The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025412	Lactiplantibacillus plantarum strain X7021 chromosome, complete genome	3190599	559505	568129	3190599		Streptococcus_phage(66.67%)	11	NA	NA
WP_003644909.1|559505_561203_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|561224_561533_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|561548_562148_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|562162_562414_+	YaaL family protein	NA	NA	NA	NA	NA
WP_003644908.1|562811_563477_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|563473_563803_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_104795556.1|563819_564839_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.8e-32
WP_003640967.1|564863_565211_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003643942.1|565309_566206_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640969.1|566209_566995_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003643943.1|567133_568129_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	5.9e-51
>prophage 2
NZ_CP025412	Lactiplantibacillus plantarum strain X7021 chromosome, complete genome	3190599	765949	812053	3190599	integrase,protease,transposase	Lactobacillus_phage(16.67%)	37	799879:799898	803032:803051
WP_053267349.1|765949_766321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_114894105.1|766313_766490_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158660341.1|767011_769672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267347.1|769927_770521_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_053267346.1|770517_771384_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_087509231.1|771491_771653_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_054519314.1|771659_771929_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021730181.1|772496_772865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021357386.1|773097_773466_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	43.6	2.9e-16
WP_053267343.1|774013_774697_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_053267342.1|775193_777698_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021355861.1|777829_778144_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	36.0	3.3e-08
WP_054519334.1|778306_781018_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_033098993.1|781052_781643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104796054.1|781852_782710_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_013355305.1|782776_783133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097558256.1|783727_784111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104795574.1|784100_785948_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	24.5	2.1e-22
WP_003641172.1|786188_786443_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003641173.1|786454_787000_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641174.1|787012_787195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644046.1|787209_787632_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641176.1|787692_788133_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_053267339.1|788336_789137_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_053267338.1|789268_790279_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_015825253.1|790640_790973_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_158099649.1|791078_792668_+	alpha-rhamnosidase	NA	NA	NA	NA	NA
WP_104795575.1|792870_793464_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_021357610.1|793466_794048_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_097558087.1|794082_797733_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_104795576.1|797757_801309_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
799879:799898	attL	TGGTTTCCGTATAATAAAGG	NA	NA	NA	NA
WP_104795577.1|801366_802455_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	38.7	4.0e-61
WP_104795578.1|802454_804641_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
803032:803051	attR	CCTTTATTATACGGAAACCA	NA	NA	NA	NA
WP_053267332.1|804750_807267_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_104795579.1|807389_809924_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.5	7.1e-69
WP_077727009.1|811298_811508_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_072540428.1|811504_812053_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.3	9.1e-30
>prophage 3
NZ_CP025412	Lactiplantibacillus plantarum strain X7021 chromosome, complete genome	3190599	1199437	1206799	3190599		Lactobacillus_phage(83.33%)	7	NA	NA
WP_003643099.1|1199437_1200385_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1200728_1201343_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_104795656.1|1201345_1203784_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_003643095.1|1203871_1204432_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_053267624.1|1204502_1204943_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	4.0e-76
WP_015380221.1|1205038_1205176_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_053267625.1|1205803_1206799_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	5.3e-52
>prophage 4
NZ_CP025412	Lactiplantibacillus plantarum strain X7021 chromosome, complete genome	3190599	1715471	1800218	3190599	integrase,protease,tail,terminase,head,tRNA,holin,portal,capsid	Lactobacillus_phage(81.13%)	92	1740847:1740864	1807149:1807166
WP_080371161.1|1715471_1716395_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_063851686.1|1716866_1717388_-	shikimate kinase	NA	NA	NA	NA	NA
WP_104795749.1|1717390_1718488_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_104795750.1|1719802_1720330_-	amino acid biosynthesis protein	NA	NA	NA	NA	NA
WP_104795751.1|1720338_1721508_-	chorismate synthase	NA	NA	NA	NA	NA
WP_104795752.1|1721500_1722772_-	MFS transporter	NA	NA	NA	NA	NA
WP_003640723.1|1723413_1723767_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_053267831.1|1723789_1726363_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640725.1|1726377_1726683_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003640726.1|1726672_1726972_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003644496.1|1727016_1728234_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640728.1|1728254_1728731_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640729.1|1729026_1733340_-	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_053267830.1|1733833_1735543_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_104795753.1|1735582_1736860_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|1736897_1737683_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640735.1|1737698_1738478_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640736.1|1738597_1739161_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640737.1|1739162_1739885_-	UMP kinase	NA	NA	NA	NA	NA
WP_003644498.1|1740084_1740963_-	elongation factor Ts	NA	NA	NA	NA	NA
1740847:1740864	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
WP_003640739.1|1741065_1741869_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003640740.1|1742093_1742816_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640741.1|1743103_1744102_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_053267827.1|1744186_1744492_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_015825656.1|1744475_1745234_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_025015626.1|1745345_1745981_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_104795754.1|1746038_1746278_-	YneF family protein	NA	NA	NA	NA	NA
WP_003644501.1|1746375_1746615_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|1746766_1747399_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_089178220.1|1747488_1747719_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003645631.1|1748022_1748652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355614.1|1748702_1749872_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_053267825.1|1749907_1750300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015640487.1|1750463_1750856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645635.1|1751302_1752244_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	48.7	3.1e-78
WP_104795755.1|1752943_1753516_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104795756.1|1753667_1754852_-	LCP family protein	NA	NA	NA	NA	NA
WP_104795757.1|1754832_1755624_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.3	1.1e-28
WP_003644507.1|1755642_1757385_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003644508.1|1757863_1759075_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_104795758.1|1760121_1760658_-|holin	holin	holin	E9LUS0	Lactobacillus_phage	95.7	2.8e-39
WP_057137293.1|1760669_1760933_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	98.9	2.5e-38
WP_104795759.1|1760932_1762105_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	86.7	1.2e-193
WP_104795760.1|1762116_1762329_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	73.9	4.4e-17
WP_104795761.1|1762325_1763438_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	93.7	8.0e-57
WP_187239774.1|1763421_1763583_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	2.8e-19
WP_104795762.1|1763586_1763826_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	98.7	8.5e-33
WP_104795763.1|1763818_1765702_-|tail	phage tail protein	tail	A0A2K9V5E9	Lactobacillus_phage	84.1	3.8e-35
WP_104795764.1|1765718_1768106_-|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	69.2	0.0e+00
WP_104795765.1|1768172_1769879_-|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	61.6	1.1e-214
WP_104795766.1|1769937_1774806_-	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	59.8	0.0e+00
WP_104795767.1|1774837_1775023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795768.1|1775067_1775442_-|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	93.5	1.7e-56
WP_104795769.1|1775515_1776169_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	92.2	6.2e-110
WP_104795770.1|1776184_1776565_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	91.3	2.9e-59
WP_104795771.1|1776564_1776972_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	91.7	6.5e-65
WP_085439187.1|1776974_1777322_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	73.9	7.0e-44
WP_104795772.1|1777311_1777644_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	81.5	3.7e-42
WP_104795773.1|1777718_1778948_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	94.1	1.9e-213
WP_104795774.1|1778947_1779703_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.6	3.9e-124
WP_104795775.1|1779680_1780874_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	3.1e-224
WP_104795776.1|1780876_1781071_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	95.3	8.2e-26
WP_104795777.1|1783014_1783470_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.4	8.0e-80
WP_097558071.1|1783667_1784135_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	93.5	8.7e-82
WP_054519272.1|1784145_1784322_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	72.4	1.7e-14
WP_054519273.1|1784299_1784497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380489.1|1785158_1785587_-	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	86.5	1.1e-65
WP_104795778.1|1785874_1786180_-	hypothetical protein	NA	K4I242	Lactobacillus_phage	60.0	3.8e-25
WP_104795779.1|1786182_1786554_-	hypothetical protein	NA	Q9T1G9	Lactobacillus_phage	47.5	2.5e-15
WP_104795780.1|1786550_1786904_-	DUF1642 domain-containing protein	NA	Q8LTB5	Lactobacillus_phage	58.1	4.8e-32
WP_104795781.1|1786966_1787167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187345431.1|1787238_1787634_-	hypothetical protein	NA	O03921	Lactobacillus_phage	64.8	2.1e-36
WP_187345432.1|1787617_1787794_-	hypothetical protein	NA	E9LUP2	Lactobacillus_phage	82.8	2.7e-20
WP_104795783.1|1787871_1788180_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	90.2	6.6e-46
WP_085439171.1|1788315_1789101_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.8	3.1e-132
WP_104795784.1|1789100_1789817_-	helix-turn-helix domain-containing protein	NA	A0A0P0I7Q1	Lactobacillus_phage	39.3	1.2e-34
WP_104795785.1|1789858_1790551_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	97.8	3.4e-130
WP_104795786.1|1790597_1791257_-	DUF669 domain-containing protein	NA	E9LUU2	Lactobacillus_phage	95.4	5.9e-92
WP_104795787.1|1791258_1791921_-	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	99.1	2.1e-121
WP_104795788.1|1791921_1792782_-	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	34.4	1.1e-37
WP_187345433.1|1792781_1792952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795789.1|1793000_1793225_-	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	86.3	2.0e-28
WP_065674473.1|1793236_1793476_-	tagatose-bisphosphate aldolase	NA	E9LUT6	Lactobacillus_phage	83.5	5.9e-34
WP_016058357.1|1793509_1793689_-	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	100.0	2.2e-25
WP_104795790.1|1793830_1794091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380501.1|1794148_1794475_+	hypothetical protein	NA	E9LUT2	Lactobacillus_phage	98.1	2.7e-53
WP_003641364.1|1794590_1794800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821294.1|1795561_1795777_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JBV7	uncultured_Caudovirales_phage	71.0	5.9e-17
WP_104795791.1|1795969_1796641_+	LexA family transcriptional regulator	NA	D7RWL5	Brochothrix_phage	45.5	1.1e-45
WP_104795792.1|1796765_1797644_+	HIRAN domain-containing protein	NA	A0A2H4J549	uncultured_Caudovirales_phage	35.3	3.5e-07
WP_003641358.1|1797658_1797859_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_016510998.1|1799054_1800218_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.5	9.2e-56
1807149:1807166	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 5
NZ_CP025412	Lactiplantibacillus plantarum strain X7021 chromosome, complete genome	3190599	2086001	2140908	3190599	integrase,tail,terminase,head,holin,portal,capsid	Lactobacillus_phage(75.0%)	68	2126878:2126899	2141086:2141107
WP_027821350.1|2086001_2087144_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.5	3.5e-39
WP_063722063.1|2087151_2087823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079111819.1|2087932_2088232_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_104795830.1|2088824_2089208_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	83.7	9.9e-15
WP_104795831.1|2089194_2089491_-	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	7.6e-39
WP_104795832.1|2090629_2090806_-	XkdX family protein	NA	NA	NA	NA	NA
WP_104795833.1|2090802_2091123_-	DUF2977 domain-containing protein	NA	Q7M292	Lactobacillus_phage	80.8	2.4e-30
WP_104795834.1|2091122_2091908_-	hypothetical protein	NA	O03971	Lactobacillus_phage	85.4	9.7e-126
WP_104796058.1|2091923_2093450_-	metallophosphoesterase	NA	O03968	Lactobacillus_phage	71.5	2.5e-194
WP_187345434.1|2093735_2094047_-	hypothetical protein	NA	O03939	Lactobacillus_phage	88.9	8.6e-09
WP_104795835.1|2094024_2094318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795836.1|2094310_2095429_-|tail	phage tail protein	tail	O03938	Lactobacillus_phage	91.7	1.1e-194
WP_104795837.1|2095441_2096251_-|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	41.9	1.9e-52
WP_104795838.1|2096250_2101074_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	83.3	0.0e+00
WP_053566809.1|2101077_2101701_-	hypothetical protein	NA	O03936	Lactobacillus_phage	100.0	7.3e-108
WP_104795839.1|2101706_2102138_-	hypothetical protein	NA	O03935	Lactobacillus_phage	97.2	1.6e-74
WP_104795840.1|2102189_2102705_-|capsid	capsid protein	capsid	O03972	Lactobacillus_phage	97.5	7.1e-85
WP_053566811.1|2102738_2103143_-	hypothetical protein	NA	O03934	Lactobacillus_phage	97.0	4.8e-68
WP_053566812.1|2103142_2103490_-|capsid	minor capsid protein	capsid	O03933	Lactobacillus_phage	79.7	9.8e-46
WP_187345435.1|2103489_2103840_-|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	91.4	3.1e-55
WP_104795841.1|2103839_2104268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795842.1|2104421_2105312_-|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	58.5	4.0e-91
WP_104795843.1|2106008_2107151_-|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	95.3	7.7e-172
WP_104795844.1|2107147_2108674_-|portal	phage portal protein	portal	O03928	Lactobacillus_phage	95.9	4.2e-282
WP_104795845.1|2108682_2110026_-|terminase	PBSX family phage terminase large subunit	terminase	O03927	Lactobacillus_phage	96.9	9.4e-262
WP_104795846.1|2110006_2110594_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	43.6	1.3e-26
WP_053339019.1|2110651_2110972_-	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	48.1	9.4e-19
WP_021732633.1|2111227_2111497_-	DUF2829 domain-containing protein	NA	A0A0K2FLC4	Brevibacillus_phage	45.5	2.5e-12
WP_003642805.1|2112095_2112557_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_047673728.1|2112848_2113325_-	DUF1642 domain-containing protein	NA	A0A2P0ZLB8	Lactobacillus_phage	60.8	8.4e-48
WP_104795847.1|2113317_2113683_-	hypothetical protein	NA	A0A1I9KKG9	Lactobacillus_phage	56.9	5.0e-32
WP_158660343.1|2113675_2113822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795848.1|2113889_2114960_-	DNA cytosine methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	59.2	6.2e-123
WP_056953070.1|2115055_2115367_-	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	90.3	7.2e-48
WP_104795849.1|2115369_2115744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795850.1|2115740_2116259_-	hypothetical protein	NA	O03915	Lactobacillus_phage	55.3	2.9e-41
WP_103851856.1|2116255_2116543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795851.1|2116539_2117448_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_187345455.1|2117528_2118281_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.2	3.8e-71
WP_104795853.1|2118312_2119212_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	1.3e-62
WP_104795854.1|2119208_2119595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380633.1|2119965_2120478_-	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	44.7	2.5e-29
WP_104795855.1|2120544_2120850_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_003642792.1|2120861_2121032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101083.1|2121044_2121275_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016511202.1|2121447_2121810_+	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
WP_003642784.1|2121821_2122235_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_104795856.1|2122261_2123260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104795857.1|2123664_2124792_+	Abi family protein	NA	A0A1Q1PVS3	Staphylococcus_phage	28.2	1.4e-24
WP_104795858.1|2124892_2126014_+|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	2.9e-46
WP_003642774.1|2126364_2126571_-	hypothetical protein	NA	NA	NA	NA	NA
2126878:2126899	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_187345436.1|2127375_2127747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795861.1|2127902_2128172_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_104795862.1|2128581_2130162_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.8	7.9e-42
WP_104795863.1|2130151_2131261_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.3	1.0e-48
WP_033611503.1|2131261_2131462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795864.1|2131415_2133119_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.3	1.2e-120
WP_104795865.1|2133115_2133589_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_061468355.1|2134493_2134883_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	3.0e-19
WP_104795866.1|2134875_2135214_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	36.6	1.9e-09
WP_089197947.1|2135200_2135392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795867.1|2135407_2135887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104795868.1|2136032_2137427_-	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	40.4	9.7e-68
WP_104795869.1|2137426_2138227_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_104795870.1|2138240_2138468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527234.1|2138737_2138917_-	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	89.7	3.0e-22
WP_104795871.1|2139073_2139694_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104795872.1|2139750_2140908_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	35.1	3.0e-54
2141086:2141107	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
>prophage 6
NZ_CP025412	Lactiplantibacillus plantarum strain X7021 chromosome, complete genome	3190599	2332349	2340860	3190599		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2332349_2332928_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_003645866.1|2332920_2333946_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	2.7e-59
WP_016527273.1|2333942_2335397_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	3.3e-50
WP_104795899.1|2335381_2337601_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	1.3e-143
WP_011101895.1|2337593_2338274_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2338273_2338528_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2338529_2339261_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_015380738.1|2339263_2340394_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2340377_2340860_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 1
NZ_CP025413	Lactiplantibacillus plantarum strain X7021 plasmid unnamed1, complete sequence	30838	21389	29100	30838	transposase	Enterococcus_phage(33.33%)	6	NA	NA
WP_054646979.1|21389_23129_-	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	26.8	5.6e-33
WP_104796065.1|23305_24226_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.8	1.0e-49
WP_049816396.1|24619_25222_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	54.2	3.0e-50
WP_076633387.1|25310_27734_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	50.3	4.4e-201
WP_080469038.1|27892_28525_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.0	2.1e-54
WP_003660057.1|28650_29100_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	43.8	3.1e-28
>prophage 1
NZ_CP025417	Lactiplantibacillus plantarum strain X7021 plasmid unnamed5, complete sequence	67589	10256	45290	67589	protease,holin,transposase	Enterobacteria_phage(27.27%)	32	NA	NA
WP_104796133.1|10256_11150_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.3	8.1e-60
WP_034529615.1|11125_11386_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	46.5	2.8e-13
WP_104796134.1|11547_12801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052470505.1|12821_13781_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_041153667.1|13811_14795_-	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_080315025.1|14831_15491_-	acyltransferase	NA	NA	NA	NA	NA
WP_041153668.1|15497_16658_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041153669.1|16657_17836_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_041153670.1|17896_18565_-	sugar transferase	NA	NA	NA	NA	NA
WP_104796135.1|18619_19393_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_104796136.1|19379_20099_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_052470506.1|20110_20881_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_016526595.1|21454_22120_-	sugar transferase	NA	NA	NA	NA	NA
WP_104796137.1|22135_22972_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.8	4.2e-34
WP_016526593.1|23004_24033_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.1	5.3e-71
WP_003644155.1|24042_24624_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	4.3e-38
WP_041153676.1|24627_25497_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.4	8.6e-99
WP_102115684.1|25720_26896_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.8e-27
WP_104796139.1|28085_29402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075269600.1|29573_29825_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	7.8e-37
WP_104796140.1|29878_30721_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	4.3e-156
WP_104796141.1|31010_31307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104796142.1|31383_34323_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_104796143.1|35139_37245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062690082.1|37338_37653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104796144.1|37718_39503_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.7	7.5e-81
WP_104796145.1|39505_40111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063485948.1|40113_40308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104796146.1|40304_41270_-	DUF3991 and TOPRIM domain-containing protein	NA	NA	NA	NA	NA
WP_104796147.1|41383_43546_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	46.9	3.1e-105
WP_006293514.1|44269_44374_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_063489657.1|44654_45290_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
