The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026324	Helicobacter pylori strain 26695-dRdM2 chromosome, complete genome	1666735	1018513	1070430	1666735	integrase,tRNA,transposase	Helicobacter_phage(50.0%)	42	1029019:1029038	1080353:1080372
WP_001150920.1|1018513_1019425_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_001862971.1|1020507_1020969_-	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	47.1	1.3e-05
WP_001862974.1|1020961_1022305_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_010875568.1|1022301_1023393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875569.1|1023302_1024634_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_010875570.1|1024630_1026280_-	GTPase	NA	NA	NA	NA	NA
WP_000271456.1|1026500_1026788_-	endoribonuclease VapD	NA	NA	NA	NA	NA
WP_000880322.1|1026857_1027139_-	DUF3240 family protein	NA	NA	NA	NA	NA
WP_000978968.1|1027154_1030217_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.7	2.8e-83
1029019:1029038	attL	ATGAGCATGCCTATAGCGAT	NA	NA	NA	NA
WP_000816822.1|1030213_1031293_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_010875571.1|1031289_1032531_-	TolC family protein	NA	NA	NA	NA	NA
WP_000555186.1|1032580_1034686_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000682021.1|1034797_1035859_+	hypothetical protein	NA	A0A2D1GN01	Pseudoalteromonas_phage	30.1	2.0e-09
WP_000057737.1|1035871_1037347_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001165207.1|1037361_1037643_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_001010809.1|1037762_1039073_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_000574070.1|1039201_1040665_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000400290.1|1040680_1042159_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_000233600.1|1042289_1043447_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_049794234.1|1044910_1045183_+	exonuclease VII large subunit	NA	NA	NA	NA	NA
WP_010875573.1|1045554_1046250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169565.1|1046250_1046541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343415.1|1047099_1047924_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010875574.1|1048133_1048457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875575.1|1048759_1049473_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_000886948.1|1050856_1051090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010875484.1|1051096_1051525_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
WP_000930565.1|1051594_1052878_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.0	2.6e-200
WP_010875578.1|1053026_1054829_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001120382.1|1055978_1057046_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.7e-08
WP_000009099.1|1057362_1058166_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000006537.1|1058137_1058389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875576.1|1058974_1059604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080012132.1|1059608_1060322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000930564.1|1060370_1061654_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.2	1.2e-200
WP_010875484.1|1061723_1062152_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
WP_000587397.1|1062733_1063390_+	ParA family protein	NA	A2I303	Vibrio_virus	23.4	7.1e-05
WP_000394638.1|1063474_1063759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000665511.1|1063802_1064987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065304.1|1067202_1067517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254056.1|1068067_1068601_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_001862466.1|1070013_1070430_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	96.4	4.6e-74
1080353:1080372	attR	ATCGCTATAGGCATGCTCAT	NA	NA	NA	NA
