.1|1077357_1077582_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_017827772.1|1077863_1078337_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1078534_1078744_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246058.1|1079200_1079575_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1079590_1080556_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1080657_1081302_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1081663_1081927_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1082125_1083337_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 2
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	1392986	1430708	4021165	holin,head,terminase,integrase,lysis	Pectobacterium_phage(21.62%)	51	1384994:1385008	1410556:1410570
1384994:1385008	attL	TTCACTAAGTAACTT	NA	NA	NA	NA
WP_104836351.1|1392986_1394162_-|integrase	site-specific integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	30.1	2.7e-31
WP_020945460.1|1394163_1394376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250516.1|1394988_1395168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836353.1|1395215_1395716_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	55.2	1.2e-39
WP_104836354.1|1395715_1397683_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.4	8.4e-118
WP_004250523.1|1397695_1397956_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_036895402.1|1397955_1398288_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	38.1	4.7e-05
WP_004250527.1|1398744_1399503_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
WP_004250529.1|1399607_1399865_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020945464.1|1399905_1400361_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	9.9e-30
WP_004250533.1|1400378_1400603_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_104836355.1|1400604_1401435_+	replication protein	NA	H9C164	Pectobacterium_phage	59.3	4.4e-36
WP_104836356.1|1401424_1402843_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	60.8	6.8e-170
WP_104836357.1|1402897_1403074_+	palmdelphin	NA	NA	NA	NA	NA
WP_104836358.1|1403076_1403310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836359.1|1403313_1403655_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	51.4	2.1e-24
WP_104836360.1|1403685_1404588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250549.1|1404701_1405295_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.7	1.5e-57
WP_071425521.1|1405306_1405618_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	1.0e-33
WP_088207136.1|1405652_1406201_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	44.9	6.3e-31
WP_020945472.1|1406328_1406649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250554.1|1406783_1406981_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	65.4	1.1e-09
WP_104836859.1|1407135_1408170_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	70.8	3.7e-141
WP_088206692.1|1408483_1409053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088207259.1|1409344_1409650_+|holin	holin	holin	F1C5D1	Cronobacter_phage	52.4	5.1e-22
WP_104836860.1|1409681_1410035_+	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	79.8	6.7e-42
WP_104836361.1|1410040_1410487_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	33.1	1.4e-12
WP_104836362.1|1410826_1411849_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	39.8	3.2e-36
1410556:1410570	attR	AAGTTACTTAGTGAA	NA	NA	NA	NA
WP_071425526.1|1411970_1412447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836363.1|1412729_1414127_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	3.3e-84
WP_104836364.1|1414131_1415634_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.7	1.1e-101
WP_049209903.1|1415671_1416385_+|head	head protein	head	A0A2H5BG15	Pseudoalteromonas_phage	34.8	2.0e-32
WP_104836365.1|1416381_1417641_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.6e-45
WP_036908136.1|1417640_1418138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250578.1|1418137_1419205_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
WP_004250579.1|1419274_1419616_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	33.6	2.7e-08
WP_104836366.1|1419618_1420050_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.7	2.0e-11
WP_049199483.1|1420049_1420508_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	37.6	3.2e-12
WP_004250582.1|1420507_1420879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250583.1|1420865_1421381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836367.1|1421389_1422877_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.7	2.5e-82
WP_004250586.1|1422887_1423340_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_004250588.1|1423380_1423839_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_104836368.1|1423922_1426217_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	27.5	8.8e-18
WP_104836369.1|1426213_1426741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020945489.1|1426740_1427058_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
WP_036937853.1|1427023_1427839_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	1.8e-10
WP_049197352.1|1427841_1428534_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
WP_004250600.1|1428530_1428875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836370.1|1428867_1430055_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.9	3.0e-70
WP_049213669.1|1430051_1430708_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.9	1.3e-38
>prophage 3
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	1509574	1596441	4021165	tRNA,portal,head,protease,transposase,terminase,tail,integrase,lysis,capsid	Morganella_phage(26.19%)	92	1513086:1513145	1555009:1555219
WP_004247117.1|1509574_1510678_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1510783_1511236_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_104836381.1|1511228_1511858_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004251822.1|1511996_1513250_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
1513086:1513145	attL	ATGCTACGCCACATGGGGTGGACAGAAGCCGCTGACTTAATCATTAAAGGTATGGAAGGC	NA	NA	NA	NA
WP_104836382.1|1513359_1514493_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	72.2	1.4e-154
WP_087803552.1|1514467_1514719_-	excisionase	NA	NA	NA	NA	NA
WP_049219749.1|1514804_1515329_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	61.0	2.3e-54
WP_081353450.1|1515850_1516282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233779.1|1516271_1518146_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	26.7	5.4e-13
WP_103004815.1|1518242_1518899_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	73.5	1.3e-86
WP_103004814.1|1518994_1519222_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	50.0	7.9e-12
WP_104836383.1|1519260_1519737_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	1.8e-45
WP_017628377.1|1519998_1520178_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
WP_104836862.1|1520735_1521251_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	3.5e-23
WP_098943240.1|1521272_1522079_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	4.0e-90
WP_104836384.1|1522075_1523101_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.1	6.4e-85
WP_104836385.1|1523128_1523527_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	53.5	1.6e-31
WP_004244726.1|1523867_1524080_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_104836386.1|1524411_1524870_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_104836387.1|1525482_1527036_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	26.4	2.4e-19
WP_104836863.1|1527122_1528157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836388.1|1528637_1529060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334538.1|1529125_1529395_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_104836389.1|1529394_1529865_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.8	8.9e-50
WP_104836390.1|1530007_1530469_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.2	4.8e-24
WP_036937625.1|1530741_1530945_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_036937622.1|1531771_1532284_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	65.7	1.9e-58
WP_036976739.1|1532365_1532773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036937620.1|1532769_1533108_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	68.8	8.3e-42
WP_017628364.1|1533225_1533693_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	1.6e-43
WP_017628363.1|1533646_1535380_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_017628362.1|1535379_1536648_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|1536665_1537334_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|1537337_1538504_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|1538542_1538842_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|1538841_1539171_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_017628358.1|1539160_1539634_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	8.2e-11
WP_017628357.1|1539639_1539981_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|1539990_1540656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|1540720_1541137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|1541133_1541412_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1541436_1541628_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628353.1|1541754_1545030_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|1545030_1545627_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|1545626_1546208_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|1546224_1546560_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|1546638_1547037_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
WP_049219718.1|1551443_1551782_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_049219717.1|1551925_1552174_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081232609.1|1552227_1554411_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	60.3	2.1e-16
WP_020945527.1|1555341_1555500_-|transposase	transposase	transposase	NA	NA	NA	NA
1555009:1555219	attR	ATGCTACGCCACATGGGGTGGACAGAAGCCGCTGACTTAATCATTAAAGGTATGGAAGGCGCGATTGCCGCTAAGACTGTAACTTATGATTTCGAACGTCAGTTAGAAGGCGCTAAACTACTGAAATGTAGCGAGTTTGGTGACGCGATTATCAAACATATGTAATTGTTGATTTGATAAATAGTTAACGGGAGCTTATTAGTTCCCGTTT	NA	NA	NA	NA
WP_158660324.1|1557011_1557254_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.7	2.6e-21
WP_063108987.1|1558072_1559197_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004247907.1|1559637_1559850_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
WP_004242516.1|1560176_1560635_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_064506144.1|1561124_1561586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247909.1|1561709_1562084_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004242519.1|1562173_1563022_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_074154164.1|1563261_1563459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836391.1|1563482_1564025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026090443.1|1564866_1565181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247912.1|1565831_1566473_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
WP_104836393.1|1566485_1567712_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.9	1.7e-60
WP_020945535.1|1568270_1568933_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012367822.1|1569495_1569852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063108993.1|1570509_1571505_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_004242534.1|1572387_1572609_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004242536.1|1573034_1573316_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_004242537.1|1573677_1574091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251481.1|1574118_1574361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242541.1|1574423_1574984_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
WP_004242542.1|1575359_1575557_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_004242544.1|1575574_1576351_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004242548.1|1576585_1576969_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_004247922.1|1577111_1577975_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004247923.1|1578086_1578518_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.1	1.8e-20
WP_012367826.1|1578691_1579429_+	phosphatase	NA	NA	NA	NA	NA
WP_020945539.1|1579515_1580064_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_004242555.1|1580514_1580910_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_004251473.1|1581220_1581655_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.5	5.9e-24
WP_004242561.1|1582295_1582799_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_004242563.1|1583331_1583724_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_004251471.1|1583723_1584623_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_004242565.1|1584670_1585012_+	YebY family protein	NA	A0A2H4JCQ9	uncultured_Caudovirales_phage	32.7	1.5e-06
WP_004242567.1|1585311_1585554_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_004242568.1|1585766_1588085_-	MCE family protein	NA	NA	NA	NA	NA
WP_104836394.1|1588026_1589283_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_004242571.1|1589560_1590058_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004242572.1|1590153_1590846_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_017827230.1|1590865_1592926_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	2.1e-82
WP_004242576.1|1593830_1595183_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_004242578.1|1595562_1596441_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	1811749	1821741	4021165		Escherichia_phage(66.67%)	8	NA	NA
WP_017628120.1|1811749_1813807_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
WP_004248043.1|1813818_1815519_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1815854_1816541_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1816540_1817002_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_104836433.1|1817054_1817666_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	5.6e-28
WP_004242891.1|1817805_1818666_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_004242892.1|1818667_1819285_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|1819296_1821741_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 5
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2156320	2165148	4021165	holin	Salmonella_phage(25.0%)	10	NA	NA
WP_104836480.1|2156320_2157373_-	nucleotidyltransferase	NA	A0A067XQU1	Caulobacter_phage	22.8	1.2e-06
WP_012368028.1|2157356_2158136_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.3	1.1e-31
WP_104836481.1|2158514_2159009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836482.1|2159008_2159353_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	84.3	2.6e-43
WP_104836483.1|2159355_2159628_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	37.8	3.2e-12
WP_020945795.1|2159624_2159996_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_104836484.1|2160082_2161537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836485.1|2161523_2162453_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	83.0	1.2e-146
WP_104836486.1|2162452_2162815_-	GtrA family protein	NA	S5FXN2	Shigella_phage	53.8	4.0e-26
WP_104836487.1|2162955_2165148_-	hypothetical protein	NA	A0A2P0QGN7	Salmonella_phage	48.6	1.9e-126
>prophage 6
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2169288	2201299	4021165	integrase,terminase,tail	Escherichia_coli_O157_typing_phage(21.43%)	39	2184862:2184877	2207066:2207081
WP_104836490.1|2169288_2172372_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	51.1	1.9e-164
WP_087726493.1|2172374_2172923_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	1.2e-45
WP_104836491.1|2172922_2173411_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.9	2.7e-49
WP_104836492.1|2173394_2175857_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.1	0.0e+00
WP_104836493.1|2175856_2176462_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	6.7e-66
WP_020945806.1|2176461_2176773_-	hypothetical protein	NA	Q858G5	Salmonella_phage	38.5	8.8e-14
WP_036936189.1|2176836_2177178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836494.1|2177186_2177618_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	2.5e-30
WP_004243350.1|2177676_2178657_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
WP_046334336.1|2178672_2179350_-	peptidase	NA	T1SAP9	Salmonella_phage	64.3	4.0e-43
WP_104836495.1|2179379_2179694_-	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	6.8e-14
WP_104836496.1|2179690_2181355_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	65.2	3.7e-199
WP_104836497.1|2181364_2181577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836498.1|2181761_2183243_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	76.7	3.4e-228
WP_104836499.1|2183242_2183812_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	48.1	2.0e-43
WP_104836500.1|2183857_2184505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836501.1|2184533_2184875_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.1	4.8e-29
2184862:2184877	attL	GGTGATTTAGCCATTA	NA	NA	NA	NA
WP_158660325.1|2184934_2185282_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_104836503.1|2185404_2185800_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.0	2.0e-34
WP_046334325.1|2185796_2186210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243368.1|2186456_2187182_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
WP_104836504.1|2187181_2188024_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	59.7	3.8e-51
WP_004243371.1|2188034_2188220_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
WP_064505757.1|2188359_2188638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243373.1|2188714_2189323_+	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
WP_046334324.1|2189719_2191444_+	DNA breaking-rejoining protein	NA	A0A0U2I1R6	Escherichia_phage	47.6	1.2e-112
WP_046334323.1|2191489_2192530_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	50.4	3.5e-99
WP_004250862.1|2192573_2192831_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004250861.1|2192884_2193079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836505.1|2193115_2193400_+	hypothetical protein	NA	A0A1P8DTG9	Proteus_phage	90.4	2.0e-44
WP_104836506.1|2193399_2193894_+	ASCH domain-containing protein	NA	A0A077KCB2	Edwardsiella_phage	26.4	2.9e-11
WP_071425471.1|2193893_2194427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060555936.1|2194496_2195213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060555937.1|2195247_2195721_+	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.7	1.2e-70
WP_104836507.1|2195717_2196359_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	60.6	8.6e-72
WP_004250849.1|2196361_2196559_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	3.4e-19
WP_104836508.1|2196754_2197951_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.4	3.1e-139
WP_104836509.1|2198170_2199748_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004243391.1|2199832_2201299_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
2207066:2207081	attR	TAATGGCTAAATCACC	NA	NA	NA	NA
>prophage 7
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2384523	2403412	4021165	holin,lysis	Escherichia_phage(21.43%)	21	NA	NA
WP_012368081.1|2384523_2386962_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2386973_2387591_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2387594_2388371_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_104836535.1|2388486_2389029_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	2.7e-18
WP_017628013.1|2389597_2389777_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243615.1|2391176_2391833_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_104836536.1|2391829_2393017_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.9	1.3e-73
WP_004243617.1|2393009_2393354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368086.1|2393350_2394043_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	1.6e-34
WP_004243622.1|2394045_2394858_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2394826_2395147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243624.1|2395159_2395648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250717.1|2395650_2397954_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
WP_004243627.1|2398036_2398495_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2398554_2399007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368089.1|2399017_2400505_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	4.2e-77
WP_012368090.1|2400513_2401026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368091.1|2401062_2401512_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004243635.1|2401508_2401913_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.8	3.8e-25
WP_004248367.1|2401915_2402215_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_104836537.1|2402596_2403412_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	3.5e-54
>prophage 8
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2592505	2674189	4021165	tRNA,portal,head,protease,transposase,terminase,tail,integrase,lysis,capsid	Yersinia_phage(13.64%)	97	2614621:2614636	2662912:2662927
WP_004248453.1|2592505_2593036_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
WP_004243886.1|2593348_2593609_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	4.6e-16
WP_004243887.1|2593638_2594019_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004243888.1|2594018_2594750_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004243889.1|2594819_2595560_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004243892.1|2595572_2596481_-	GTPase Era	NA	NA	NA	NA	NA
WP_004248457.1|2596477_2597158_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
WP_004248458.1|2597353_2598325_-	signal peptidase I	NA	NA	NA	NA	NA
WP_046335198.1|2598339_2600136_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
WP_004243895.1|2600457_2600922_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_046335199.1|2600934_2601906_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_004243897.1|2601954_2602614_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_004243899.1|2602615_2603194_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_012368142.1|2603494_2604253_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004243902.1|2604521_2605877_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.1	2.3e-42
WP_004248459.1|2606027_2606411_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	2.0e-31
WP_036964652.1|2606422_2606647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368143.1|2606745_2607426_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.2	1.7e-57
WP_004243909.1|2607517_2608129_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004243910.1|2608230_2609130_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_104836560.1|2609215_2610877_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004243912.1|2610990_2611353_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004243913.1|2611485_2611779_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004243914.1|2611771_2612206_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004243915.1|2612362_2612845_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	4.3e-31
WP_104836561.1|2613631_2614006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836562.1|2614396_2614702_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2614621:2614636	attL	AAAAGAGATAATTAAA	NA	NA	NA	NA
WP_036905825.1|2616362_2616629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247890.1|2616625_2617312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049219065.1|2617311_2617644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836563.1|2617633_2620423_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.0	9.3e-187
WP_036905289.1|2620423_2620822_-	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.7	8.3e-33
WP_017827263.1|2620875_2621151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836564.1|2621164_2621746_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	1.9e-49
WP_104836565.1|2621742_2622342_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	54.9	1.5e-54
WP_104836566.1|2622342_2625648_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	3.2e-186
WP_017827267.1|2625904_2626255_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	40.5	6.2e-16
WP_017827268.1|2626254_2626731_-|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	75.5	6.9e-58
WP_026164627.1|2626753_2627146_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	57.9	1.2e-31
WP_036905269.1|2627154_2627544_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	2.2e-30
WP_080749322.1|2627530_2627857_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	44.5	2.6e-16
WP_026164628.1|2627863_2628166_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	70.0	6.8e-35
WP_104836868.1|2628218_2629481_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	82.0	5.1e-185
WP_036905264.1|2629496_2630102_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	5.3e-87
WP_036905261.1|2630091_2631321_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	87.8	4.8e-212
WP_071425264.1|2631468_2633202_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	98.2	0.0e+00
WP_104836568.1|2633205_2633679_-|terminase	phage terminase small subunit P27 family	terminase	A0A1P8DTK5	Proteus_phage	66.9	9.2e-55
WP_049218006.1|2633826_2634024_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	87.7	6.4e-26
WP_104836569.1|2634020_2634371_-	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	93.0	2.4e-60
WP_104836570.1|2634430_2634808_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	72.4	2.5e-39
WP_104836571.1|2635416_2635881_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	79.1	3.1e-47
WP_104836572.1|2636023_2636494_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	2.9e-48
WP_004250558.1|2636493_2636763_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_049219095.1|2637126_2637390_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_049219097.1|2637369_2637549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247148.1|2637629_2638151_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_017827437.1|2638447_2638831_-	antitermination protein Q	NA	A0A088CD47	Shigella_phage	72.2	5.5e-50
WP_104836573.1|2638830_2639805_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	55.4	3.4e-104
WP_104836574.1|2639801_2641367_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	69.9	2.5e-221
WP_080047916.1|2641627_2641876_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	1.8e-17
WP_104836575.1|2641868_2642126_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	60.8	2.1e-16
WP_104836576.1|2642251_2642950_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	44.2	6.6e-49
WP_104836577.1|2643256_2644126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836578.1|2644148_2644400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836579.1|2644389_2644806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836580.1|2644965_2645430_+	helix-turn-helix transcriptional regulator	NA	A0A059VK24	Pseudomonas_phage	35.0	2.3e-05
WP_104836581.1|2645431_2645638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836582.1|2645640_2645838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836583.1|2645824_2646022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836584.1|2646014_2646299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836585.1|2646261_2646552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836586.1|2646544_2646967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080047927.1|2647041_2647395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080047955.1|2647372_2647588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836587.1|2647584_2648061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836588.1|2648072_2648771_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	57.0	6.1e-63
WP_104836589.1|2648770_2649304_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	35.9	1.1e-22
WP_104836591.1|2649536_2649788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836592.1|2649774_2650173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836593.1|2650159_2650483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336070.1|2650469_2650682_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	61.8	3.1e-18
WP_104836594.1|2650636_2651818_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	69.4	1.1e-152
WP_104836595.1|2652134_2653376_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.8	2.4e-102
WP_104836596.1|2653590_2654901_-	hypothetical protein	NA	Q858S9	Enterobacteria_phage	33.6	5.7e-62
WP_104836597.1|2655076_2655367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158660327.1|2655430_2656426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836599.1|2657118_2658702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152994956.1|2659834_2660215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335210.1|2660594_2661290_+	fimbrial protein	NA	NA	NA	NA	NA
WP_104836600.1|2661416_2662544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836601.1|2663076_2663781_+	fimbrial protein	NA	NA	NA	NA	NA
2662912:2662927	attR	TTTAATTATCTCTTTT	NA	NA	NA	NA
WP_041701197.1|2667483_2667912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248486.1|2667901_2668159_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_046335316.1|2668851_2669538_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_104836602.1|2670129_2670525_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004250418.1|2670536_2672033_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_096043063.1|2673172_2674189_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
>prophage 9
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2701536	2749638	4021165	tRNA,holin,protease,head,portal,terminase,tail,integrase,lysis,capsid,plate	Salmonella_phage(28.95%)	59	2740602:2740617	2747210:2747225
WP_004243990.1|2701536_2702028_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004243991.1|2702280_2702496_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004248513.1|2702640_2702880_+	YecH family protein	NA	NA	NA	NA	NA
WP_012368173.1|2702992_2703238_-	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
WP_004248514.1|2703422_2703770_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_046334644.1|2703747_2704308_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004243999.1|2704382_2705069_-	membrane protein	NA	NA	NA	NA	NA
WP_004244000.1|2706157_2706994_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046334645.1|2707060_2707921_+	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_104836606.1|2707978_2710594_-	sugar transporter	NA	NA	NA	NA	NA
WP_004244003.1|2710599_2711052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244004.1|2711514_2712063_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
WP_004244005.1|2712568_2712778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244007.1|2713085_2713295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368178.1|2714568_2714787_-	positive regulator of phage late gene transcription	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
WP_104836607.1|2714839_2715937_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	56.2	7.3e-111
WP_104836608.1|2715936_2716401_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	56.2	8.8e-42
WP_104836609.1|2716400_2719235_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.6	5.8e-112
WP_075204427.1|2719227_2719401_-|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	50.9	1.6e-09
WP_104836610.1|2719361_2719709_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.8	3.5e-19
WP_104836611.1|2719728_2720244_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	58.5	1.6e-55
WP_104836612.1|2720247_2721420_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	71.4	1.0e-166
WP_104836613.1|2721519_2723151_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	72.4	1.8e-57
WP_104836614.1|2723140_2723752_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.4	3.2e-76
WP_104836615.1|2723744_2724653_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.6	1.3e-108
WP_104836616.1|2724654_2724993_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	49.5	1.4e-25
WP_104836617.1|2724989_2725616_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.8	9.0e-58
WP_104836618.1|2725681_2726317_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	1.5e-28
WP_104836619.1|2726306_2726744_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	48.6	1.2e-32
WP_087726277.1|2726718_2727222_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	1.4e-05
WP_087726278.1|2727218_2727623_-	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	57.4	4.6e-39
WP_012368194.1|2727615_2727930_-|holin	holin	holin	NA	NA	NA	NA
WP_104836620.1|2727949_2728156_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	51.5	8.1e-16
WP_104836621.1|2728155_2728611_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.3	2.4e-28
WP_012368197.1|2728688_2729357_-|terminase	terminase	terminase	F1BUQ7	Erwinia_phage	46.6	7.2e-45
WP_102086891.1|2729356_2730502_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.7	6.8e-128
WP_104836622.1|2730517_2731327_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	3.4e-65
WP_104836623.1|2731499_2733254_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.2	2.3e-260
WP_104836624.1|2733253_2734282_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	67.5	4.0e-135
WP_087726286.1|2734761_2735157_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_104836625.1|2735227_2735908_-	hypothetical protein	NA	V9IQL5	Stenotrophomonas_phage	27.2	1.9e-16
WP_104836626.1|2736114_2738493_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.3	1.1e-164
WP_104836627.1|2738492_2738816_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_104836628.1|2738815_2739643_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	3.0e-61
WP_087726417.1|2739642_2739951_-	DUF3850 domain-containing protein	NA	A0A218M496	Shigella_phage	41.1	6.5e-09
WP_012368208.1|2739952_2740174_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
WP_104836629.1|2740166_2740424_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_049220105.1|2740441_2740837_-	DUF5347 family protein	NA	NA	NA	NA	NA
2740602:2740617	attL	ATACGATTATTTTCAT	NA	NA	NA	NA
WP_036908537.1|2740886_2741162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964418.1|2741171_2741324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836870.1|2741320_2741506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368213.1|2741523_2741799_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	47.0	3.7e-16
WP_012368214.1|2741901_2742201_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	4.8e-33
WP_087726416.1|2742267_2743251_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	56.2	8.2e-98
WP_004244024.1|2743419_2744934_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
WP_096043105.1|2744942_2746041_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_046334647.1|2746212_2747946_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	4.7e-64
2747210:2747225	attR	ATACGATTATTTTCAT	NA	NA	NA	NA
WP_046334648.1|2747955_2748663_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004244032.1|2748696_2749638_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
>prophage 10
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2943528	2995159	4021165	portal,holin,coat,terminase,tail,integrase,lysis	Proteus_phage(25.49%)	74	2953615:2953661	2994018:2994064
WP_104836662.1|2943528_2946249_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.1	0.0e+00
WP_036900269.1|2946245_2946590_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.9	2.8e-45
WP_104836663.1|2946604_2947201_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	2.9e-29
WP_049257504.1|2947200_2947386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836664.1|2947555_2948167_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	4.3e-20
WP_036907509.1|2948163_2948373_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_049257505.1|2948369_2948564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071843629.1|2948566_2948740_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_104836872.1|2948732_2949743_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	52.2	3.3e-78
WP_104836665.1|2949763_2950372_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	68.8	1.8e-71
WP_104836666.1|2950384_2950780_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.0	1.4e-27
WP_049257508.1|2950779_2950998_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	8.6e-08
WP_152691671.1|2951114_2952032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836667.1|2952239_2953451_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
2953615:2953661	attL	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_104836668.1|2953847_2954054_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	97.1	3.8e-29
WP_158660328.1|2954226_2955129_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_104836670.1|2957194_2959138_-	DNA transfer protein	NA	C6ZR18	Salmonella_phage	56.5	5.5e-146
WP_104836873.1|2959122_2960691_-	acyltransferase	NA	B6SCW4	Bacteriophage	44.0	1.1e-88
WP_104836671.1|2960700_2961360_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	68.1	8.6e-59
WP_036976869.1|2961353_2961815_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.3	9.3e-60
WP_104836672.1|2961814_2962513_-|tail	phage tail protein	tail	C6ZR14	Salmonella_phage	66.5	7.0e-35
WP_104836874.1|2962512_2963751_-	hypothetical protein	NA	Q9T1S0	Acyrthosiphon_pisum_secondary_endosymbiont_phage	69.3	2.4e-147
WP_104836673.1|2964265_2964763_-	recombinase RmuC	NA	A0A2D1GLR5	Escherichia_phage	61.9	3.3e-47
WP_104836674.1|2964740_2964950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063108518.1|2965001_2966285_-|coat	coat protein	coat	G5DA99	Enterobacteria_phage	67.6	4.4e-168
WP_104836675.1|2966284_2967199_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	61.5	3.7e-92
WP_104836676.1|2967213_2969304_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	66.7	4.7e-236
WP_104836677.1|2969306_2970803_-|terminase	terminase	terminase	A0A0M4S5Z3	Salmonella_phage	81.8	8.9e-253
WP_104836678.1|2970777_2971269_-	DNA-packaging protein	NA	I6S1J2	Salmonella_phage	79.8	1.5e-71
WP_104836679.1|2971457_2971907_-	collagen-like protein	NA	NA	NA	NA	NA
WP_036977151.1|2971916_2972141_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	53.4	3.9e-11
WP_036976897.1|2972488_2972854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836680.1|2972853_2973306_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	80.4	2.6e-54
WP_104836681.1|2973302_2973707_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.6	2.2e-25
WP_104836682.1|2973699_2973987_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|2973983_2974373_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_104836683.1|2974857_2975613_-	antitermination protein	NA	G0ZNC6	Cronobacter_phage	46.2	2.7e-48
WP_063693385.1|2975609_2975801_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	96.8	1.0e-28
WP_104836684.1|2975800_2976421_-	hypothetical protein	NA	A0A2I7RAC0	Vibrio_phage	53.6	6.7e-45
WP_158660329.1|2976424_2976583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836685.1|2976694_2977138_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	55.3	8.1e-37
WP_071233478.1|2977139_2977349_-	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	96.8	1.6e-30
WP_158660330.1|2977341_2977518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233638.1|2977517_2977742_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_104836687.1|2977953_2978175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964332.1|2978190_2978358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063108498.1|2978377_2979289_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	61.2	9.0e-99
WP_104836688.1|2979299_2979986_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	88.6	1.2e-108
WP_104836689.1|2979982_2980921_-	replication protein 15	NA	A0A1P8DTG2	Proteus_phage	52.9	6.0e-82
WP_104836690.1|2980917_2981601_-	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	93.0	8.2e-113
WP_104836691.1|2981622_2981967_-	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	38.6	4.7e-08
WP_036895075.1|2982102_2982288_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_036976930.1|2982383_2983094_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	62.1	2.5e-80
WP_064497308.1|2983334_2984252_+	serine dehydrogenasease	NA	NA	NA	NA	NA
WP_104836692.1|2984803_2985073_+	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	70.3	6.9e-23
WP_158660331.1|2985088_2985577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836694.1|2986031_2986265_+	hypothetical protein	NA	A0A1P8DTG4	Proteus_phage	79.7	6.4e-25
WP_104836695.1|2986266_2986566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247709.1|2986634_2986895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836696.1|2987112_2987367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247464.1|2987363_2987615_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	4.1e-38
WP_104836697.1|2987611_2988496_+	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	61.9	1.1e-93
WP_104836698.1|2988492_2989191_+	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	57.3	2.6e-74
WP_104836699.1|2989180_2989714_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	58.8	2.7e-55
WP_104836700.1|2989729_2990038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081232608.1|2990293_2990482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836701.1|2990474_2990768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158660332.1|2990767_2990926_+	hypothetical protein	NA	A0A1P8DTH4	Proteus_phage	79.5	1.1e-09
WP_158660333.1|2991080_2991242_+	hypothetical protein	NA	A0A1P8DTF6	Proteus_phage	98.1	9.8e-25
WP_104836702.1|2991234_2991552_+	DUF2591 family protein	NA	A0A2I7S0T5	Vibrio_phage	37.8	3.2e-11
WP_104836704.1|2991740_2992343_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	58.1	6.4e-61
WP_094959881.1|2992631_2992964_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104836706.1|2992840_2994004_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	75.7	9.5e-178
WP_060554830.1|2994286_2995159_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
2994018:2994064	attR	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 11
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	3258581	3267437	4021165		Caulobacter_phage(50.0%)	9	NA	NA
WP_104836739.1|3258581_3260150_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	1.6e-10
WP_012368337.1|3260550_3261231_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3261327_3261903_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_104836740.1|3261979_3262558_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	43.1	3.2e-33
WP_049196995.1|3262625_3263651_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.0e-74
WP_004245607.1|3263685_3264141_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_104836741.1|3264165_3265314_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004250201.1|3265314_3265899_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017827550.1|3266291_3267437_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
>prophage 12
NZ_CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	3912305	3971353	4021165	tRNA,protease,transposase,integrase	uncultured_Caudovirales_phage(22.22%)	44	3950006:3950022	3969596:3969612
WP_017628739.1|3912305_3912890_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_104836837.1|3912984_3913896_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_104836838.1|3915338_3915734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836839.1|3915881_3917996_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_104836840.1|3917998_3920347_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_004246549.1|3924059_3924530_+	cellulose biosynthesis protein	NA	NA	NA	NA	NA
WP_046334397.1|3924568_3925474_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_020946490.1|3925647_3926610_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.1	8.7e-60
WP_046334396.1|3926683_3927721_+	endoglucanase	NA	NA	NA	NA	NA
WP_012368625.1|3927859_3929509_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_004249964.1|3929617_3931480_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	1.1e-13
WP_004249787.1|3931476_3932868_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_004246539.1|3932883_3933804_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_004246538.1|3934002_3934659_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004246537.1|3934655_3935594_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_080633831.1|3935605_3938653_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_004246534.1|3938832_3939663_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_104836841.1|3939659_3940430_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017826978.1|3940440_3941316_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_004246526.1|3941607_3942150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246525.1|3942364_3943336_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_012368630.1|3943460_3944348_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012368631.1|3944762_3945563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368632.1|3945737_3947090_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
3950006:3950022	attL	GCTATTTTGGCATAAAT	NA	NA	NA	NA
WP_104836842.1|3950238_3951042_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_060554979.1|3951095_3952961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246518.1|3953088_3954018_-	phosphoesterase	NA	NA	NA	NA	NA
WP_012368636.1|3954202_3954667_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_104836843.1|3955527_3957015_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	78.5	3.3e-215
WP_104836844.1|3957025_3957877_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	36.4	1.6e-52
WP_104836845.1|3958137_3958731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|3958936_3959701_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|3960207_3960708_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3960835_3961675_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3961668_3962016_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000939727.1|3962163_3962985_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_071593219.1|3963116_3963908_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845054.1|3964053_3965067_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000454193.1|3965269_3965620_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|3965745_3966306_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|3966308_3969260_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|3969268_3969670_+	hypothetical protein	NA	NA	NA	NA	NA
3969596:3969612	attR	ATTTATGCCAAAATAGC	NA	NA	NA	NA
WP_001067784.1|3969754_3970459_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_074180790.1|3970516_3971353_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
