The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	91547	112525	5531975	transposase	Bacillus_phage(50.0%)	22	NA	NA
WP_009310015.1|91547_93080_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_023313186.1|93240_93507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103214964.1|93517_94312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001527022.1|94379_94802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000527682.1|94901_95348_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000527682.1|95653_96100_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023313185.1|96271_97324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073835.1|97335_97653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313184.1|97655_97907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103214965.1|98602_99847_+	type II secretion system protein GspD	NA	NA	NA	NA	NA
WP_023279773.1|99848_100817_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_001298440.1|100956_101154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103214966.1|101410_102043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103214967.1|102071_103475_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|103586_105119_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_064157089.1|105295_105928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883460.1|105956_107360_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_004221585.1|107618_107783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313181.1|108161_109172_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_023313180.1|109250_110231_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023313179.1|110439_110811_-	DUF2255 family protein	NA	NA	NA	NA	NA
WP_023290558.1|110986_112525_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	3.9e-280
>prophage 2
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	219178	228592	5531975		Escherichia_phage(87.5%)	9	NA	NA
WP_160333886.1|219178_220813_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004176258.1|220867_222133_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|222163_223252_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001620096.1|223338_223599_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620095.1|223896_224757_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|224777_225539_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002210514.1|225799_226702_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210515.1|226713_227979_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
WP_002210516.1|227971_228592_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	447945	556192	5531975	portal,tail,head,transposase,terminase,integrase,capsid,protease,plate,holin	Klebsiella_phage(65.0%)	116	531441:531456	562037:562052
WP_023313005.1|447945_449031_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_040236347.1|448994_450749_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032409400.1|450825_451296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313003.1|451292_452348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313002.1|452378_453977_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_023313001.1|453976_457432_-	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_023313000.1|457428_458637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021469292.1|458976_459198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087638354.1|460085_461184_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
WP_023312999.1|461376_461898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071835948.1|464887_465250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071556732.1|465644_465920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040236344.1|466053_467265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074376123.1|467257_469768_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	1.1e-16
WP_002902160.1|472687_473179_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_023312992.1|473183_474890_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004179546.1|474886_475576_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_015958243.1|475572_476916_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190552.1|476925_478470_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004176434.1|478512_479004_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_032102834.1|479162_479285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019705237.1|479849_480098_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_040174799.1|480505_480928_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_074185737.1|481005_481188_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
WP_040186352.1|481199_482000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040182608.1|484049_487118_-	kinase	NA	A0A286S259	Klebsiella_phage	97.1	0.0e+00
WP_103214973.1|487114_487495_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	98.4	6.7e-72
WP_040182606.1|487504_487987_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
WP_004899614.1|487973_488453_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_040182604.1|488452_490900_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	5.9e-278
WP_004143895.1|491476_491740_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_001177591.1|491772_492126_-|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|492169_492661_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_004143899.1|493948_494146_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_004216821.1|495932_496613_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_017880221.1|496618_497896_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_004143904.1|497898_499431_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143905.1|499440_499875_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_040182582.1|499996_500206_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
WP_040182580.1|500218_500509_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
WP_071854263.1|500579_500786_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
WP_032408647.1|500866_501103_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
WP_023304730.1|501427_501700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591489.1|501832_502117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182576.1|502352_502628_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
WP_023304728.1|502635_503265_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_019705280.1|503264_503546_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|503532_503928_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_104457636.1|504490_504937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182574.1|505252_506035_-	molecular chaperone	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
WP_048322137.1|506996_508655_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
WP_040182571.1|508696_509065_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
WP_071854265.1|509735_509969_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
WP_023304723.1|510109_510784_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
WP_040182568.1|510947_511361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182566.1|511543_511768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218017.1|511972_512134_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_029602968.1|512126_512381_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
WP_004146412.1|512448_512571_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_032439899.1|512567_512993_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.8e-53
WP_009309071.1|512989_513184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439898.1|513180_514008_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	3.2e-111
WP_009309074.1|514752_514944_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
WP_040182271.1|514924_516106_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.5	7.4e-202
WP_019705237.1|516489_516738_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_040174799.1|517145_517568_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_074185737.1|517645_517828_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
WP_040186352.1|517839_518640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040182608.1|520689_523758_-	kinase	NA	A0A286S259	Klebsiella_phage	97.1	0.0e+00
WP_103214973.1|523754_524135_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	98.4	6.7e-72
WP_040182606.1|524144_524627_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
WP_004143894.1|527579_528047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004143895.1|528112_528376_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_001177591.1|528408_528762_-|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|528805_529297_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_000561415.1|529352_529718_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_004216814.1|529714_530254_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_004184710.1|530246_530579_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_004143899.1|530580_530778_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_017880223.1|530838_531165_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_044067369.1|531112_531355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040182598.1|531391_532555_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.5	2.9e-211
531441:531456	attL	CGATAGTGGGCCAGCG	NA	NA	NA	NA
WP_004216821.1|532566_533247_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_017880221.1|533252_534530_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_004143904.1|534532_536065_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143905.1|536074_536509_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_040182582.1|536630_536840_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
WP_040182580.1|536852_537143_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
WP_071854263.1|537213_537420_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
WP_032408647.1|537500_537737_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
WP_023304730.1|538061_538334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591489.1|538466_538751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182576.1|538986_539262_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
WP_023304728.1|539269_539899_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_019705280.1|539898_540180_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|540166_540562_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_031280381.1|541124_541571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182574.1|541885_542668_-	molecular chaperone	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
WP_071854264.1|542664_543627_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	98.8	3.1e-182
WP_048322137.1|543628_545287_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
WP_040182571.1|545328_545697_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
WP_071854265.1|546367_546601_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
WP_023304723.1|546741_547416_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
WP_040182568.1|547579_547993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182566.1|548175_548400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218017.1|548604_548766_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_029602968.1|548758_549013_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
WP_004146412.1|549080_549203_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_032439899.1|549199_549625_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.8e-53
WP_009309071.1|549621_549816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439898.1|549812_550640_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	3.2e-111
WP_009309074.1|551384_551576_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
WP_040182271.1|551556_552738_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.5	7.4e-202
WP_004152146.1|552970_553483_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_023312991.1|553681_555214_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	29.5	1.5e-21
WP_004176437.1|555430_556192_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
562037:562052	attR	CGCTGGCCCACTATCG	NA	NA	NA	NA
>prophage 4
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	677287	763699	5531975	portal,tail,transposase,terminase,capsid,integrase,protease,head,tRNA,holin	Salmonella_phage(16.67%)	98	677256:677315	762679:764123
677256:677315	attL	TGGACTGACCCCATAAAGTTGGATGGTTCATATTAAGCGGCTCTCAGAGCCTGGGTTCGG	NA	NA	NA	NA
WP_085955203.1|677287_678651_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_004176531.1|678786_679338_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_004140411.1|679503_681357_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_004176535.1|681495_682515_+	asparaginase	NA	NA	NA	NA	NA
WP_023312962.1|682524_683166_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	4.2e-18
WP_002901255.1|683336_684590_+	glycoside hydrolase family 18 protein	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
WP_002901254.1|684750_685095_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002901249.1|685189_685468_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002901246.1|685511_685925_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002901243.1|686263_687259_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002901240.1|687333_688218_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_074376150.1|688274_689090_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.5	2.9e-16
WP_002901236.1|689220_689967_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002901234.1|690383_692318_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_004152363.1|692403_693687_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
WP_002901231.1|693732_694296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016529621.1|694454_694937_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
WP_016946410.1|695058_695370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004220356.1|695437_695557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179386.1|695627_696509_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023312960.1|696684_697902_+	MFS transporter	NA	NA	NA	NA	NA
WP_023312959.1|697898_698648_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
WP_023312958.1|698814_699720_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152360.1|699726_700992_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
WP_002901192.1|700994_701414_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
WP_004178082.1|701492_702980_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_052450217.1|703585_703768_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	85.2	1.5e-18
WP_040235822.1|703778_704579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235820.1|706627_709705_-	kinase	NA	A0A286S259	Klebsiella_phage	61.9	0.0e+00
WP_040235819.1|709701_710082_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_040235817.1|710094_710571_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.2	2.4e-50
WP_004884312.1|710557_711031_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_040235816.1|711052_714460_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.1	5.6e-194
WP_040235814.1|714527_714911_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	3.1e-32
WP_040235812.1|715107_715638_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	2.1e-63
WP_025713378.1|715830_716136_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	3.6e-28
WP_025713379.1|716138_716543_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	8.5e-33
WP_025713380.1|716573_717278_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	1.6e-79
WP_040235809.1|717334_717682_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	1.8e-31
WP_040235808.1|717678_718128_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.9	1.3e-63
WP_040235805.1|718124_718463_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	8.1e-37
WP_032734570.1|718475_718808_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_040235802.1|718813_719068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032423088.1|719113_720334_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	8.3e-140
WP_025713387.1|720343_721051_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
WP_032423087.1|721026_722346_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	1.7e-138
WP_025713389.1|722352_724089_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
WP_038808146.1|724042_724507_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	4.8e-48
WP_040235798.1|724690_725044_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	72.7	9.0e-47
WP_025713392.1|725242_725704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040235796.1|725778_726024_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	61.7	3.0e-17
WP_025713394.1|726152_726485_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	62.7	4.4e-35
WP_025713395.1|727053_727338_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	75.5	1.1e-31
WP_023304957.1|727423_727606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967894.1|727627_727804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235795.1|727811_728438_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.8	1.5e-89
WP_025713397.1|728437_728716_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.9	1.7e-32
WP_025713398.1|728705_729095_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	79.1	2.6e-47
WP_040235790.1|729789_730839_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.4	8.9e-167
WP_020805698.1|730988_731180_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	81.0	1.6e-21
WP_040235788.1|731389_732220_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	2.9e-59
WP_077255574.1|732238_733225_-	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	48.6	1.1e-89
WP_020804343.1|733306_734128_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	4.0e-90
WP_040235787.1|734217_734616_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	69.7	6.2e-44
WP_023343178.1|734612_735089_-	hypothetical protein	NA	U5P451	Shigella_phage	61.8	1.4e-15
WP_040235785.1|735085_736936_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	52.2	1.5e-196
WP_038808205.1|738298_738757_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_040235782.1|738753_739665_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	73.8	4.4e-53
WP_023322342.1|739654_739834_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_014838121.1|740006_740555_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	66.9	3.0e-65
WP_014838120.1|740635_741103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025714631.1|741336_741567_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	2.7e-12
WP_038808210.1|741664_742297_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	6.0e-33
WP_087855718.1|742569_743085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838118.1|743901_744273_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.5	4.8e-51
WP_014838117.1|744325_745156_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	82.4	9.3e-127
WP_040235856.1|745291_745819_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.3	6.0e-63
WP_023343167.1|745818_746019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040235771.1|746011_746797_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	6.9e-63
WP_040235770.1|746924_747269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040235766.1|747696_747924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838111.1|747920_748472_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	46.0	7.0e-30
WP_040235764.1|748464_748701_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
WP_008806034.1|749001_749238_+	excisionase	NA	NA	NA	NA	NA
WP_008806033.1|749227_750370_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	81.9	1.2e-172
WP_004150800.1|750482_751733_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|751973_752624_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_103215081.1|752641_753100_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_050583690.1|753156_754263_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004140557.1|754317_754959_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_040235761.1|754962_756333_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	1.4e-108
WP_004179354.1|756387_756750_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004179353.1|756833_757640_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150807.1|757922_758594_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_004147969.1|758593_760060_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004176560.1|760145_761267_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_085955203.1|761342_762705_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_023312942.1|763207_763699_-|transposase	transposase	transposase	NA	NA	NA	NA
762679:764123	attR	CCGAACCCAGGCTCTGAGAGCCGCTTAATATGAACCATCCAACTTTATGGGGTCAGTCCACTGCGCTTGCCGGGCCTACGGGTTCCGCGCTCACCGGCTGGACCGCAGGCCGGATAAGGCGAAGCCGCCATCCGGCATAAAGACAGGCACCCGCTCTGATGTTCACCGCCCGGCGGCGCTGCGCTTGCCGGGCCTACAGGTTCCGCGCTCACCGGCTGGACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCATAAAGACAGGCACCCGTTCTGCTGTTCACCGCCCGACGGCGCTGCGCTTGCCGGGCCTACGGTTCCCGCGCTCACCGGCTGAACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCATAAAGACAGGCACCCGCTCTGCTGTTCACCGCCCGGCGGCGCTGCGCTTGCCGGGCCTACGGGTCCCGCGGTCACCGGCTGGACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCACTTTGTGGTTTCGATGGCGGCAATGTCTTACCCGAGCATTATCGCCTCTCGCCTGCATCAAATTCGCTTACCTCACCCGCCCAATCCGTCGGATACCATCCCCGGCGCACATCGCGATGAAAGGTCGAATACGGCCAATCCTGCACCCGACGGACATGACCGTGCTTAACGGGATTGATATAAACGTAATCCATATGCCGTCGGTAATCTTCTTCATTACGGATGGCATGTTCCCAGAATCGCGGCTGCCAGATATGGCGCTGCGCCAGCGCTCGGGTAAACATTTTTTTAATGTCCCGCCAGCGACCGGAATAATCGGTATCCCCCTCAGGTAGGGTCCAGATGCAGTGCATATGCTCTGGTAAAACCACCCAGGCGTTAATCAGAAAAGGTTTTTTGCTTTTAACAGACGCTGTAGCGGCACGCAGATGAACAATATGCCGCGTCAGGAGATCGCTGCGCCGATTTTGCAGGTTAACGGTGAAGAACCAGCAGCCGCCAGGGATATAACTGCGACGATAATCAGACATGTGAGGTTCCCTCCTCAGTATTAGCCTTATCGCTTTTGTCCGGCGGCGCTGCGCTTGCCGGGCCTACGGGTCCCGCGCTCACCGGCTGGACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCATAAAGACAGGCACCCGCTCTGCTGTTCACCGCCCGGCGGCGCTGCGCTTGCCGGGCCTACGGGTTCCGCGCTCACCGGCTGGACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCATAAAGACAGGACCCGCTCTAATGTTGAACGCCCGGCGGCGCTGCGCTTGCCGGGCCTACGGGTTCTGCGGTCACCGTCTGGACCGTAGGCCGGATAAGGCGAAGCCGCCATCCGGCATGAAGACAGGCACCCGCTCTGATGTTGAACGCCCGGCGGCGCTGCGCTTGCCGGGCCTACGGGT	NA	NA	NA	NA
>prophage 5
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	918395	978391	5531975	tail,transposase,integrase,protease,head	Pectobacterium_phage(33.33%)	57	925158:925172	974284:974298
WP_100729764.1|918395_918869_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	3.1e-26
WP_004191051.1|918907_919903_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_100729765.1|919913_920639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100729766.1|920625_920949_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_100729767.1|920951_922616_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.2	4.5e-104
WP_100729768.1|922615_924010_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	2.4e-58
WP_020947865.1|924094_924547_-	hypothetical protein	NA	A3EYX3	Salmonella_phage	66.4	1.5e-49
WP_009308351.1|924553_924814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279624.1|924797_925031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064145708.1|925027_925384_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
925158:925172	attL	AACTCCTCCGCCAGC	NA	NA	NA	NA
WP_071838911.1|925371_925695_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	1.8e-25
WP_100729769.1|925684_926278_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	4.7e-80
WP_100729770.1|926346_926538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100729771.1|926913_927441_-	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	28.7	9.1e-11
WP_133123792.1|927437_928118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215074.1|928130_928823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080922675.1|929063_929297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009308333.1|929300_929951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100729773.1|929989_931378_-	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.3	2.0e-105
WP_004191078.1|931374_932358_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.8	1.3e-39
WP_016197573.1|932360_932519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100729774.1|932602_933049_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	53.2	1.2e-27
WP_100729775.1|933109_933310_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	48.3	1.4e-09
WP_100729776.1|933392_933800_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	50.8	3.7e-28
WP_100729820.1|934730_934964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100729777.1|935008_937138_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	8.0e-98
WP_069135042.1|937137_937704_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_004141609.1|937705_937891_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_004199480.1|938100_938325_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_100729778.1|938328_939366_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	4.0e-95
WP_040236540.1|939632_941285_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|941554_942214_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
WP_002898457.1|942302_942632_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_004893114.1|942628_942910_-	acylphosphatase	NA	NA	NA	NA	NA
WP_023283528.1|942958_943747_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_019705931.1|943764_944319_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_004219213.1|944536_945712_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_002898441.1|945771_946089_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_023283527.1|946131_947007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040236541.1|947153_950288_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_040236543.1|950341_951562_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_040236544.1|951558_953706_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.7e-26
WP_004179227.1|953702_955139_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_064733123.1|956826_957189_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.0	7.9e-14
WP_021567584.1|957185_957536_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	3.3e-41
WP_039264109.1|957566_959159_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.9e-181
WP_004144085.1|967155_967569_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002898432.1|967723_968182_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_040236859.1|968193_970248_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
WP_002898425.1|970372_970819_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002898422.1|970836_972972_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_004179217.1|972985_973582_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_009485781.1|973672_973888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179215.1|973930_974440_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
974284:974298	attR	GCTGGCGGAGGAGTT	NA	NA	NA	NA
WP_002898408.1|974792_975863_+	porin OmpA	NA	NA	NA	NA	NA
WP_002898404.1|975995_976448_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_004147851.1|976633_978391_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 6
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	1059759	1069222	5531975	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|1059759_1061481_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|1061507_1062227_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1062580_1062799_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_040236670.1|1062918_1065198_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	5.6e-166
WP_002896520.1|1065228_1065546_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|1065871_1066093_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|1066169_1068110_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|1068106_1069222_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	1526863	1595215	5531975	transposase,terminase,capsid,integrase,tRNA,holin	Escherichia_phage(18.97%)	87	1544797:1544843	1592286:1592332
WP_002892491.1|1526863_1528381_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|1528712_1530188_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892486.1|1530247_1532395_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_002892484.1|1532477_1533812_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_040236764.1|1534177_1535746_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016156491.1|1536092_1537073_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.0e-185
WP_002892402.1|1537238_1537511_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_040236915.1|1537611_1538532_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	39.7	1.6e-50
WP_032419681.1|1539042_1539909_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004178865.1|1539981_1541286_-	citrate synthase	NA	NA	NA	NA	NA
WP_004142684.1|1541331_1541472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892370.1|1541796_1541967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215066.1|1542045_1542447_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_014386491.1|1542796_1543777_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_002892360.1|1544042_1544336_-	hypothetical protein	NA	NA	NA	NA	NA
1544797:1544843	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_074403793.1|1545431_1545683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215064.1|1547049_1547484_+	sugar transferase	NA	NA	NA	NA	NA
WP_103215063.1|1547450_1547639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074403791.1|1547639_1548347_+	GlcNAc-PI de-N-acetylase	NA	NA	NA	NA	NA
WP_148722504.1|1548437_1548710_-	hypothetical protein	NA	H2DE47	Erwinia_phage	41.6	1.2e-11
WP_088296096.1|1551167_1552211_-	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	41.5	4.4e-17
WP_103215062.1|1552212_1552800_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	42.9	3.2e-33
WP_103215061.1|1552792_1554025_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.5	1.1e-104
WP_001518114.1|1554032_1554389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087775389.1|1554843_1555434_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	23.4	7.6e-06
WP_087775386.1|1555423_1556293_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.5	2.0e-26
WP_019725008.1|1556289_1556595_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_087775383.1|1556596_1557436_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	31.7	3.8e-27
WP_103215060.1|1557439_1559398_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	37.2	9.8e-42
WP_161420570.1|1559378_1559525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215059.1|1559602_1560079_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	3.2e-07
WP_088607471.1|1560131_1560386_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	76.2	1.4e-20
WP_043875683.1|1560388_1561144_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.8	2.8e-61
WP_004196864.1|1561324_1561768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215058.1|1561767_1563249_-	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.4	6.7e-59
WP_064782738.1|1563252_1563804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064782758.1|1563785_1564154_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	30.6	1.5e-07
WP_103215057.1|1564150_1564714_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.9	4.8e-18
WP_041937856.1|1564716_1565160_-	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	38.2	1.1e-12
WP_047671892.1|1565159_1565486_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	42.6	2.1e-10
WP_064782736.1|1565487_1566525_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	4.2e-84
WP_014342913.1|1566524_1567007_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.2e-33
WP_077268467.1|1567008_1568826_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.5	6.9e-58
WP_064782735.1|1568888_1569578_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	54.9	2.9e-65
WP_103215055.1|1569630_1571151_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.2	5.7e-106
WP_103215054.1|1571151_1572828_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.3	3.9e-249
WP_103215053.1|1572829_1573462_-|terminase	terminase small subunit	terminase	A0A2I7RHH8	Vibrio_phage	48.0	1.6e-41
WP_074403790.1|1573583_1573706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064782732.1|1573920_1574310_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	45.2	1.1e-21
WP_064782756.1|1574306_1574804_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	9.6e-79
WP_064782731.1|1574781_1575051_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
WP_065520806.1|1575766_1576576_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	77.0	4.8e-120
WP_103215052.1|1576572_1576713_-	YlcG family protein	NA	NA	NA	NA	NA
WP_103215051.1|1576709_1576940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215050.1|1576936_1577545_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.7	2.3e-50
WP_032413853.1|1577537_1577708_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_103215049.1|1577713_1578310_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.3e-57
WP_103215048.1|1578473_1578713_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.3e-09
WP_103215046.1|1578893_1579091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116287994.1|1579083_1580055_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	93.0	1.2e-64
WP_004191573.1|1580051_1580564_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.6	4.8e-73
WP_004191575.1|1580563_1581238_-	hypothetical protein	NA	A0A2H4FRZ0	Salmonella_phage	49.7	1.6e-28
WP_004191576.1|1581234_1581504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215129.1|1581500_1582064_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	42.9	8.2e-10
WP_040182091.1|1582300_1582594_-	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.1e-25
WP_040182092.1|1582590_1583439_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_103215045.1|1583435_1584296_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.6	3.5e-60
WP_001548453.1|1584382_1584604_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_040182097.1|1584643_1584865_-	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.1	1.8e-13
WP_029363661.1|1584967_1585663_+	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	62.4	8.2e-76
WP_103215044.1|1585682_1586117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073970525.1|1586460_1586586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032717012.1|1586578_1586773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080901445.1|1586861_1587146_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	3.3e-39
WP_103215043.1|1587161_1588007_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	2.0e-68
WP_080850838.1|1588003_1588684_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.0	1.1e-122
WP_103215042.1|1588680_1589109_+	regulator	NA	M9NYX4	Enterobacteria_phage	81.0	7.5e-64
WP_065800368.1|1589105_1589762_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_009483861.1|1589758_1589977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483862.1|1589973_1590198_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	9.2e-21
WP_048269240.1|1590194_1590680_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	61.9	1.2e-30
WP_009483816.1|1590676_1590895_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
WP_103215041.1|1590896_1591232_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_021441323.1|1591108_1592272_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_004143017.1|1592703_1593570_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1592286:1592332	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|1593571_1593784_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|1593829_1595215_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 8
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	4149073	4203363	5531975	portal,tail,transposase,terminase,integrase,capsid,protease,head,holin	Klebsiella_phage(55.56%)	73	4153686:4153708	4166198:4166220
WP_000019445.1|4149073_4150054_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_085783913.1|4150373_4150736_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004174789.1|4150746_4151319_-	flavin oxidoreductase	NA	NA	NA	NA	NA
WP_023313546.1|4151530_4152415_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180956.1|4152539_4153340_+	hypothetical protein	NA	NA	NA	NA	NA
4153686:4153708	attL	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
WP_023313544.1|4154377_4155094_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_023313543.1|4155398_4157732_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	81.7	0.0e+00
WP_004185276.1|4157743_4158064_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004185275.1|4158060_4158288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158236957.1|4158284_4158656_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	68.5	8.0e-30
WP_072041630.1|4158567_4158834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556592.1|4158830_4159097_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_032409532.1|4159201_4159339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313542.1|4159638_4160376_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.7	7.1e-70
WP_023313541.1|4160372_4160618_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	5.0e-20
WP_023313540.1|4160635_4161202_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.1e-59
WP_074376113.1|4161273_4161423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313539.1|4161723_4163883_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_023313538.1|4163884_4164802_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_032415394.1|4164956_4166147_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.0	3.4e-106
WP_023317197.1|4166477_4167386_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	97.0	2.4e-168
4166198:4166220	attR	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
WP_023317196.1|4167873_4169049_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	93.8	7.3e-210
WP_023317195.1|4169003_4169216_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	74.2	8.4e-24
WP_004218013.1|4169273_4169387_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_023317194.1|4169482_4169707_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	2.4e-29
WP_032441077.1|4169696_4170422_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	98.3	2.7e-130
WP_004152153.1|4170427_4170946_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004152154.1|4171050_4171878_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_009309071.1|4171874_4172069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|4172065_4172491_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004146412.1|4172487_4172610_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152157.1|4172677_4172932_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004218017.1|4172924_4173086_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152159.1|4173459_4173648_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|4173640_4173955_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|4174125_4174794_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|4174891_4175113_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|4175689_4177348_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|4177349_4178312_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|4178308_4178785_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_023317191.1|4178781_4179564_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	100.0	9.0e-148
WP_023317190.1|4179783_4180332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317188.1|4180583_4180976_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	72.2	4.6e-44
WP_023317187.1|4180965_4181244_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	75.0	5.3e-34
WP_023316711.1|4181243_4181873_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.4	1.5e-105
WP_040236329.1|4181880_4182156_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	73.0	8.9e-26
WP_023316713.1|4182391_4182676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023316714.1|4182812_4183013_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	1.3e-18
WP_023304956.1|4183409_4183655_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	4.7e-18
WP_023316716.1|4184073_4184370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023316717.1|4184426_4184660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040236333.1|4184647_4184998_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.1	1.0e-50
WP_016530193.1|4185153_4185651_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
WP_025108055.1|4185654_4187406_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	4.0e-252
WP_016530191.1|4187402_4187564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530190.1|4187553_4188780_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_000999827.1|4188772_4189372_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_004104235.1|4189381_4190620_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_004104233.1|4190697_4191015_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	1.2e-21
WP_004899632.1|4191084_4191282_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_004104230.1|4191283_4191616_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	6.5e-55
WP_040236338.1|4191608_4192148_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	93.3	8.5e-89
WP_004104227.1|4192144_4192510_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.9	8.4e-64
WP_004104226.1|4192566_4193058_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
WP_023317181.1|4193101_4193455_+	hypothetical protein	NA	A0A286S1N4	Klebsiella_phage	79.5	1.3e-48
WP_023317180.1|4193487_4193751_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	86.0	8.2e-37
WP_023317179.1|4193830_4194442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317178.1|4194495_4196796_+	hypothetical protein	NA	A0A286S1S3	Klebsiella_phage	51.1	5.3e-180
WP_102004210.1|4196795_4197275_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	97.5	5.6e-92
WP_040236343.1|4197261_4197744_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.1	1.1e-84
WP_004152651.1|4197753_4198134_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_040235674.1|4198130_4201199_+	kinase	NA	A0A286S259	Klebsiella_phage	97.3	0.0e+00
WP_040235742.1|4202070_4203363_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	37.0	3.1e-68
>prophage 9
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	4259496	4305851	5531975	tail,holin,terminase,integrase	Salmonella_phage(28.0%)	65	4257152:4257166	4305461:4305475
4257152:4257166	attL	CCCGGGTGATGGCCG	NA	NA	NA	NA
WP_023301229.1|4259496_4260726_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.3e-238
WP_023301228.1|4260703_4260979_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
WP_071557557.1|4261017_4261257_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
WP_023301227.1|4261264_4261573_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	3.2e-24
WP_103215013.1|4261569_4262172_-	hypothetical protein	NA	R9VWB9	Serratia_phage	51.4	1.7e-53
WP_103215012.1|4262206_4263295_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.5	4.4e-108
WP_103215011.1|4263307_4266406_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.6	4.3e-294
WP_016946289.1|4266543_4266699_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_004179600.1|4266707_4266899_-	YebW family protein	NA	NA	NA	NA	NA
WP_029602856.1|4267364_4267568_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	76.1	1.1e-20
WP_032438209.1|4267596_4268007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602857.1|4268133_4268520_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	92.9	1.0e-56
WP_029602858.1|4268623_4268854_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	85.9	3.2e-29
WP_029602859.1|4268856_4269420_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	44.1	3.6e-29
WP_071826821.1|4269764_4269953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073545905.1|4269967_4270876_+	DNA-binding protein	NA	V5URT9	Shigella_phage	53.9	8.4e-89
WP_032417026.1|4270878_4271628_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_023286280.1|4271635_4271971_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
WP_103215010.1|4271963_4272749_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	9.6e-65
WP_162862895.1|4272864_4273380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070550162.1|4273376_4273781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215008.1|4273777_4274407_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_158649457.1|4274403_4274553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215007.1|4275184_4275469_+	hypothetical protein	NA	A0A0S1S1U7	Klebsiella_phage	94.7	3.8e-48
WP_162862896.1|4275468_4275639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040241897.1|4275803_4276031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032423783.1|4276406_4276640_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	70.1	5.8e-26
WP_071557491.1|4276744_4276993_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_016946309.1|4277027_4277624_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_103215124.1|4277831_4278128_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	9.2e-37
WP_032755220.1|4278124_4278481_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	65.8	1.4e-42
WP_103215006.1|4278596_4279418_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	66.1	2.9e-96
WP_029497337.1|4279662_4280049_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	89.8	1.6e-57
WP_000243811.1|4280035_4280317_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_103215005.1|4280316_4280946_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	4.2e-87
WP_103215004.1|4280948_4281224_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	93.4	7.1e-07
WP_103215003.1|4281174_4281363_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	91.5	4.3e-24
WP_103215002.1|4281751_4281988_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	60.3	6.5e-17
WP_064142403.1|4282045_4282234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215001.1|4282237_4283242_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.1	3.8e-34
WP_103215000.1|4283219_4284527_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.1	1.5e-150
WP_103214999.1|4284526_4285927_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	6.4e-128
WP_103214998.1|4285910_4287023_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.7	4.8e-110
WP_103214997.1|4287107_4287893_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.8	3.8e-69
WP_032410237.1|4287903_4288857_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	1.1e-131
WP_134156008.1|4288865_4289138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038808181.1|4289178_4289574_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	42.5	2.1e-12
WP_004190649.1|4289575_4289830_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004190646.1|4289839_4290073_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_103214996.1|4290059_4290443_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	5.4e-21
WP_103214995.1|4290444_4290996_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	42.8	5.0e-28
WP_103214994.1|4290992_4291385_+	electron transfer flavoprotein subunit beta	NA	A0A059VK45	Pseudomonas_phage	31.5	1.5e-13
WP_103214993.1|4291408_4292581_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.0e-22
WP_103214992.1|4292635_4293118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807842.1|4293255_4293462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|4293538_4293895_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_103214991.1|4293942_4294308_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	48.3	1.0e-05
WP_103214990.1|4294403_4298030_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	29.8	1.1e-78
WP_103214989.1|4298059_4298287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103214988.1|4298344_4298809_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.5	7.9e-51
WP_023317177.1|4298805_4299288_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	7.2e-79
WP_103214987.1|4299297_4299666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103214986.1|4299794_4300175_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	93.7	7.6e-68
WP_103214985.1|4300171_4303240_+	kinase	NA	A0A286S259	Klebsiella_phage	90.7	0.0e+00
WP_158649456.1|4305578_4305851_+	hypothetical protein	NA	H2DE47	Erwinia_phage	40.4	8.0e-11
4305461:4305475	attR	CCCGGGTGATGGCCG	NA	NA	NA	NA
>prophage 10
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	4710109	4717014	5531975	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_064162399.1|4710109_4710973_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|4710983_4711757_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_074177879.1|4711997_4712894_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	30.2	2.1e-15
WP_004144192.1|4713136_4714498_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|4714816_4715539_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004214740.1|4715535_4717014_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 11
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	4758391	4766769	5531975		Enterobacteria_phage(28.57%)	9	NA	NA
WP_064782645.1|4758391_4759798_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	28.8	2.9e-27
WP_064782646.1|4760021_4761086_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	1.9e-103
WP_064782647.1|4761112_4761982_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	1.5e-111
WP_004175259.1|4762013_4762904_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175260.1|4762918_4763473_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175261.1|4763652_4764819_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_032409012.1|4765242_4765365_-	small membrane protein	NA	NA	NA	NA	NA
WP_001741931.1|4765555_4765696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040215970.1|4765764_4766769_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 12
NZ_CP026392	Klebsiella pneumoniae strain KPNIH48 chromosome, complete genome	5531975	4874578	4929702	5531975	coat,terminase,integrase,head,tRNA,holin	Escherichia_phage(22.03%)	75	4880974:4880996	4926989:4927011
WP_004151452.1|4874578_4876312_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|4876547_4877117_+	VOC family protein	NA	NA	NA	NA	NA
WP_004180440.1|4877193_4877937_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_004151451.1|4878018_4879023_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|4879019_4879763_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|4879802_4880198_-	membrane protein	NA	NA	NA	NA	NA
WP_100097892.1|4880250_4881024_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
4880974:4880996	attL	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_103215090.1|4881026_4882286_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	90.2	8.1e-223
WP_016244760.1|4882328_4882574_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_103215091.1|4882577_4882796_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	50.0	3.3e-07
WP_032442372.1|4882792_4882984_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_032442371.1|4882980_4883205_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	1.6e-20
WP_104457645.1|4883527_4884001_-	hypothetical protein	NA	B4XYU1	Lactobacillus_phage	43.2	7.9e-22
WP_023283323.1|4883997_4884156_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_065953852.1|4884152_4884776_-	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	49.0	4.6e-46
WP_074181085.1|4884772_4885081_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	33.3	3.8e-09
WP_094819271.1|4885287_4885572_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	80.9	5.0e-40
WP_103215093.1|4885579_4886551_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	89.3	7.4e-67
WP_019704100.1|4886638_4886833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322075.1|4886825_4886936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215094.1|4886932_4887202_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	42.9	6.9e-07
WP_032453660.1|4887561_4888251_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.7	5.1e-62
WP_004151299.1|4888378_4888612_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004139615.1|4888652_4888874_+	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_024622726.1|4888959_4889757_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	3.5e-91
WP_104457650.1|4889816_4890782_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	79.3	1.8e-65
WP_019704107.1|4890778_4891516_+	Replication protein 14	NA	A0A0K2FIT1	Enterobacteria_phage	55.6	3.1e-65
WP_103215095.1|4891512_4891815_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048987997.1|4892248_4892644_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	80.6	8.8e-59
WP_162837911.1|4893175_4893343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162443.1|4893339_4894011_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	30.0	1.9e-05
WP_039108779.1|4894424_4894745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805077.1|4895099_4895567_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	5.7e-33
WP_004196828.1|4895547_4895718_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	3.3e-15
WP_103215050.1|4895710_4896319_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.7	2.3e-50
WP_004196866.1|4896315_4896699_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	43.8	1.0e-19
WP_074399076.1|4896695_4896836_+	YlcG family protein	NA	NA	NA	NA	NA
WP_065520806.1|4896832_4897642_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	77.0	4.8e-120
WP_064782731.1|4898678_4898948_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
WP_064782756.1|4898925_4899423_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	9.6e-79
WP_064782732.1|4899419_4899809_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	45.2	1.1e-21
WP_072198339.1|4900023_4900146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215096.1|4900267_4900915_+	hypothetical protein	NA	I6S676	Salmonella_phage	79.6	2.0e-100
WP_103215097.1|4900945_4901434_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.5e-47
WP_103215098.1|4901430_4902999_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	86.8	6.2e-289
WP_103215099.1|4903010_4904462_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	52.1	5.4e-122
WP_162862897.1|4904379_4905390_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.8	5.6e-118
WP_074167271.1|4905529_4906048_+	hypothetical protein	NA	Q4TZV0	Escherichia_virus	39.9	9.2e-24
WP_103215100.1|4906121_4907477_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.1	8.6e-130
WP_016529582.1|4907476_4907938_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_103215101.1|4907934_4908990_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	3.8e-101
WP_029884066.1|4909022_4909262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178849.1|4909264_4909645_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
WP_071599334.1|4909644_4909818_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	2.4e-13
WP_046654827.1|4909817_4910180_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	1.6e-19
WP_004151265.1|4910182_4910608_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_032442345.1|4910604_4910997_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.2	9.7e-34
WP_102083127.1|4911065_4911818_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	4.4e-43
WP_032442344.1|4911870_4912548_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.5	1.8e-72
WP_065890240.1|4912723_4913479_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	1.8e-60
WP_064147641.1|4913481_4913736_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	71.4	4.4e-19
WP_063443022.1|4913810_4914245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254637.1|4914285_4914639_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_064484068.1|4914764_4914932_+	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
WP_050597782.1|4914918_4915623_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	43.9	9.0e-38
WP_103215103.1|4915688_4916474_+	Bro-N domain-containing protein	NA	A0A2L1IV39	Escherichia_phage	59.3	3.2e-84
WP_103215104.1|4916564_4920005_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	47.3	1.7e-153
WP_031590297.1|4920047_4920524_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004199076.1|4920523_4920994_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_065242176.1|4920990_4921386_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	2.3e-35
WP_104457646.1|4921372_4923850_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.2	1.1e-196
WP_104457647.1|4923938_4926218_+	hypothetical protein	NA	A0A0H5ARL8	Pseudomonas_phage	38.7	4.2e-12
WP_158649464.1|4926224_4926497_+	hypothetical protein	NA	H2DE47	Erwinia_phage	42.0	2.1e-11
WP_004145564.1|4927080_4927647_-	hydrolase	NA	NA	NA	NA	NA
4926989:4927011	attR	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_049000419.1|4927914_4929702_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
>prophage 1
NZ_CP026394	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-e937, complete sequence	63725	0	11921	63725	transposase	Salmonella_phage(33.33%)	8	NA	NA
WP_001553819.1|463_3361_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001010162.1|4031_5783_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_000855178.1|5800_6163_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001114211.1|6210_6564_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.6	1.7e-24
WP_004152397.1|7282_8602_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|8851_9733_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|10119_10899_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|10895_11921_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
>prophage 2
NZ_CP026394	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-e937, complete sequence	63725	19767	26466	63725	transposase	Bacillus_phage(40.0%)	8	NA	NA
WP_086539212.1|19767_20631_+	DNA polymerase III subunit epsilon	NA	K7RFY5	Vibrio_phage	34.9	3.3e-26
WP_000429587.1|20683_21079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176304.1|21075_21687_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728912.1|21683_22613_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.9e-75
WP_000091963.1|22736_23333_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.4	1.4e-20
WP_000753365.1|23745_24180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000671200.1|24388_25789_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.7	8.3e-19
WP_001188929.1|25785_26466_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	35.4	2.1e-31
>prophage 3
NZ_CP026394	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-e937, complete sequence	63725	31548	38793	63725		Clostridium_phage(33.33%)	5	NA	NA
WP_020804286.1|31548_32289_+	peptidoglycan DD-metalloendopeptidase family protein	NA	E5G070	Clostridium_phage	33.3	6.1e-13
WP_000843500.1|32319_32517_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_003830763.1|32547_35001_-	Ag(+)-translocating P-type ATPase SilP	NA	E4ZFI9	Streptococcus_phage	34.9	1.3e-80
WP_000758233.1|35119_35560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000574019.1|35646_38793_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	2.3e-61
>prophage 4
NZ_CP026394	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-e937, complete sequence	63725	42144	56339	63725		Bacillus_phage(18.18%)	15	NA	NA
WP_000697973.1|42144_42825_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
WP_015059177.1|42826_44296_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
WP_000725002.1|44532_44964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695683.1|45112_45463_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
WP_003830762.1|45634_47461_-	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
WP_000817638.1|48068_49274_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_000756331.1|49270_50242_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
WP_000457553.1|50387_51659_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
WP_000600201.1|51658_52081_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_000334635.1|52260_52932_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
WP_000085947.1|53283_53961_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_001104877.1|53960_54182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274510.1|54192_54612_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_086539209.1|54729_54879_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_162862901.1|55832_56339_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.2	7.4e-18
>prophage 5
NZ_CP026394	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-e937, complete sequence	63725	62315	62741	63725		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000065805.1|62315_62741_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
>prophage 1
NZ_CP026395	Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-edb7, complete sequence	80642	4684	29997	80642	transposase,protease	Escherichia_phage(38.46%)	21	NA	NA
WP_040119742.1|4684_5338_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032451295.1|5417_5801_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_004187436.1|5905_6301_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_040119761.1|6345_7608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206886.1|7618_8569_+	DsbC family protein	NA	NA	NA	NA	NA
WP_004187443.1|8581_10669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381802.1|11348_11882_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000027057.1|12277_13138_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|13320_13878_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_071881521.1|14039_14345_+	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	97.9	7.3e-21
WP_001067855.1|14235_14940_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000608644.1|15241_16504_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_002210513.1|18289_19051_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|19071_19932_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|20068_20773_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012954666.1|21084_21729_-	quinolone resistance pentapeptide repeat protein QnrB19	NA	NA	NA	NA	NA
WP_001067855.1|22406_23111_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004199234.1|23635_24517_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|24766_26086_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_000509966.1|26399_27005_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001553819.1|27099_29997_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 1
NZ_CP026397	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence	220406	75295	116374	220406	integrase,transposase	Escherichia_phage(27.78%)	46	88701:88715	118447:118461
WP_001567368.1|75295_76699_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|76796_78329_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_004196353.1|78534_79875_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|79963_81496_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_104457669.1|81485_83198_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_009310020.1|83562_84603_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_100250078.1|84772_86148_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	73.6	2.7e-78
WP_023280872.1|86348_86723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568059.1|86778_87105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|87101_87830_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_020804497.1|87826_88258_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_009310025.1|88302_90360_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
88701:88715	attL	TGGAGCAGGCGGTGC	NA	NA	NA	NA
WP_001568055.1|90429_90678_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_023280871.1|90726_91269_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_080828645.1|92099_92663_-	methyltransferase	NA	M4M9L8	Vibrio_phage	38.5	1.7e-18
WP_020805675.1|92710_94066_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001568051.1|94117_94348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568050.1|94439_94667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162823166.1|94685_94814_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_004118473.1|95448_95766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804372.1|95800_96055_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	55.8	1.9e-14
WP_020804371.1|96248_96440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023280869.1|96482_96989_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	32.0	4.1e-08
WP_162862903.1|97031_97697_-	antirestriction protein	NA	NA	NA	NA	NA
WP_104457662.1|98139_98907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023280866.1|98960_99380_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|99389_99611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023280865.1|99610_100312_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	2.7e-26
WP_074184477.1|100513_100630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309993.1|100748_100979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804632.1|101039_101711_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_004152353.1|101713_102685_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_162862904.1|102933_104421_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.5	5.0e-30
WP_073553741.1|104733_104850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568036.1|104827_105259_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_048268858.1|105258_106530_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	2.0e-152
WP_162862905.1|106611_107586_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.5	4.2e-86
WP_009484138.1|107585_108791_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_000362086.1|109905_110733_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_073553764.1|111190_111439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048268866.1|111620_111851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073553762.1|111942_112896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104457665.1|112976_113795_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_073553761.1|113937_114387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073553760.1|114458_115169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048268853.1|115591_116374_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	86.6	3.9e-50
118447:118461	attR	TGGAGCAGGCGGTGC	NA	NA	NA	NA
>prophage 2
NZ_CP026397	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence	220406	123739	170099	220406	protease,transposase	Bacillus_phage(30.77%)	47	NA	NA
WP_009309912.1|123739_124375_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_009309911.1|124482_124827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047057603.1|126275_126716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309909.1|126734_127328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|127619_127850_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|127846_128263_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_009309907.1|128336_129899_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|129883_130906_+	helicase UvrD	NA	NA	NA	NA	NA
WP_014343466.1|130977_131100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|131726_132707_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_004187110.1|133743_134094_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
WP_020803533.1|134241_134673_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|134923_136399_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|136391_137072_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_023280925.1|137261_138647_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|138675_139029_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004098959.1|139142_140435_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|140445_143592_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_048321744.1|143678_144119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048270276.1|144245_146693_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.6	1.3e-83
WP_000843497.1|146733_146931_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|146964_147702_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_001023257.1|147990_148440_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|148673_150491_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|150490_151387_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|151426_151807_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004213583.1|151811_152741_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|152795_153476_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|153472_154873_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004118347.1|155088_155523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654306.1|155901_156021_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004118349.1|155986_156166_-	antitoxin	NA	NA	NA	NA	NA
WP_032415726.1|156479_156728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200905.1|156724_157957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200903.1|158090_158582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839182.1|158950_159355_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_000612626.1|159351_159699_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_023316587.1|159747_161286_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	6.1e-281
WP_017896554.1|162268_162577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087759866.1|162683_163804_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_001567366.1|164295_164844_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|164890_165325_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003026799.1|165569_165836_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|165823_166306_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|166506_167910_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|167938_168571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427620.1|169094_170099_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP026396	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence	144072	7612	66045	144072	integrase,tRNA,transposase,protease	Stx2-converting_phage(27.27%)	42	37796:37811	61210:61225
WP_000019450.1|7612_8593_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_101883334.1|8839_13861_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.2	6.4e-53
WP_158236899.1|13874_21464_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	24.8	4.9e-65
WP_101883336.1|21456_22239_-	thioesterase	NA	NA	NA	NA	NA
WP_101883337.1|22317_23538_-	MFS transporter	NA	NA	NA	NA	NA
WP_101883342.1|25279_26005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883460.1|26254_27658_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_064157089.1|27686_28319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087859135.1|28647_29814_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_087851471.1|30194_31613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087859136.1|31674_32979_+	KamA family radical SAM protein	NA	NA	NA	NA	NA
WP_087859137.1|32978_34424_+|tRNA	class I tRNA ligase family protein	tRNA	NA	NA	NA	NA
WP_087859138.1|34401_35571_+	MFS transporter	NA	NA	NA	NA	NA
WP_087851463.1|35567_35810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101883343.1|36082_36313_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	55.9	8.0e-12
WP_087859140.1|36564_37179_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_032432545.1|37273_40303_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
37796:37811	attL	GTTCGCCTTCTCACCG	NA	NA	NA	NA
WP_010465829.1|40286_40889_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.3	1.6e-40
WP_000182276.1|41080_41437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001172026.1|41438_41774_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000741275.1|41788_42124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091614.1|42147_42474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054412.1|42470_42851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457654.1|42968_44228_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_020326536.1|44812_45808_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
WP_104457655.1|45943_46273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001553819.1|46188_49086_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|49180_49786_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_104457656.1|49801_50248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065551.1|51432_52446_-	replication protein	NA	NA	NA	NA	NA
WP_022631532.1|52438_52990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386216.1|52982_53060_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_022631531.1|53271_53541_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032713666.1|53913_54363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032713668.1|54352_56290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032713670.1|56286_58086_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032713672.1|58082_59276_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_039264109.1|60528_62121_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.9e-181
61210:61225	attR	CGGTGAGAAGGCGAAC	NA	NA	NA	NA
WP_021567584.1|62151_62502_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	3.3e-41
WP_064733123.1|62498_62861_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.0	7.9e-14
WP_032713779.1|64147_65401_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044060787.1|65403_66045_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP026396	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence	144072	125869	132864	144072	integrase	Escherichia_phage(50.0%)	7	131414:131427	141990:142003
WP_004152353.1|125869_126841_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_001568036.1|127074_127506_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004197646.1|127505_128777_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_004098982.1|129188_130064_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197649.1|130712_131339_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
131414:131427	attL	AAAGTGACTTCAGA	NA	NA	NA	NA
WP_077253981.1|131458_131638_+	Par-like protein	NA	NA	NA	NA	NA
WP_004197635.1|132069_132864_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
141990:142003	attR	TCTGAAGTCACTTT	NA	NA	NA	NA
>prophage 1
NZ_CP026398	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence	249238	16365	33984	249238	tail,transposase	Escherichia_phage(29.41%)	26	NA	NA
WP_004197197.1|16365_17607_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
WP_004026392.1|18265_18430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386579.1|18490_18946_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_004026394.1|19233_19842_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
WP_103214932.1|19911_20361_-|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
WP_162140056.1|20905_21073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120310.1|21129_21402_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_016947069.1|21671_21857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103214931.1|21856_22546_-	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.4e-19
WP_016947068.1|22542_23025_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
WP_065801655.1|23361_23577_-	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	6.1e-14
WP_004197183.1|23780_23996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197228.1|24275_24662_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_004883219.1|25078_25723_-	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_103214930.1|25719_25947_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.9e-10
WP_062826758.1|26424_26613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386581.1|26609_27107_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	57.0	1.5e-23
WP_000019445.1|27285_28266_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_004026415.1|28400_28619_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_004197205.1|28784_29036_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026416.1|29156_29471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026417.1|29551_29872_-	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_000654812.1|30281_31250_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
WP_004181845.1|31531_31825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181844.1|31841_32423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|32496_33984_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 2
NZ_CP026398	Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence	249238	123071	179142	249238	integrase,transposase,protease	Caulobacter_phage(20.0%)	55	123538:123556	131534:131552
WP_087759866.1|123071_124192_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
123538:123556	attL	CCTGTGGCCAGTGCGTCCA	NA	NA	NA	NA
WP_004181765.1|124816_125035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|125622_125865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|125912_126377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186937.1|126386_126794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065801680.1|126836_127796_+	DNA replication protein	NA	NA	NA	NA	NA
WP_042934801.1|127792_128551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|128547_128871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026552.1|129021_129339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386529.1|129404_130541_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004178082.1|130626_132114_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
131534:131552	attR	CCTGTGGCCAGTGCGTCCA	NA	NA	NA	NA
WP_016946352.1|132626_132881_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_065801681.1|132966_134034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158649448.1|134688_135231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|135391_136276_-	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_000509966.1|136850_137456_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001553819.1|137550_140448_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_004026565.1|141192_141645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065801682.1|141887_142202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181742.1|143176_143389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049007085.1|143482_143761_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004118061.1|144308_144713_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004196929.1|144988_145471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196935.1|145849_147349_-	kinase	NA	NA	NA	NA	NA
WP_032720947.1|147376_149110_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|149109_150150_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026585.1|150242_150881_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|150881_151523_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_014386542.1|151547_152186_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026591.1|152665_153124_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_032720946.1|153126_154350_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_065800116.1|154360_155317_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_065801645.1|155316_156396_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.6e-40
WP_004181732.1|156397_157171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049125915.1|157163_158306_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.0	8.3e-33
WP_103214909.1|158317_159376_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_004210240.1|159687_160272_+	tellurium resistance protein	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
WP_023287201.1|160268_161420_+	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004026604.1|161442_161898_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_004026607.1|161921_162962_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026609.1|163000_163579_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026611.1|163665_164241_+	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_065892223.1|164325_165567_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	24.7	1.8e-09
WP_001100942.1|165903_166551_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004181725.1|167135_167525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016947102.1|167590_168349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078207737.1|168581_169313_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004181720.1|169572_170175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181719.1|171167_172439_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_032455404.1|172621_173116_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	34.2	6.1e-17
WP_004181718.1|173226_174045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181717.1|174448_174847_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001567369.1|175433_176066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|176094_177498_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|177609_179142_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
