The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026325	Helicobacter pylori strain dRdM1 chromosome, complete genome	1670779	1022357	1074276	1670779	tRNA,integrase,transposase	Helicobacter_phage(50.0%)	44	1032864:1032883	1084199:1084218
WP_001150920.1|1022357_1023269_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000401714.1|1023282_1024221_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001862971.1|1024352_1024814_-	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	47.1	1.3e-05
WP_001862974.1|1024806_1026150_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_010875568.1|1026146_1027238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875569.1|1027147_1028479_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_010875570.1|1028475_1030125_-	GTPase	NA	NA	NA	NA	NA
WP_000271456.1|1030345_1030633_-	endoribonuclease VapD	NA	NA	NA	NA	NA
WP_000880322.1|1030702_1030984_-	DUF3240 family protein	NA	NA	NA	NA	NA
WP_000978968.1|1030999_1034062_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.7	2.8e-83
1032864:1032883	attL	ATGAGCATGCCTATAGCGAT	NA	NA	NA	NA
WP_000816822.1|1034058_1035138_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_103433688.1|1035134_1036370_-	TolC family protein	NA	NA	NA	NA	NA
WP_000555186.1|1036419_1038525_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000682021.1|1038636_1039698_+	hypothetical protein	NA	A0A2D1GN01	Pseudoalteromonas_phage	30.1	2.0e-09
WP_000057737.1|1039710_1041186_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001165207.1|1041200_1041482_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_001010809.1|1041601_1042912_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_000574070.1|1043040_1044504_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000400290.1|1044519_1045998_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_000233600.1|1046128_1047286_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001863015.1|1048443_1048746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049794234.1|1048756_1049029_+	exonuclease VII large subunit	NA	NA	NA	NA	NA
WP_010875573.1|1049400_1050096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169565.1|1050096_1050387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343415.1|1050945_1051770_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010875574.1|1051979_1052303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875575.1|1052605_1053319_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_000886948.1|1054702_1054936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010875484.1|1054942_1055371_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
WP_000930565.1|1055440_1056724_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.0	2.6e-200
WP_010875578.1|1056872_1058675_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001120382.1|1059824_1060892_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.7e-08
WP_000009099.1|1061208_1062012_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_000006537.1|1061983_1062235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010875576.1|1062820_1063450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080012132.1|1063454_1064168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000930564.1|1064216_1065500_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.2	1.2e-200
WP_010875484.1|1065569_1065998_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	8.6e-76
WP_000587397.1|1066579_1067236_+	ParA family protein	NA	A2I303	Vibrio_virus	23.4	7.1e-05
WP_000394638.1|1067320_1067605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000665511.1|1067648_1068833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065304.1|1071048_1071363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254056.1|1071913_1072447_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_001862466.1|1073859_1074276_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	96.4	4.6e-74
1084199:1084218	attR	ATCGCTATAGGCATGCTCAT	NA	NA	NA	NA
>prophage 2
NZ_CP026325	Helicobacter pylori strain dRdM1 chromosome, complete genome	1670779	1430839	1438559	1670779		Escherichia_phage(33.33%)	7	NA	NA
WP_103433681.1|1430839_1431481_-	copper response regulator transcription factor CrdR	NA	A0A1V0SKI5	Klosneuvirus	27.5	6.3e-06
WP_000412211.1|1432095_1432755_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_103433682.1|1433776_1434559_-	site-specific DNA-methyltransferase	NA	S0A0D5	Cellulophaga_phage	33.1	1.8e-18
WP_103433683.1|1434545_1435136_-	site-specific DNA-methyltransferase	NA	A0A1D8KJW7	Synechococcus_phage	36.6	5.2e-15
WP_022542381.1|1435289_1435754_-	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_103433684.1|1436091_1437516_+	site-specific DNA-methyltransferase	NA	I7KLR2	Campylobacter_virus	52.3	9.7e-23
WP_103433685.1|1437521_1438559_+	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	52.6	3.6e-19
